Journal of Indonesian Natural History [PDF]

Journal of

Indonesian Natural History

July 2014 Vol.2 No.1

Journal of Indonesian Natural History Editors Dr. Wilson Novarino

Dr. Carl Traeholt

Associate Professor for Biology Department of Biology University of Andalas, Indonesia

Programme Director, Southeast Asia Research and Conservation Division Copenhagen Zoo, Denmark

Email: [email protected]

Email: [email protected]

Editorial board Dr. Ardinis Arbain

Dr. Ramadhanil Pitopang

University of Andalas, Indonesia

Tadulako University, Indonesia

Indra Arinal

Dr. Lilik Budi Prasetyo

National Park Management, Department of Forestry Indonesia

Bogor Institute of Agriculture, Indonesia

Dr. Ahimsa Campos-Arceiz

Dr. Dewi Malia Prawiradilaga

Nottingham University Malaysia Campus, Malaysia

Indonesia Institute of Science, Indonesia

Dr. Mads Frost Bertelsen

Dr. Rizaldi

Research and Conservation Division, Copenhagen Zoo, Denmark

University of Andalas, Indonesia

Dr. Susan Cheyne

Dr. Dewi Imelda Roesma

Oxford University, Wildlife Research Unit, United Kingdom

University of Andalas, Indonesia

Bjorn Dahlen

Dr. Jeffrine Rovie Ryan

Green Harvest Environmental Sdn. Bhd, Malaysia

Wildlife Forensics Lab, Dept. of Wildlife and National Parks, Malaysia

Dr. Niel Furey

Boyd Simpson

Centre for Biodiversity Conservation, Royal University of Phnom Penh, Cambodia

Research and Conservation Division, Copenhagen Zoo, Denmark

Dr. Benoit Goossens

Robert B. Stuebing

Cardiff University, United Kingdom

Herpetology and Conservation Biology, Indonesia

Dr. Djoko Iskandar

Dr. Sunarto

Bandung Institute of Technology, Indonesia

Dr. Matthew Linkie

Fauna & Flora International, Singapore

Dr. Erik Meijaard

People and Nature Consulting International, Indonesia

Dr. John Payne Borneo Rhino Alliance, Malaysia

WWF-Indonesia

Dr. Jatna Supriatna University of Indonesia

Dr. Campbell O. Webb The Arnold Aboretum, Harvard University, USA

Dr. Zainal Z. Zainuddin

Borneo Rhino Alliance, Malaysia

The Journal of Indonesian Natural History is published biannually by the Department of Biology at the University of Andalas, Padang, Sumatra Barat, Indonesia, in collaboration with Copenhagen Zoo, Denmark. The Department of Biology at University of Andalas is dedicated to educating Indonesian biologists in the study and conservation of Indonesia’s biodiversity and natural history. Copenhagen Zoo, through its Research and Conservation Division, supports in-situ conservation in Southeast Asia by assisting local organizations and individuals who undertake research, capacity building and the implementation of conservation programmes and projects.

The Journal of Indonesian Natural History is published by the Department of Biology, University of Andalas, Indonesia in collaboration with Copenhagen Zoo, Denmark. It is available for free from www.jinh.net Cover photo: The beautiful Javan black-winged starling, Acridotheres melanopterus, known locally as Jalak Putih is almost extinct in the wild. It is listed as Critically Endangered on the IUCN red-list © Anaïs Tritto

2

© University of Andalas / Copenhagen Zoo

Editorial

Indonesia 20-years after ratifying the Convention on Biological Diversity - a status check Carl Traeholt1 and Wilson Novarino2 Copenhagen Zoo, Southeast Asia Programme, Malaysia University of Andalas, Padang, Sumatra

1 2

Corresponding authors: email: [email protected]

When the “Convention on Biological Diversity” (CBD) was launched in 1992, it was an important milestone for the World’s conservation community and for the Global community as a whole. It was the first comprehensive far-reaching international agreement that attracted support from most nations across the Globe. For the first time in history, a majority of the World’s nations acknowledged the value of biological diversity and the impending crisis if nothing was done to prevent the onslaught on the World’s natural resources. Since then, the human population passed 7.15 billion in July, 2013 (Worldometer, 2014), the total excretion of CO2 has grown more than predicted and reached 34.5 billion tons in 2012 (Boden et al., 2011; Oliver et al., 2013; Peters et al., 2012. Raupach et al., 2007), the dependency on fossil fuel is at its highest ever, the Earth’s seas are getting increasingly polluted and overfished (FAO, 2011; Olden et al., 2007; Pham et al., 2014) and the destruction of tropical rainforests takes place at an unprecendent rate at all continents with tropical rainforests (Hansen et al., 2013; Hansen et al., 2010; Margono et al., 2014, 2012). In light of this, it is tempting to claim that the Rio Convention merely sputters on, and many have questioned its relevance in the 21st Century. Whilst the adoption of the Rio Convention is a straight forwards process, the operationalization of it requires far more commitment at national and international levels. The task for each nation and the international community is monumental. For the ideas behind the Rio Convention to have real effect on the ground it requires that relevant national policies are formulated, mainstreamed and implemented. This process requires most sectors of society and governance to collaborate constructively. A policy needs a supporting legislative framework, and a responsible agency must be appointment with the mandate to implement the policy cross-sectorally. The implementation of the policy must

2014 Journal of Indonesian Natural History Vol 2 No 1

also be supported by enforcement agencies and penal codes formulated for law-breakers. It needs to be adopted at provincial and district level too, and mainstreamed into local governance. Finally, it requires local citizens to embrace the idea and voluntarily make a concerted attempt to manage their lives accordingly. Whereas policy formulation, legal framework development and enforcement may seem daunting tasks, the biggest challenges often remain with the local citizens and transforming the current economic structure into a system that incorporates environmental and social values into overall budget evaluations. The value of, for example, “clean air” or the cost of “polluted water” is inherently difficult parameters to incorporate into the current economic system. In a Global perspective, biodiversity conservation is an enormous task that most nations are not yet willing to commit to --- at least not at a scale that makes real positive differences. The cost of managing, for example, the World’s terrestrial biodiversity sustainably is estimated at approximately US$ 80 billion annually, and only 12% is currently being committed to this task (McCarthy et al., 2012; CBD, 2012). Despite the Global community’s pledged support and commitment to CBD’s 2020 Aichi targets there is a huge financial shortfall if all types of habitats (e.g terrestrial, freshwater, marine) should be sustainably managed. Some of the World’s largest economies continue to pursue wealth creation through extraction based economic development despite the launch of many international policy intitiatives (e.g. REDD, Climate Change, UNEP Fi). Indonesia ratified the CBD on the 23rd of August, 1994, exactly 20 years ago. So where does Indonesia rank in a conservation conext? Has there been any meaningful commitment to the CBD and conservation progress? Indonesia has 566 national parks, nature reserves and wildlife sanctuaries covering 360,693 km2, which consist of 490 terrestrial protected areas (225,401

3

km2) and 76 marine protected areas (135,291 km2). The terrestrial protected areas include 43 National Parks, 239 Nature Reserves, 70 Game Reserves, 13 Hunting Parks, 22 Grand Forest Parks, and 103 Nature Tourism Parks. Yet, after Brazil, Indonesia has the second highest rate of primary forest loss in the World (Hansen et al., 2013; Stibig et al., 2014; Wilcove et al., 2014). Even with the Indonesian forest moratorium in place since 2011 new licenses covering approximately 5.5 million hectares have been issued by the Ministry of Forestry for various development purposes. Critics claim that 4.5 million hectares of it have been excised from areas that were originally classified for conservation and that data unavailability undermines confidence in the moratorium, highlighting transparency issues (Sloan, 2014). The implementation and mainstreaming of the CBD concepts does not always progress optimally in Indonesia. However, serious actions are being taken to meet the 2020 Aichi Biodiversity Targets. In situ conservation is carried out through the establishment of conservation areas, such as biosphere reserves, wildlife sanctuaries, national parks, ecotourism parks, forest parks and hunting parks. Coverage of these areas increased from 7.628 million ha in 1981 to 27.968 million ha in 2007 (MoE, 2009). Community-based forestry projects, covering 2 million ha, have also been established, and despite vast tracts of land being developed into palm oil estates, a significant portion of these are also being set aside as “high conservation value” areas. Furthermore, ex-situ conservation activities have increased the number of species of flora and fauna being successfully bred in captivity from 171 species in 2006 to 416 species in 2008 (MoE, 2009). Breeding species in captivity is in itself a poor measurement for conservation success, however. Instead, the Ecosystem Approach is being used to develop a programme for the conservation and management of marine and fish resources. Management plans have also been approved for more than 100 conservation areas, while others are still being developed. Several regencies have been designated as conservation areas realising that these play a vital role in regional development. Many conservation initiatives are based in the 2003 “Indonesian Biodiversity Strategy and Action Plan (IBSAP)” that was developed with a focus on achieving five goals: 1) to encourage changes in attitude and behavior of Indonesian individuals and society, as well as in existing institutions and legal instruments, 2) to apply scientific and technological inputs, and local wisdom, 3) to implement balanced conservation and sustainable use of biodiversity, 4) to strengthen institutions and law enforcement, and 5) to resolve conflicts over natural resources. Currently, Indonesia is

4

in the process of updating the IBSAP (2003) to 2020. The intention is for the updated IBSAP to be mainstreamed into sectoral policies, plans and programmes through its integration in the Medium-term National Development Plan (2014-2019). The updated IBSAP will also include elements for monitoring and evaluating implementation at the national and local levels. The one issue that has received criticism is that the IBSAP remains a voluntary concept that provinces and districts can chose to accept or reject. Considering Indonesia’s diverse cultural heritage, economic challenges and vast territory, it is not surprising that conservation progress has been slow. Policy implementation lacks behind, too many management plans collect dust on shelves in offices and the majority of Indonesia’s national parks and protected areas are considered “paper parks”. Yet, important policies are being institutionalised to guide sustainable development processes, and an increasing amount of resources is being allocated for environmental and biodiversity management. “Green” technology and innovation is encouraged and supported, and economic initiatives are set in motion that aim to transform Indonesia’s economic framework from classic “extraction based” into a “resource-based” system. Indonesia has also seen a surge in international education being offered for its citizens. One of the most visionary developments is the establishment of the Indonesia Learning Center (ILC) by American conglomerate General Electric in collaboration with three Indonesian state enterprises: Pertamina (state oil & natural gas mining company), PLN (government-owned electricity company), and Garuda Indonesia (the national airline of Indonesia). The ILC intends to provide leadership-training courses both for internal employees and external customers according to World famous Crotonville’s curriculum and learning experience. Senior faculty members at Crotonville, New York, are brought to Indonesia to deliver leadership training to the nation’s current and future talents. Since good leadership is essential to good governance, Crotonville’s entering into Indonesian education and corporate governance promises very positive development prospsects for the nation. One of the major challenges for the incoming President will be to continue to support the processes of economic change and transformation. His cabinet and advisers must be able to set aside conventional economic approaches that continue to propose economic deficiencies are best fixed with the same problems that created them. At the current Global economic slowdown, Governments across the World institute various conventional economic mechanisms (e.g. lower interest rates; public bail-outs) to encourage public and

© University of Andalas / Copenhagen Zoo

coporate spending. In reality, it is like pretending there is consumer demand for various goods even if there is none. At the onset of the 21st century the incoming Government must be steadfast and refrain from the temptation to follow conventional economics and not attempt to combat budget deficiency by creating more depth. With a population of 230 million citizens, urban planning plays a significant role in biodiversity conservation too. It is tempting to solve urban housing deficiency by setting up standardised concrete buildings, because these can be erected rapidly and rationally. This approach, however, remains rooted in an utopian belief that “livability” can be calculated according to mathematical and economic models. At a planning level, it is easy to subscribe to mapping urban development according to functionality, vis-a-vis separate housing estates, working areas and recreational areas from each other. Whilst it may have economic merrits, it creates a one-dimensional environment that rarely meets modern urban citizens’ demands for livelihood diversity and experience. There remain substantial biodiversity challenges for Indonesia in the immediate and long-term future. However, the nation has made a commendable beginning and, despite many challenges, Indonesia lives up to its CBD-responsibilities to a much larger degree than most of its peers.

References BAPPENAS (2003). Indonesian Biodiversity Strategy and Action Plan. The National Development Planning Agency (BAPPENAS). 140pp. Boden, T.A., Marland, G. and R.J. Andres (2011). Global, Regional, and National Fossil-Fuel CO2 Emissions. Carbon Dioxide Information Analysis Center, Oak Ridge National Laboratory, U.S. Department of Energy, Oak Ridge, Tenn., U.S.A. doi 10.3334/ CDIAC/00001_V2011. FAO (2011). Review of the state of world marine fishery resources. FAO Fisheries and Aquaculture Technical Paper 569. Rome, Italy. 354pp. Hansen, M.C., Potapov, P.V., Moore, R., Hancher, M. et al. (2013). High-Resolution Global Maps of 21st-Century Forest Cover Change. Science 342(6160): 850-853. [DOI:10.1126/science.1244693]. Hansen, M.C., Stehman, S.V. and P.V. Potapov (2010). Quantification of global gross forest cover loss. Proc. Natl. Acad. Sci. 107: 8650– 8655.

Ministry of Environment (2009). The 4th National Report for CBD. Biodiversity Conservation Unit, Ministry of Environment. Jakarta, Indonesia. Margono, B.A., Potapov, P.V., Turubanova, S., Stolle, F. and M.C. Hansen. (2014). Primary forest cover loss in Indonesia over 2000–2012. Nature Climate Change 4: 730–735. doi:10.1038/ nclimate2277. Margono, B. A., Turubanova, S., Zhuravleva, I., Potapov, P., Tyukavina, A., Baccini, A., Goetz, S. and M.C. Hansen (2012). Mapping and monitoring deforestation and forest degradation in Sumatra (Indonesia) using Landsat time series data sets from 1990 to 2010. Environ. Res. Lett. 7: 034010. Olden, J. D., Hogan, Z. S. and Zanden, M. J. V. (2007). Small fish, big fish, red fish, blue fish: size-biased extinction risk of the world’s freshwater and marine fishes. Global Ecology and Biogeography, 16: 694–701. doi: 10.1111/j.1466-8238.2007.00337.x. Oliver, J.G.J., Janssens-Maenhout, G., Muntean, M. and J.A.H.W. Peters (2013). Trends in global CO2 emissions, 2013-Report, The Hague: PBL Netherlands Environmental Assessment Agency; Ispra: Joint Research Centre. Peters, G., Marland, C., Le Quere, T., Boden, J., Canadell, G. and M.R. Raupach (2012). Rapid growth in CO2 emissions after the 2008-2009 global financial crisis. Nature Climate Change 2: 2–4. Pham C.K., Ramirez-Llodra E., Alt C.H.S., Amaro T., Bergmann M., et al. (2014). Marine Litter Distribution and Density in European Seas, from the Shelves to Deep Basins. PLoS ONE 9(4): e95839. doi:10.1371/journal.pone.0095839. Raupach, M.R., Marland, G., Ciais, P., Le Quere, C., Canadell, J., Klepper, G. and C. Field (2007). Global and regional drivers of accelerating CO2 emissions. Proceedings of the National Academy of Sciences 104(24): 10288–10293. Sloan, S. (2014). Indonesia’s moratorium on new forest licenses: An update. Land Use Policy 38: 37–40. Stibig, H. J., Achard, F., Carboni, S., Rasi, R. and J. Miettinen ((2014). Change in tropical forest cover of Southeast Asia from 1990 to 2010. Biogeosciences 11: 247–258. UNEP/CBD/COP (2012). Resourcing the Aichi Biodiversity Targets: A first assement of the resources required for implementing the Strategic Plan for Biodiversity 2011-2020. UNEP/CBD/COP. 83 pp. Wilcove, D.S., Giam, X., Edwards, D.P., Fisher, B. and Koh, L. P. (2014). Navjot’s nightmare revisited: Logging, agriculture, and biodiversity in Southeast Asia. Trends Ecol. Evol. 28: 531–540. Worldometer (2013). http://www.worldometers.info/worldpopulation, accessed 3 April, 2014.

McCarthy et al. (2012) Financial Costs of Meeting Two Global Biodiversity Conservation Targets: Current Spending and Unmet Needs. Science 338(6109): 946-949. DOI: 10.1126/science.1229803.

2014 Journal of Indonesian Natural History Vol 2 No 1

5

News and Notes Fatwa against illegal wildlife trafficking in Indonesia In March 2014, the Indonesian Council of Ulama --- Indonesia's top Muslim clerical body --- issued a fatwa (Fatwa No. 04, 2014) on Conservation of Threatened Wildlife to maintain Ecosystem balance. In a religious context, it effectively requires Indonesia’s 200 million Muslims to take an active role in protecting and conserving endangered species, including tigers, rhinos, elephants, and orangutans. At the same time, it declares illegal hunting or illegal trading of endangered species to be haram (forbidden). The fatwa is believed to be the first of its kind in the World and is a welcome example of a religious body engaging proactively and responsibly in an area usally covered by existing civil laws. The fatwa is not “implementable” per se, but is issued to give an explanation, as well as guidance, to all Muslims in Indonesia on the sharia law perspective on issues related to animal conservation. It will supplement existing Indonesian law and it is hoped that this proactive initiative by the Indonesian Council of Ulama will have positive impact on the current exscallating illegal wildlife trade in the country.

Female Sumatran rhino rescued in Sabah, Malaysia On the 21st of March, 2014, a critically endangered female Sumatran rhino (Dicerorhinus sumatrensis) was successfully rescued from a very remote area in Danum Valley and translocated to join male (Tam) and a female (Puntung) rhinos at the Borneo Rhino Sanctuary (BRS) Facilities in Tabin Wildlife Reserve. Due to the remote capture area, she had to be flown in a Sikorsky S-64 Helicopter that was made available by Erickson AirCrane Inc. She was named “Iman” (Fig. 1), after a small river near where she was caught, and her rescue was a result of a year of intense efforts to make every last rhino in Malaysia count towards efforts to prevent the extinction of one of the world’s most critically endangered species. The Sabah State Cabinet had previously heeded advice from local and international

6

Figure 1. A female Sumatran rhino a day after capture, March 2014, from Danum Valley, Sabah. The rhino named “Iman” was in poor reproductive health © John Payne

rhino experts and agreed that the only way to ensure that every Sumatran rhino in Sabah plays a role in saving the species is to bring all of them into a managed, fenced facility, with the necessary local and global expertise and collaboration to breed them. Once Iman is settled into Tabin, the Sabah Wildlife Department and Borneo Rhino Alliance (BORA) will review all the potential options on how she can best contribute to her species. But it is expected that Iman will be given a reasonable time to mate with the male, Tam, at the BRS. Ealier Tam had been slotted to be loaned to Cincinnati Zoo as part of a breeding collaboration, where there is already a fertile female. If Iman proves to be fertile and the pair compatible, it might not be necessary for Tam to fly to Cincinnati to mate.

Drastic measures needed to save Sumatran rhinos from extinction The successful capture of a female Sumatran rhino in Danum Valley, Sabah, in March 2014 renewed hope of establishing a local breeding population in Sabah. After capture Iman, as the rhino was named, exhibited various indications similar to pregnancy but a detailed ultrasound examination under anesthesia by specialists from the Leibniz Institute for Zoo and Wildlife Research Berlin (IZW) with local counterparts revealed that what had been suspected to be a fetus was in fact a collection of tumors in the uterus. A thorough examination revealed that some of the tumors were as

© University of Andalas / Copenhagen Zoo

big as footballs. This indicates that Iman has not been sexually active for 5-10 years, most likely because there are too few males left, if any at all, in the wild. The discovery of the poor reproductive condition of Iman is simmilar to that of Puntung, a female captured in 2011, and a young poached female from 2001. It is a big blow to the Global Sumatran Rhino Breeding program and it reiterates the critical need for assisted reproduction techniques such as in vitro fertilisation. It is evident that Sabah’s rhino population is far too small to recover without human intervention. While Sumatran populations appear to reproduce naturally in the wild the threat of poaching continues to push Sumatra’s remaining small wild populations into a similar irreversible extinction vortex as is undeniably happening to the rhinos in Sabah. BORA executive director, Dr. Junaidi Payne, stated that “everyone concerned with preventing the extinction of this magnificent species really ought to work collaboratively to share knowledge, ideas, experience, gametes and rhinos. That includes Indonesia and Malaysia, and the various specialists, notably IZW”.

Also highlighted was the need to develop standard surveying methods, technical guidelines on the protection of the animals victimized in conflicts and the establishment of the Javan Leopard Forum. There is still no accurate population estimate for Javan leopard, although it is expected to number in the range of 400-500 indviduals. The main reason for the general decline of the species is believed to be associated with habitat loss, due to expanding production forests and agricultural land. A Javan Leopard Forum was declared by 10 representatives of various stakeholders from state-run forestry enterprise PT Perhutani, Foksi, Java Carnivore Awareness, the Indonesia Institute of Sciences (LIPI), the Bogor Agricultural Institute, the Conservation Breeding Specialist Group Indonesia and the Zoological Society of London. The Javan leopard conservation strategy and action plan is expected to be approved by the Forestry Ministry in the near future, and it will provide a much needed guidance to ensuring the long-term survival of Java’s top predator.

Global forest watch tracks where trees fall

More plans made to save Javan leopard Recently the Indonesian Forestry Ministry held a two day “National Conference on Javan Leopard” workshop at the Indonesia Safari Park in Cisarua, Bogor, West Java, to develop a Javan leopard conservation strategy and action plan aimed at saving the species from extinction. Dozens of participants from insitutions including the Indonesian Wild Animals Conservation Forum (FOKSI), the Indonsian Zoo and Aquarium Association (PKBSI), Indonesia Safari Park, the Harimau Kita Forum, Java Carnivore Awareness, the Indonesian Institute of Sciences (LIPI), Bogor Agricultural Institute and research institutions provided the ministry with four key recommendations: a) conservation of Javan leopard in its natural habitat, b) the need to include conservation institutions (e.g. zoos and wildlife refuges), c) public awareness tasks, and d) financing conservation and research activities. An important addition to the stategic approach was the inclusion of ex-situ conservation actions. The participants agreed that it is critical to manage the genetic quality of all captive Javan leopard individuals, and that a studbook keeper should be appointed to oversee this.

2014 Journal of Indonesian Natural History Vol 2 No 1

It is well knowned that forests across the world are vanishing at an astonishing rate, and with it biodivesity. Sometimes it is hard to visualise just how serious the problem is. The World Resources Institute (WRI) recently released a new online mapping tool that aims to put all the eyes of the world on forests everywhere in the World, with near-real time monitoring. The system combines satellite pictures, computer algorithms and crowd-sourced data to provide an up-to-date look at the health of forests across the World. The system named “Global Foresty Watch” is developed in collaboration with dozens of partners and will allow users with a computer and internet access to zoom into a forest anywhere in the world and see where trees are being lost as well as how fast it is being lost. The system has a resolution of 30 meters and will be able to detect if a stand of trees is felled by logging or fire, or wasted away by disease. A very important fact is that WRI provides the Global Forest Watch as an “open source” platform that any person can use for free. Hopefully, the system will contribute to ending the procrastinated denial and secrecy of forest clearings across the Globe and begin a more factual and progressive debate about how to manage, protect and replace forested areas.

7

Nepal celebrates ‘zero poaching year’ for rhino, tiger and elephant Nepal recently celebrated a monumental conservation achievement: 365 days without a single incident of rhino, tiger or elephant poaching record in any of the country’s protected areas. The achievement has to be seen in contrast to the huge increases in elephant and rhino poaching worldwide, and is testament to the collective commitment of Nepal’s Department of National Parks and Wildlife Conservation (DNPWC) and its national and international collaboraters. The last reported incident of rhino poaching in the country occured on February 16, 2013. In recent years, the Nepalese Government have focused increasingly on its conservation plight, aomng others by establishing the Wildlife Crime Control Coordination Committee at the national level and the Wildlife Crime Control Bureau at the district level and increased law-enforcement. In 2013 alone, law enforcement officials arrested more than 700 wildlife criminals in the country. This has resulted in a significant decrease in poaching and illegal wildlife trade, and a rise in the rhino population.The success is a good example of combined efforts in protected area and species management IUCN’s country representative pledged continued support to the DNPWC in the future. Despite this recent success, the large number of arrests in 2013 indicate that Nepal is still a major transit point for trade and the smuggling of body parts of endangered animals. Between February 2013 and February 2014 authorities seized 1,200 grams of tiger bone, two rhino horns, a rhino toe, six leopard hides, and 11 red panda hides. A 2011 rhino census revealed that 534 Greater Onehorned rhinos still persist in Nepal; 503 of these occur in Chitwan National Park, 24 in Bardiya National Park and seven in Shuklaphanta Wildlife Reserve.

The world’s first net-zero energy skyscraper rises in Indonesia The Pertamina Energy Tower will soon become the world’s first net-zero energy skyscraper. It will be built in the center of Indonesia’s capital, Jakarta, and expected to be complited by 2019. It will consists of 99 stories and serve as the headquarters of Pertamina, the national energy company. Up to 20,000 people will

8

work there, where there will also be a campus that has a mosque, a sports center and a 2,000-seat auditorium for the performing arts. The design appears like a funnel, the top of the tower opens at the top, capturing wind and sucking it inside to run a series of vertical wind turbines that provide 25 percent of the building’s electricity. The façade will be calibrated for Jakarta’s proximity to the equator to mitigate solar heat gain throughout the day as well as year. The sides of the building will be made as sun-shading “leaves” that allow daylight to enter while shielding the building from glare and heat from the sun, and airconditioners will be replaced with radiant cooling systems. The power will be supplied by thousands of solar panels and geothermal facilities. In the past decade, Indonesia has developed a long range of policies aimed at guiding the Nation into a path of sustainable development. The Pertamina Energy Tower will reflect Indonesia’s sustained commitment to sustainable development, and possible propell the nation into a small group of elite nations taking a big step towards a resource based economy.

New EU initiative to protect biodiversity and fight wildlife crime

On the International Day for Biological Diversity today, the Commission is launching a major new initiative to halt biodiversity loss and eradicate poverty in developing countries. The EU Biodiversity for Life (B4Life) initiative is designed to assist needy countries protect their national ecosystems, combat wildlife crime and develop green economies. B4Life will operate with an estimated budget of up to €800 million for the period 2014-2020 and will focus on Least Developed Countries and countries containing “biodiversity hotspots”, the places where ecosystems and their services are the richest but also the most threatened. The past two decades have manifested that biodiversity and development are closely linked and mutually reinforcing --- that is, healthy ecosystems sustain development while development impacts on habitats. Therefore, the B4Life focus on ecosystem conservation and restoration as an opportunity to generate growth, create jobs and reduce poverty through developing new strategic frameworks for green economy. B4Life will operate in three priority areas: •

Promoting good governance of natural resources.

© University of Andalas / Copenhagen Zoo

• •

Securing healthy ecosystems for food security. Developing nature-based solutions towards a green economy.

In addition to the three priority areas, B4Life will include a special ‘Wildlife Crisis Window’ (WCW), dedicated to combating the increase in the illegal trade of endangered species, particularly in Africa. As well as threatening species, wildlife poaching and trafficking harm local and national security. There are mounting evidence that rebel militias and possibly terrorist groups are involved in elephant and rhino poaching as a means of financing their actions. The WCW aims at tackling poaching and trafficking at all levels --- at a local level by securing the management of priority protected areas; at a national level by reinforcing the rule of law by tackling corruption and improving investigation; at a regional level by promoting anti-criminal networks and the creation of cross-border protected areas, and by improving species monitoring; and internationally by supporting organisations specialised in the fight against wildlife crime, illegal trade and smuggling.

Association for Tropical Biology Conservation meeting, Cairns

and

The Association for Tropical Biology and Conservation (ATBC) held its 51st annual meeting in Cairns, Australia. The event also included the Asia-Pacific Chapter (AP) meeting and was co-hosted by James Cook University. The 2014 annual meeting became the largest congregation of tropical biologists ever in Australia, with 589 registered scientists and conservationists from 55 nations participating. The event theme was The Future of Tropical Biology and Conservation and almost 200 oral presentations were delivered in five concurrent sessions along with almost 100 posters. In lieu of the recent plans for port development and associated dredging in the Abbott Point area near Bowen, Queensland, the meeting produced the ATBC 2014 Cairns Declaration in Support of Stronger Protection of the Great Barrier Reef. The declaration focus particularly on the feasibility of the offset requirement for reducing net sediment input into the Great Barrier Reef Marine Park, and the cumulative effect of this development to the marine ecosystem. The ATBC Cainrs Declaration can be downloaded at: http:// tropicalbiology.org/atbc-2014-cairns-declaration/.

2014 Journal of Indonesian Natural History Vol 2 No 1

The Asia-Pacific Chapter meeting reconstituted the chapter board and decided that the 2015 AP-meeting will take place in Cambodia. The team will be preparing for this event.

Forests Asia Summit, Jakarta One of the most important and largest events in the region took place in Jakarta from 5-6th of May, 2014. The Forests Asia Summit: Sustainable Landscapes for Green Growth in Southeast Asia was organised by the Center for International Forestry Research (CIFOR) and co-hosted by the Indonesian Ministry of Forestry. The event was the largest in Asia in recent years and attracted more than 1,000 leading stakeholders from Southeast Asia and across the world. It saw ministers from across Southeast Asia join CEOs, civil society leaders, development experts and the world’s top scientists, to share knowledge on how the region can accelerate the shift toward a green economy by better managing its forests and landscapes. Thousands more participated online or through nationwide broadcasts, and there were special learning events with leading global experts on the Green Economy, the Southeast Asian haze crisis, climate change negotiations and the Sustainable Development Goals. As a testament to the importance of the occasion H.E. President of Indonesia Susilo Bambang Yudhoyono delivered the opening address, with ministers and high ranking Government officials and corporate players from most of SE Asia also making presentations. One notable absentee from this important event was Malaysia. The aim of the Forests Asia Summit was to lay the foundations for continued dialogue, transitions toward sustainable investments, and further research to support evidence-based policymaking, all directed toward achieving equitable green growth and more sustainable management of landscapes across Southeast Asia. Following the event, an outcome statement was compiled from reporting from the sessions at the Forests Asia Summit to provide an overview of messages throughout the conference. In summary, the reporting concludes that: •

To achieve equitable and sustainable green growth in Southeast Asia, all stakeholder groups must strive to overcome communication barriers, engage in continued, participatory dialogue, and act together within a landscape and multilevel governance framework.

9

•

Government, the corporate sector and the finance sector must work together to create enabling conditions to unlock private capital and support investments in sustainable landscapes and smallholders.

•

The scientific community, with support from the public and private sectors, must engage in integrated and targeted research aimed at increasing understanding of the dynamics that shape landscapes and communicate findings to government and business in a way that supports evidence-based changes in policy and practice toward a sustainable future and action on the ground. sustainable landscapes and smallholders.

•

The scientific community, with support from the public and private sectors, must engage in integrated and targeted research aimed at increasing understanding of the dynamics that shape landscapes and communicate findings to government and business in a way that supports evidence-based changes in policy and practice toward a sustainable future and action on the ground.

The detailed Outcome statement with associated explanation can be found at: http://www.cifor.org/ forestsasia/about/outcome-statement/.

Tigers in peril The annual Global Tiger Day took place worldwide on 29 July 2014. Unfortunately, there is still very little cause to celebrate with tiger populations continueing to decline across its ranges. Poaching and habitat destruction remain the primary causes of decline, along with an increasing loss of prey base. These are some of ther concerns that were highlighted in a comprehensive report co-authored by TRAFFIC into the progress made by the countries implementing measures to protect Asia’s four big cat species. The report states that in the period from 2000-2014 a minimum of 1590 tigers have been seized - an average of two animals per week - with most recorded from India (536) (Fig.1). Despite formulating policies, high level meetings, pledges and plans the number of tigers represented in seizures has increased from less than 100 in 2000 to 150 per year in 2014. While this can also be a result of improved law enforcement, it is a trend that concerns many conservation biologists across the region. Indonesia reportedly lost 103 tigers in the 2000-2014 period. While this figure is small in comparison to India’s loss of tigers, the report warns that Indonesia must improve its law enforcement if tigers are to survive in Sumatra. In the period 2010-2012 Indonesia contributed with 20% of all tiger parts seizures despite only having less than 10% of the global tiger population.

Figure 1. Number of killed and traded tigers in range countries suggest that the illegal trade florishes as much as ever. From TRAFFIC (2014).

10

© University of Andalas / Copenhagen Zoo

Debate Forum

Bird thieves in Java show that Indonesian wildlife crime knows no boundaries Anais Tritto1 and Resit Sozer1 Cikananga Conservation Breeding Centre, West Java, Indonesia

1

Corresponding authors: Anais Tritto, email: [email protected]

A large theft of endangered captive bred birds from the Cikananga Wildlife Centre in West Java has seriously ruffled the feathers of the Indonesian conservation community. Burglars succeeded in stealing a total of 156 rare birds from the centre, likely to feed Indonesia’s burgeoning bird trade. Enough is enough, say bird conservationists. Indonesia’s national emblem is a large mythical bird or bird-like creature, Garuda. The Garuda is a reference to both Indonesia’s Hindu and Buddhist past, as well as to the cultural importance of birds in the country. The speed at which Indonesians are consuming and trading local wild bird species, however, suggests that the only birds left will soon live in cages, or are exotics like the ubiquitous tree sparrow introduced from Europe. Forest areas that used to resonate with bird calls are now silent. The Yellow-vented Bulbul, Pycnonotus goiavier, previously very common in Bogor and Jakarta, is now rare, because its pretty song makes it a popular cage bird. Once one of the most common birds in Indonesia’s rice fields, the beautiful Java Sparrow, Lonchura oryzivora, was hunted extensively for keeping in cages too, but also shot and poisoned because it fed on rice. This species roamed in flocks of thousands but has almost disappeared from the wild. Bird collectors and traders are finding ever more devious (and often illegal) ways to obtain birds that are increasingly hard to find in the wild. A recent victim of this conniving approach was the Cikananga Wildlife Centre, near Sukabumi, West Java. After five years of painstaking captive breeding efforts the centre succeeded in breeding over 500 individuals of the Blackwinged Starling, Acridotheres melanopterus, known locally as Jalak Putih (Fig.1). Due to its popularity as a cage bird thousands were captured and sold, and today it has become close to extinct in the wild and

2014 Journal of Indonesian Natural History Vol 2 No 1

listed as “critically endangered” on the IUCN Red-list. Cikananga does not breed them for markets though, but release them back into the Javan countryside at secret

Figure 1. The Javan Black-winged starling, Acridotheres melanopterus, is listed as “Critically endangered” on the IUCN-redlist. For the past five years Cikananga Wildlife Centre, West Java, successfully bred more than 500 individuals of the species to help save it from extinction. Many pairs have been reintroduced back to its natural habitat on Java. Recently, several hundreds were stolen by professional thieves, aledgely to supply Indonesia’s rampant illegal bird trade. © Roland Wirth

11

locations for local villagers to enjoy their splendid songs again and benefit from the starlings as biological pest controllers of insects in rice fields. In the past few months 10 attempts of theft have been recorded of which three were successful. The audacious thieves trespassed into Cikananga, avoided a range of security measures and stole 156 birds. The total loss at Cikananga amounted to: one Bali Starling (near extinction in the wild; listed as Critically Endangered on the IUCN redlist), two Black-winged Starlings of the Bali subspecies, three Sumatran Laughing-Thrushes, 149 Black-winged Starlings from Java (listed as Critically Endangered on the IUCN red-list) and one Javan green magpie. This also is a big blow to the centre’s staff who, supported by meagre salaries, have worked for years to breed these birds in an attempt to save them from extinction and to the benefit of all Indonesians. These were not some local dudes out on a cash run. Locks were picked with chemicals, they brought wire cutters, knew exactly where to go, and had clearly studied security operations. Rumours suggested that all birds were sold at Jakarta’s bird markets the same morning, a tell-tale sign that the birds had been preordered. Although the thieves hit several times, and with the increased security measures, including extra security guards patrolling the aviaries, they always managed to escape. Theft was also reported at the release site for Blackwinged starlings. On the the 22nd of July, three chicks were stolen from a “secure” nest box after removing the padlock. Whereas the pair rearing the chicks was not caught the theft is a big setback for the Cikanganga’s reintroduction programme. Of an initial 40 released individuals only seven birds remain in the area at present, and therefore each hatching is of critical value to the effort of reestablishing a wild population of the species. A few days before this theft, one juvenile approx three months old was stolen but local people forced the thief to release it. Consequently, the security at the release site will be improved with the employment of two local security guards. The efforts in Cikananga to save endangered Indonesian birds from extinction through captive breeding and re-introduction has been funded by generous donations from many philanthropic people in Germany, Switzerland, England, the Czech Republic, Poland and the USA. Naturally, these people are frustrated about the greed of bird thieves, traders and buyers in Indonesia, and the limited success of the

12

Indonesian authorities in preventing such thefts from occurring and prosecute the culprits. A reward of 15,000,000 Rupiahs has been offered by one of the donors to anyone who can give information that leads to the recovery of at least some of the stolen birds and identification of the thieves. Unfortunately, the Cikananga theft is one of many indications of a growing biodiversity conservation challenge in Indonesia. To date, the Indonesian conservation authorities continue to struggle with mainstreaming conservation related policies and enforcing relevant laws. The occasional raids on bird markets constitute merely inadequate authoritative signals that usually do not have any deterring effect illegal bird poaching and other illegal wildlife trade in the country. Does anyone care? Many Indonesians will probably never see an undisturbed forest in their life – after all, such forests are now rare on Java where most people live. Would it bother anyone if the last of Indonesia’s hornbills were caught for their beaks to be used in Chinese medicine? Or that no more eagles would soar overhead? Perhaps not now, but one day in the future many will likely bemoan the loss of a whole range of incredible species that makes this country one of the most biodiversity rich in the World. By then, it is a little too late. What is needed are major efforts by both governmental and non-government organizations to crack down hard on illegal bird trade and poaching, and provide the public with good and informative education and awareness about wild birds. Without such efforts, there is a real risk that many of Indonesia’s wild birds will disappear over the next decade. If that happens, Indonesia’s birds will become mythical creatures just like Garuda and people might ponder about the days when wild birds still roamed the countryside and bless gardens, fields and forests with intricate songs and calls.

© University of Andalas / Copenhagen Zoo

The Rufford Foundation: Grant Recipient Conference The Rufford Foundation held its “Grant Recipient Conference” in Sabang, Sumatra in January 2014. The conference was organised jointly by Fauna & Flora International and the Rufford Foundation with the main objectives to, • •

Provide a forum for grant recipients to discuss ideas, problems, issues and create invaluable networking opportunities; and, Increase communication and information between Rufford and its grant recipients.

The participants consisted of 16 Nature award winners from Indonesia ranging from first-time grantees to Booster recipients. The first day was allocated for project presentations, which were designed to highlight the logical progression in project implementation and evolution of project design from the first Rufford Small Grant (RSG) to a second RSG to Booster. The second day involved a field trip to an FFI marine project site, including visiting a mangrove forest rehabilitation site with the local customary marine leader. The RSG is a relatively small contributor to conservation projects. Nevertheless, RSG have resulted in significant and tangible conservation impacts. Rufford has also enabled early career conservationists to get that all important first start and mobilized sooner than they would have done otherwise. Grant recipients include what is now widely acknowledged conservation officers in Indonesia, many which were participating in the conference, including the co-editor of the Journal of Indonesian Natural History, Wilson Novarino. The grantees were engaged in subjects varying from local policy and legislation support, to protecting Malay tapirs and Sumatran tigers, and using gibbons as a flagship species to support income generating activities for local coffee farmers on Java. It also allowed grantees to pursue and test creative and innovative initiatives and disseminate results widely. Finally, one of the most important results of RSG support is that it has enabled grantees to train up a future generation of conservationists, and often focus on critically important species or ecosystems that would otherwise have received little attention. The conference also aimed at forging new collaborations in Indonesia. It set out to identify and establish areas for collaboration between grantees and increase further

2014 Journal of Indonesian Natural History Vol 2 No 1

opportunities for collaboration through their own local networks. After two days of information sharing, discussions and deliberations the participants arrived at the following recommendations: • •

•

•

•

•

A future Rufford conference should include grantees from eastern Indonesia and also those focussing on marine issues. Indonesia holds the second highest number of RSG project awards but not a single RSG recipient has advanced to the Continuation stage. This was because they had progressed in their career and felt that they were no longer suitable. Rufford should include a sub-section or set of guidelines as part of the RSG proposal format to enable project information and dissemination to a wider audience (e.g. IUCN, national parks). Rufford should create an alumni network with regional meetings and opportunities for wider peer learning. Also, an electronic Rufford mail-list would enable a global alumni network to connect. Conduct a gap analysis to identify locations (e.g. eastern Indonesia) and issues (e.g. marine biodiversity conservation) that are underrepresented in RSG. Consider setting up a small grants scheme, whereby a pool of student projects (e.g. £1000 each) could be funded under a single RSG capacity building grant of £6000 that is award to the supervisor. This could increase the number of projects and opportunities for early career conservations who will benefit from the experience of initially managing a smaller grant.

The Editors

13

Genetic diversity of Macaca fascicularis (Cercopithecidae) from Penang, Malaysia as inferred from mitochondrial control region segment J.J. Rovie-Ryan1, M. T. Abdullah2,3, F. T. Sitam1, S. G. Tan4, Z. Z. Zainuddin5, M. M. Basir1,6, Z. Z. Abidin1,6, C. Keliang1, A. Denel1, E. Joeneh1 and F. M. Ali1 Outbreak Response Team, Wildlife Genetic Resource Bank Laboratory, Ex-Situ Conservation Division, Department of Wildlife and National Parks Peninsular Malaysia, Kuala Lumpur, Malaysia. 2 Kenyir Ecosystem Research Centre, Universiti Malaysia Terengganu, 21030 Kuala Terengganu, Terengganu, Malaysia.. 3 Department of Zoology, Faculty of Resource Science and Technology, Universiti Malaysia Sarawak, Malaysia. 4 Dept. of Cell and Molecular Biology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, Malaysia. 5 Borneo Rhino Alliance, Sabah, Malaysia. 6 Deputy Director General I and II Office, DWNP, KM 10 Cheras Road, 56100 Kuala Lumpur. 1

Corresponding author: J.J. Rovie-Ryan, email: [email protected] Abstrak Keanekaragaman genetic kera ekor panjang (Macaca fascicularis) dari Penang, termasuk Pulau Jerejak dan daratan utama Negeri Penang Malaysia telah dianalisis dengan menggunakan 1.042 bp control region (CR) segment DNA mitochondria (mtDNA). Dua puluh haplotipe menunjukkan adanya satu haplotipe tunggal yang sama antara daratan utama dan pulau, hal ini menandakan bahwa ini merupakan genetic yang diterima dari daratan. Dibandingkan dengan penelitian sebelumnya yang dilakukan berdasarkan CR, semua haplotipe dari Penang merupakan gambaran baru dan tidak ada yang sama dengan populasi M. fascicularis lainnya di wilayah ini. Adanya satu deletion mutasi unik pada contoh dari penang (Kelompok I dan II) bisa menjadi indicator yang baik untuk upaya konservasi keunikan genetic dan mungkin bisa dikelola sebagai satu unit pengelolaan. Sebuah ringkasan pohon filogenetik (NJ, MP, ML dan Bayesian) mendukung pengelompokan monofiletik dari M. fascicularis seperti digambarkan pada penelitian penelitian sebelumnya. Pemisahan topologi dari haplotype Penang kedalam tiga kelompok utama secara umum berhubungan dengan distribusi geografis mereka. Penelitian ini juga mencatat bahawa haplotipe Penang memiliki garis keturunan dari wilayah continental yang telah terpisah dari garis keturunan insular sekitar 1.04 juta tahun yang lalu. Penelitian ini juga menunjukkan bahwa CR dari mtDNA sangat baik digunakan untuk mengkuantifikasi keanekaragaman genetic intraspesifik pada M. fascicularis. Abtract The genetic diversity of the long-tailed macaques (Macaca fascicularis) from Penang, Malaysia, including Jerejak Island and the mainland area of the state of Penang, Seberang Perai were examined using 1,042 bp control region (CR) segment of the mitochondrial DNA (mtDNA). Twenty haplotypes were described with a single haplotype sharing between the mainland and the island which suggests that it is a remnant of the genetic makeup from the mainland. Compared to previous studies based on the CR, all the Penang haplotypes are newly described with none shared with the other regional populations of M. fascicularis. A single deletion mutation unique to the Penang samples (Groups I and II) could be a good indicator for the conservation of the genetic uniqueness and possibly should be managed as a management unit (MU). A summarised phylogenetic tree (NJ, MP, ML and Bayesian) supports the monophyletic clustering of the M. fascicularis as described in previous studies. The topology separates the Penang haplotypes into three major groups, which generally corresponds to their geographical distribution. We also noted that the Penang haplotypes are of the continental lineage which separated from the insular lineage at around 1.04 mya. Finally, we showed that the CR of the mtDNA is powerful and suitable for the quantification of intraspecific diversity in M. fascicularis. Keywords: Macaca fascicularis, Penang Island, phylogenetics, hypervariable segments I and II

Introduction The long-tailed macaque, Macaca fascicularis, also known as the cynomolgus macaques, are widely distributed in nature and occupies vast areas of mainland Received 26th February 2014; Revision accepted 2nd May, 2014

14

southeast Asia (Thailand, Cambodia, Vietnam, Laos, Myanmar, Peninsular Malaysia and Singapore) and the Greater and Lesser Sunda Islands (Indonesia, Brunei, and the Malaysian Borneo) and the Philippines (Eudey, 2008; Fooden, 1995). They can be found almost everywhere especially at low elevations preferring the mangrove and swampy forests, river banks, and

© University of Andalas / Copenhagen Zoo

Genetic diversity of M. fascicularis

seashores (Eudey, 2008). In Peninsular Malaysia they are very common and populate areas in sympatry with the human settlements [Department of Wildlife and National Parks (DWNP), 2006]. In Penang particularly, M. fascicularis is distributed throughout the islands (Penang Island and smaller adjacent islands including Jerejak Island) and the mainland portion of Seberang Perai (DWNP, 2006; Karimullah & Shahrul, 2011). Historically, Peninsular Malaysia was part of the Sundaland which was heavily influenced by events during the Quaternary Period (Pliocene and Pleistocene) (Voris, 2000). During the Pleistocene, periods of intermittent glacial caused the fluctuation of sea levels and at its maximum fell by 120 m below present-day levels and landmasses (Malay Peninsula, Borneo, Sumatra, Java, Bali, Palawan, the Mentawai Islands, and the smaller intervening islands), which are currently separated were joined and formed Sundaland (Bird et al., 2005; Harrison et al., 2006; Sathimurthy & Voris, 2006; Voris, 2000). Consequently, Penang Island which is currently situated about four km off the coast of Seberang Perai and separated by the narrow Penang Straits at a maximum depth of 20 m (Asadpour et al., 2011) would experience repeated connection to the mainland during Pleistocene, thus limiting faunal interchanges. In Malaysia, very few genetic studies had been conducted on M. fascicularis. Most studies were conducted to investigate their conflict with humans (DWNP, 2006), association with zoonotic diseases (Cox-Singh & Singh, 2008; Thayaparan et al., 2013, 2014), distribution (DWNP, 2006; DWNP, unpublished data; Karimullah & Shahrul, 2011), and behaviour (Ling, 2006; Ping, 2003; Shuan, 2006). In other regional populations of M. fascicularis (Indochinese, Indonesian, Philippines, Singapore, and Mauritius) however, numerous genetic studies have been conducted using mitochondrial DNA (mtDNA) markers (Blancher et al., 2008; Harihara et al., 1988; Kawamoto et al., 2008; Lawler et al., 1995; Perwitasari-Farajallah et al., 1999; Perwitasari-Farajallah et al., 2001; Schillaci et al., 2011; Shiina et al., 2010; Smith et al., 2007; Tosi & Coke, 2007; Tosi et al., 2002). In this study, we employ the mtDNA control region (CR) as part of a major research initiative by the DWNP to comprehensively examine the population genetics, phylogeography, and the diseases associated with M. fascicularis in Malaysia (both from Peninsular Malaysia and from Sarawak and Sabah states on Borneo Island). In summary, this pilot study is designed to achieve these objectives;

2014 Journal of Indonesian Natural History Vol 2 No 1

(1) to examine the genetic diversity of the Penang M. fascicularis and (2) to investigate the efficiency of the mtDNA control region in assessing the genetic diversity of M. fascicularis in Malaysia.

Methods Sample Collection Sampling was conducted by the Outbreak Response Team (ORT) of the DWNP on conflict long-tailed macaques as part of a Wildlife Disease Surveillance Programme (WDSP) launched by DWNP in 2011 to monitor the emergence of zoonotic diseases in wildlife species. Figure 1 shows the sampling sites (A-L) while Table 1 provides the details of each of the samples used in this study. All samples were kept at the Wildlife Genetic Resource Bank (WGRB) Laboratory, DWNP. DNA Extraction, PCR Amplification and Sequencing Total genomic DNA was extracted from 46 samples either from blood (preserved in lysis buffer) or from liver samples (see Table 1) using the QIAamp DNeasy Blood and Tissue Kit (QIAGEN Ag., Germany) protocol for blood and tissue samples as provided by the manufacturer. A pair of oligonucleotides; WGRB/MFCR/F15978 (5’– ACCACCAACACCCAAAGCTGGC–3’) and WGRB/ MFCR/R580(5’-TCAGTGTCTTGCTTTGGGTGGGT-3’), were designed using the program Primer3 (Rozen & Skaletsky, 2000) as a plug-in in the Geneious v5.6 (Drummond et al., 2012) to cover the complete length of the CR segment. Amplifications were carried out in an Arktik Thermal Cycler (Thermo Scientific, USA), using a 15 µl reaction volume consisting of 0.5 µl of DNA template (~15–20 ng), 0.2 µl (0.13 µM) of each primer and 14.5 µl of GoTaq® Colorless Master Mix (Promega, USA). Amplification was done using the following PCR profile: a preliminary denaturation at 98oC for 2 min followed by 30 cycles of 95oC for 30 sec, 69oC for 30 sec and 72oC for 40 sec. This was followed by a final extension period of 72oC for 3 min before the samples were cooled to 4oC. Cycle sequencing on both primers were done on an ABI PRISM®377 DNA Sequencer by a sequencing service provider (1st Base Laboratories Sdn. Bhd., Malaysia). Sequence Analysis Multiple alignments of the sequences were done and ambiguous flanking regions were identified and removed

15

Rovie-Ryan et al.

No

Sample Label

Location/GPS of capture

Sex

Table 1. Detailed information on each M. fascicularis samples collected from the Penang State. Map

Sample type**

Haplotype Designation

Haplotype Frequency

GenBank Acc. No.

1

WDSP/11/0037

Sg. Kecil, Seberang Perai, Penang

F

L

BLB

20

0.130

JX113316

2

WDSP/11/0038

Sg. Kecil, Seberang Perai, Penang

F

L

BLB

20

0.130

JX113317

3

WDSP/11/0039

Kuala Juru, Seberang Perai, Penang

M

J

BLB

9

0.022

JX113318

4

WDSP/11/0040

Kuala Juru, Seberang Perai, Penang

M

J

BLB

5

0.022

JX113319

5

WDSP/11/0041

Permatang Kriang, Seberang Perai, Penang

M

I

BLB

4

0.043

JX113320

6

WDSP/11/0042

Permatang Kriang, Seberang Perai, Penang

M

I

BLB

19

0.022

JX113321

7

WDSP/11/0043

Ladang Byram, Seberang Perai, Penang

F

K

BLB

20

0.130

JX113322

8

WDSP/11/0044

Ladang Byram, Seberang Perai, Penang

F

K

BLB

20

0.130

JX113323 JX113324

9

WDSP/11/0045

Ladang Byram, Seberang Perai, Penang

F

K

BLB

20

0.130

10

WDSP/11/0046

Ladang Byram, Seberang Perai, Penang

F

K

BLB

20

0.130

JX113325

11

WDSP/11/0047

Jerejak Rainforest Resort, Jerejak Island

M

H

BLB

12

0.065

JX113326

12

WDSP/11/0048

Jerejak Rainforest Resort, Jerejak Island

M

H

BLB

12

0.065

JX113327

13

WDSP/11/0049

Jerejak Rainforest Resort, Jerejak Island

M

H

BLB

11

0.022

JX113328

14

WDSP/11/0050

Jerejak Rainforest Resort, Jerejak Island

M

H

BLB

10

0.087

JX113329 JX113330

15

WDSP/11/0051

Jerejak Rainforest Resort, Jerejak Island

M

H

BLB

10

0.087

16

WDSP/11/0052

Jerejak Rainforest Resort, Jerejak Island

M

H

BLB

12

0.065

JX113331

17

WDSP/11/0053

Jerejak Rainforest Resort, Jerejak Island

M

H

BLB

10

0.087

JX113332

18

WDSP/11/0054

Jerejak Rainforest Resort, Jerejak Island

M

H

BLB

10

0.087

JX113333

19

WDSP/11/0055

Jerejak Rainforest Resort, Jerejak Island

M

H

BLB

15

0.022

JX113334

20

WDSP/11/0056

Jerejak Rainforest Resort, Jerejak Island

F

H

BLB

13

0.022

JX113335

21

WDSP/11/0057

Jerejak Rainforest Resort, Jerejak Island

M

H

BLB

16

0.022

JX113336

22

WDSP/11/0058

Sg. Baru, Teluk Kumbar, Penang Island

M

G

BLB

17

0.043

JX113337

23

WDSP/11/0059

Sg. Baru, Teluk Kumbar, Penang Island

F

G

BLB

17

0.043

JX113338

24

WDSP/11/0060

Surau MK 2, Tg. Bungah, Penang Island

M

B

BLB

6

0.022

JX113339

25

WDSP/11/0061

Batu Feringghi, Penang Island

M

A

BLB

14

0.022

JX113340

26

WDSP/11/0062

Permatang Pasir, Balik Pulau, Penang Island

M

E

BLB

18

0.022

JX113341

27

WDSP/11/0063

Surau MK 2, Tg. Bungah, Penang Island

M

B

BLB

7

0.109

JX113342

28

WDSP/11/0064

Surau MK 2, Tg. Bungah, Penang Island

M

B

BLB

7

0.109

JX113343

29

WDSP/11/0065

Surau MK 2, Tg. Bungah, Penang Island

M

B

BLB

7

0.109

JX113344

30

WDSP/11/0066

Surau MK 2, Tg. Bungah, Penang Island

F

B

BLB

7

0.109

JX113345

31

WDSP/11/0067

Surau MK 2, Tg. Bungah, Penang Island

F

B

BLB

8

0.022

JX113346

32

WDSP/11/0068

Bkt. Gambir, Gelugor, Penang Island

M

F

BLB

1

0.217

JX113347

33

WDSP/11/0069

Bkt. Gambir, Gelugor, Penang Island

M

F

BLB

1

0.217

JX113348

34

WDSP/11/0070

Bkt. Gambir, Gelugor, Penang Island

M

F

BLB

1

0.217

JX113349

35

WDSP/11/0071

Permatang Pasir, Balik Pulau, Penang Island

M

E

BLB

3

0.043

JX113350

36

WDSP/11/0072

Bkt. Gambir, Gelugor, Penang Island

F

F

BLB

2

0.022

JX113351

37

WDSP/11/0073

Bkt. Gambir, Gelugor, Penang Island

M

F

BLB

3

0.043

JX113352

38

WDSP/11/0074

Jln. Perak, Penang Island

M

D

BLB

7

0.109

JX113353

39

ZMW486

Tanjung Tokong, Penang Island

F

C

L

1

0.217

JX113354

40

ZMW487

Tanjung Tokong, Penang Island

M

C

L

1

0.217

JX113355

41

ZMW488

Tanjung Tokong, Penang Island

F

C

L

1

0.217

JX113356

42

ZMW489

Tanjung Tokong, Penang Island

F

C

L

1

0.217

JX113357

43

ZMW490

Tanjung Tokong, Penang Island

M

C

L

4

0.043

JX113358

44

ZMW491

Tanjung Tokong, Penang Island

M

C

L

1

0.217

JX113359

45

ZMW492

Tanjung Tokong, Penang Island

F

C

L

1

0.217

JX113360

46

ZMW493

Tanjung Tokong, Penang Island

M

C

L

1

0.217

JX113361

16

© University of Andalas / Copenhagen Zoo

Genetic diversity of M. fascicularis

Figure 1. The map showing the sampling locations and haplotype designation of M. fascicularis in the Penang Island, Jerejak Island, and Seberang Perai (mainland). Each letter (A-L) represents a sampling location while the numbers (1-20) represents the assigned haplotype number (for details see Table 1). Dotted arrows indicate haplotypes sharing between the locations.

2014 Journal of Indonesian Natural History Vol 2 No 1

17

Rovie-Ryan et al.

from the analysis by using the program Geneious v5.6. Sequence characterisations (variable sites, conserved sites and parsimony-informative sites) were done using Mega v5 (Tamura et al., 2011). Standard genetic diversity indices including the number of haplotypes (H), haplotype diversity (h), and nucleotide diversity (π) (Nei, 1987) were calculated in DnaSP v5 (Librado et al., 2009). The mtDNA CR contains two segments; hypervariable segment I (HVI) and II (HVII). Apparently, there has been no comprehensive study utilizing the complete CR in M. fascicularis. However, several authors worked on either one of the segments. Thus we split our dataset to compare our sequences with the available sequences of the HVI (Chu et al., 2007; Smith et al., 2007), and the HVII (Blancher et al., 2008; Kawamoto et al., 2008; Shiina et al., 2010). To analyse the genetic structuring between the mainland and the island as well as among the other regional populations, an estimate of population subdivision (FST) (Hudson et al., 1992) was calculated using DnaSP v5. Apart from that, the genetic distances between populations were also calculated by using the Kimura two-parameter model (Kimura, 1980) as performed using Mega v5. Phylogenetic Trees and Estimation of Divergence Time To infer the phylogenetic relationships, haplotypes data were used to generate the trees. Trees were constructed by using the neighbour-joining (NJ), maximum parsimony (MP), and maximum likelihood (ML) methods as implemented in Mega v5 and also the Bayesian method by using MrBayes (Huelsenbeck & Ronquist, 2001) as a plug-in in the Geneious program. A median-joining network was also constructed using the Network program (Bandelt et al., 1999). NJ was performed by using the Kimura 2-parameter distance model (Kimura, 1980) with pairwise deletion option while the MP analysis was done by using the CloseNeighbour-Interchange (CNI) option. The best-fit substitution model for ML was calculated in Mega v5 and the tree was constructed based on the HKY+G model using the Nearest-Neighbour-Interchange (NNI) option. The Bayesian analysis was performed by using the default settings with the HKY85 model (Hasegawa et al., 1985). Four heated Markov chains were initiated from random trees and sub-sampled at every 200 cycles. Delson (1996) proposed an early separation occurring

18

at around 5.5 million years ago (mya) between the African and the Asian Macaca lineage. Therefore, for the complete CR dataset, members from both lineages were included in the analysis; the Asian lineage was represented by M. mulatta (AY612638) and M. thibetana (EU294187), while the African lineage was represented by M. sylvanus (AJ309865). All trees were rooted with the outgroup species of the tribe Papionini, Papio hamdryas (Y18001). To assess the robustness of the trees, bootstrapping (Felsenstein, 1985) with 10,000 replicates were conducted on all the NJ, MP, and ML trees. To compare our dataset with the other regional populations of M. fascicularis, we constructed the ML tree, as described above. However, due to computational limitations, we ran the analysis with 100 bootstrapping replicates. The trees were rooted with sequences of M. cyclopis (HVI-DQ143986, HVII- AB261600), M. fuscata (HVI-AJ419862, HVII- AB261557), and M. mulatta from China (HVI-DQ373357, HVIIAB261958) and India (HVI-DQ373369, HVIIAB245416). By using the estimate of 1.6 million years ago (mya) for the divergence time between M. mulatta and M. fascicularis (Purvis, 1995; Hayasaka, 1996; Blancher et al., 2008), we re-calibrated the branch length of the ML tree in an attempt to date the divergence time of a major bifurcation event in the course of their evolution.

Results Genetic Diversity An alignment of 1,042 bp in length was produced from the 46 individual samples including the other Macaca species and outgroup sequences (N= 51) obtained from the GenBank. The sequences were later registered with the GenBank and were given accession numbers from JX113316-JX113361 (see Table 1). The nucleotide diversity (π) for the complete CR dataset was 0.012. Although the pooled island samples (Penang and Jerejak Island) consisted of 36 individuals, the π of 0.009 was observed to be lower than the mainland π of 0.013 which was represented by only 10 individuals. In total 20 haplotypes were detected using the complete dataset with a haplotype diversity (h) of 0.921. Considering the indels, the mainland had 5 haplotypes (h= 0.667) while the island had 16 (h= 0.895). A single haplotype sharing between the mainland and the island was observed (Hap4; Fig. 1).

© University of Andalas / Copenhagen Zoo

Genetic diversity of M. fascicularis

No

Population

N

Seg. Length

CS

VS

PIS

π

H

h

1

Jerejak Island

11

536

514

23

22

0.01445

4

0.764

2

Penang Island

25

536

504

33

21

0.0135

9

0.793

3

Seberang Perai

10

536

501

36

21

0.02276

5

0.667

4

Malaysia*

149

536-9

378

163

147

0.064

104

0.99

5

Indonesia

70

537-9

390

152

131

0.075

55

0.99

6

Philippines

83

537-40

430

110

64

0.023

34

0.81

1

7

Vietnam

89

538-40

441

99

85

0.039

48

0.97

8

Mauritius

68

537

523

14

10

0.001

8

0.27

Total

505

546

345

198

173

0.074

246

0.98

Table 2. Comparison among the different regional populations of M. fascicularis using the HVI segment. Number of haplotypes (H) and haplotype diversity (h) were calculated by considering sites with alignment gaps.

Seg. Length= Sequence Length, CS= Conserved sites, VS= Variable sites, PIS= Parsimony informative sites, π= Nucleotide diversity (Nei, 1987), H= No. of haplotypes, h= Haplotype diversity (Nei, 1987). 1 Mainland

No

Population

1

2

3

4

5

6

7

8

2.0

3.4

6.1

7.5

9.6

5.3

13.5

3.0

5.9

7.3

9.7

4.9

13.7

6.2

7.4

9.7

6.0

12.9

7.7

8.8

7.6

12.2

8.5

8.6

11.2

9.8

8.9

1

Jerejak Island

2

Penang Island

0.3

3

Seberang Perai

0.4

0.4

4

Malaysia*

0.4

0.4

0.4

5

Indonesia

0.4

0.4

0.4

0.0

6

Philippines

0.8

0.8

0.8

0.5

0.4

7

Vietnam

0.6

0.6

0.6

0.3

0.3

0.7

8

Mauritius

0.9

0.9

0.9

0.7

0.6

0.9

12.4 0.8

Table 2 compared the genetic diversity indices of the Penang populations to the other regional populations based on the HVI segment while Table 3 compared the estimates of population subdivision (FST) as well as the genetic distances. Separately, our finding revealed that the HVI segment contained more variations when compared to the HVII segment (see Appendix 1 for comparison between the HVI and HVII segments). Phylogeography The phylogenetic trees constructed using the NJ, MP (CI= 0.76, RI= 0.70), ML (–lnL= 3738.65), and Bayesian methods produced similar topologies and thus we summarised them using the ML tree as shown in Fig. 2A while Fig. 2B represents the median-joining haplotype network. Overall, the tree showed the monophyletic grouping of M. fascicularis. The tree topology and the haplotype network generally separated the 46 samples into three major groups: (1) Group I which consisted of three subgroups, (2) Group II which was formed entirely by the Jerejak Island samples, and (3) Group

2014 Journal of Indonesian Natural History Vol 2 No 1

Table 3. Estimates of population subdivision (FST) (below the diagonal) and pairwise distances (%, above the diagonal) among the geographical populations of M. fascicularis analysed.

III which consisted of a mixture of haplotypes from the mainland and the island samples. In Group I, subgroup I-1 consisted of haplotypes from the north-eastern part of the island (sites C, E, and F), subgroup I-2 consisted of haplotypes from the mainland (site J) which was adjacent to the island, while subgroup I-3 contained of a mixture of haplotypes from the rest of the island (sites A, B, D, and G). Furthermore, the single deletion mutation observed as mentioned earlier delineated Groups I and II from Group III. Both the HVI and HVII segment produced similar topologies (data not shown). A broader comparison of the Penang haplotypes with that of the other regional populations revealed that they were clustered within the continental lineage (Fig. 3). Additionally, in Figure 3, by calibrating node A which represents the bifurcation between M. mulatta and M. fascicularis, an estimated date of 1.04 mya at node B was obtained, which represents the last common ancestor between the continental and insular lineage.

19

Rovie-Ryan et al.

Figure 2. A. Phylogenetic relationships of the M. fascicularis haplotypes from Penang as represented by the ML tree. Values above the branches represent bootstrap confidence levels (10,000 replications) for NJ, MP and ML respectively. Values below the branches represent the Bayesian posterior probability. B. Median-joining haplotype network of the Penang M. fascicularis that formed the 20 haplotypes. Mutational steps are indicated in dotted circles (if not indicated, mutational step is equal to one; link lengths are proportional to mutational steps). The median vectors that represent hypothetical intermediates or missing (unsampled) haplotypes are shown in squares. The areas of the circles are proportional to the haplotype frequency.

Discussion Several studies on M. fascicularis have showed differences in variations between the HVI and HVII of the CR (Smith et al., 2007; Blancher et al., 2008; Kawamoto et al., 2008; Shiina et al., 2010). Similarly, our findings also revealed that the HVI harboured more variations compared to the HVII. Thus, we recommend that future studies on the CR should concentrate on the HVI. Previous studies investigating the genetic variations and diversity of M. fascicularis either examined the HVI (Smith et al., 2007) or HVII (Blancher et al., 2008; Kawamoto et al., 2008; Shiina et al., 2010).

20

Thus, only a handful of the complete CR sequences were available in Genbank for comparison. Smith et al. (2007) used the HVI on the Malaysian, Indonesian, Mauritius, Philippines, and Vietnamese M. fascicularis while Shiina et al. (2010) worked on three Indochinese subpopulations including the populations from Indonesia and the Philippines. Our finding revealed that all the haplotypes detected from Penang represent newly described haplotypes with none shared with the other M. fascicularis regional populations. Additionally, none of the haplotypes matched the samples (149 samples of unknown localities from Malaysia) used by Smith et al. (2007). Therefore, we would assume that the samples used by Smith et al. (2007) did not originate from

© University of Andalas / Copenhagen Zoo

Genetic diversity of M. fascicularis

the Penang population. However, the small number of samples used in this study could prevent us from detecting any possible haplotypes sharing. The π within the island for all three datasets (complete CR, HVI, and HVII) showed lower genetic diversity when compared to the mainland. This condition is very similar with the other island populations of Philippines and Mauritius, which could suggest a bottleneck or a small founder size following colonisation from the mainland (Blancher et al., 2008; Kawamoto et al., 2008). Nevertheless, the small sample number could also provide bias to the diversity observed. The distribution pattern of the haplotypes in this study strongly correspond to their geographical distributions (Fig. 1). Macaca in particular displays an extreme level of sex-biased dispersal (Melnick & Hoelzer, 1992) where only males disperse from one population to another while the females remain sedentary in nature. This will lead to geographically structured mitochondrial haplotypes which shows structuring of populations according to historical cladogenic events (Melnick et al., 1993; Tosi & Coke, 2007). In this study, we observed moderate structuring between the Penang mainland and the two island populations (FST of 0.43 and 0.37 respectively for Jerejak and Penang Island) as well as to the other neighbouring populations (FST of 0.37 for both the other Malaysian and Indonesian populations). The genetic distances between the mainland to the island populations are however low as compared to the other populations (Table 3). The narrow Penang Strait would act as a contemporary barrier to the gene flow between the mainland and the island apart from the sedentary nature of the females. The historical connectivity and the close proximity would explain the low genetic distances between the mainland and the island populations. On the other hand, the single haplotype sharing (Hap4) observed between the mainland and island could be explained as a remnant of the ancestral genetic makeup from the earlier colonisation from the mainland. The emergence of past land bridge connections permitted gene flow between the mainland and island populations. This is supported by our recent work on the Y-chromosomal gene flow of the males using the same samples set (Rovie-Ryan et al., 2013) where similar haplotypes sharing were observed. However in the past, translocations of M. fascicularis by the authorities from the island to the adjacent mainland as a response to the increasing human-macaque conflict due to the urbanisation (S. Elagupillay, pers. comm.) could also explain the haplotype sharing.

2014 Journal of Indonesian Natural History Vol 2 No 1

Figure 3. ML tree the HVI segment (-lnL= 8267.40) constructed using the HKY+G model (Hasegawa et al. 1985) with 100 bootstrapping. Note that the Penang haplotypes (Group I, II, and III) are clustered within the continental lineage. Following the ISO 3166-1 alpha-2 codes for the names of countries, MY codes for Malaysia, ID for Indonesia, VN for Vietnam, PH for Philippines, MU for Mauritius, CN for China, and IN for India. No major discrepancy was observed between the HVI and HVII trees (tree not shown).

21

Rovie-Ryan et al.

The single indel observed at np 217 distinguished the three major groupings of the Penang M. fascicularis. The insertion mutation represents the haplotypes within Group III while the deletion mutation represents the haplotypes for Groups I and II as also seen in the phylogenetic tree and the haplotype network (Fig. 2). Based on the basal positioning in the phylogeny tree, we suggest that the haplotypes of Group III represents the ancestral form of M. fascicularis in Penang. On a wider scale, all the sequences from the other regional populations of M. fascicularis using the HVI dataset also displayed the insertion mutation. Therefore, the deletion mutation observed in Group I and II is unique only to the Penang M. fascicularis. Due to this uniqueness, we propose that the Penang M. fascicularis particularly from the island should be managed as a management unit (MU). MUs are a second category of population subsets that are demographically distinct and are much smaller than the evolutionary significant units (ESUs) (Moritz, 1994). In Peninsular Malaysia, several strategies of population management has been used by the DWNP to control the human-Macaca conflicts including on-going population inventories, public awareness programmes, translocation, culling (DWNP, 2006), and recently experimenting on chemical castration (Karuppannan et al., 2013). The findings from this study would therefore provide policy makers with information on which priority areas or populations to preserve. The monophyletic clustering of the M. fascicularis as shown in the phylogenetic trees (Fig. 2 and 3) were in agreement with previous molecular studies using mtDNA data (Blancher et al., 2008; Hayasaka et al., 1996; Tosi et al., 2002). Comparisons with the other regional populations revealed that the Penang samples were clustered within the continental lineage (Fig. 3). The dichotomy between the continental and the insular lineage were first discovered by Harihara et al. (1988) and later confirmed by Tosi et al. (2002, 2003), Tosi and Coke (2007), and Blancher et al. (2008). Based on our calibration, we propose that by the middle Pleistocene, around 1.04 mya (Fig. 3), the separation of the continental and the insular lineage of M. fascicularis occurred. This estimate is close to that proposed by Tosi et al. (2003) and Blancher et al. (2008) at ~1.2 mya. The findings of this study revealed that genetic diversity and divergence of M. fascicularis were lower in the island as compared to the mainland which could suggest a bottleneck or small founder size following colonisation from the mainland. The shared haplotype

22

provided evidence on the historical connectivity between the mainland and island. The unique haplotypes observed in the Penang samples (especially the island population) would be a good indicator to conserve the genetic uniqueness of M. fascicularis in Penang. These findings could be used in management and conservation strategies especially in the population control, and would also be beneficial to other studies for example on the co-evolution of primates with vectors of diseases associated with primates (like evolution of simian malaria parasite) and biogeographical history of the Penang Island. Finally, we also discovered that the CR of the mtDNA is a powerful region to be used in addressing the genetic structuring of M. fascicularis. We acknowledge that the small sample numbers could be a source of bias in our findings. Therefore, for a more robust and geographically wide analysis, more samples should be collected from Penang and from a wider range of localities covering the entire Peninsular Malaysia, Sabah and Sarawak. Also, to infer current gene flow, further studies utilizing the Y-chromosome and microsatellite markers are currently being done.

Acknowledgements We would like to thank the Department of Wildlife and National Parks (DWNP), Malaysia, for providing the facilities, equipments, and personnels to conduct this pilot study. Also thanks to the State Director of DWNP Penang, Mr. Jamalun Nasir Ibrahim and his staff for their assistance. This project was funded by the DWNP, and partly by the Proboscis Genome Research grant awarded to M. T. Abdullah and colleagues. The sampling work for ZMW coded samples was supported in part by the USAID Emerging Pandemic Threat Program – PREDICT Project and by the Skoll Foundation and Google Incorporated through Global Viral. We would also like to thank the following individuals for their dedication and help during sampling: Tang Teong Kim, Osman Bakar and Rozeta Hj. Zahran. The samplings conducted complied with the rules, regulations and ethical standards in the treatment of the animals as laid down by all the relevant wildlife authorities in Malaysia as well as the guidelines by the Institutional Animal Care and Use Committee (IACUC), University of California, Davis, USA as adopted by the PREDICT Project. We also acknowledge the comments by two anonymous reviewers who helped to improve the earlier version of this manuscript.

© University of Andalas / Copenhagen Zoo

Genetic diversity of M. fascicularis

References Asadpour, R., Lim, H.S., Alashloo, M.M., Shekafti, S.A. and S. Moussavi (2011). Application of THEOS Imagery to study chlorophyll-a at the Strait of Penang Island, Malaysia. International Proceedings of Chemical, Biological and Environmental Engineering 17: 117-122. Bandelt, H-J., Forster, P. and A. Röhl (1999). Medianjoining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution 16: 37-48. Bird, M.I., Taylor, D. and C. Hunt (2005). Palaeoenvironments of insular Southeast Asia during the Last Glacial Period: a savanna corridor in Sundaland? Quaternary Science Reviews 24: 2228-2242. Blancher, A., Bonhomme, M., Crouau-Roy, B., Terao, K., Kitano, T. and N. Saitou (2008). Mitochondrial DNA sequence phylogeny of 4 populations of the widely distributed cynomolgus macaque (Macaca fascicularis fascicularis). Journal of Heredity 99: 254–264. Chu, J-H., Lin, Y-S. and H- Y. Wu (2007). Evolution and dispersal of three closely related macaque species, Macaca mulatta, M. cyclopis, and M. fuscata, in eastern Asia. Molecular Phylogenetics and Evolution 43: 418– 429. Cox-Singh, J. and B. Singh (2008). Knowlesi malaria: newly emergent and of public health importance? Trends in Parasitology 24: 406–410. Delson, E. (1996). The oldest monkeys in Asia. In International Symposium: Evolution of Asian Primates, (ed O. Takenaka), pp. 40. Primate Research Institute, Freude & Kyoto University, Inuyama, Aichi, Japan. Drummond, A.J., Ashton, B., Buxton, S., Cheung, M., Cooper, A., Duran, C., Field, M., Heled, J., Kearse, M., Markowitz, S., Moir, R., Stones-Havas, S., Sturrock, S., Thierer, T. and A. Wilson (2012). Geneious version 5.6. Http://www.geneious.com. DWNP. (2006). Pelan Pengurusan Kera (Macaca fascicularis) Bermasalah di Semenanjung Malaysia (English translation: Management Plan for Problematic Macaques (Macaca fascicularis) in Peninsular Malaysia). Department of Wildlife and National Parks, Kuala Lumpur, Malaysia.

2014 Journal of Indonesian Natural History Vol 2 No 1

Eudey, A.A. (2008). The crab-eating macaque (Macaca fascicularis): widespread and rapidly declining. Primate Conservation 23: 129–132. Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783–791. Fooden, J. (1995). Systematic review of Southeast Asian long- tail macaques, Macaca fascicularis (Raffles, [1821]). Fieldiana Zoology new series 81: 1–206. Harihara, S., Saitou, N., Hirai, M., Aoto, N., Terao, K., Cho, F., Honjo, S. and K. Omoto (1988). Differentiation of mitochondrial DNA types in Macaca fascicularis. Primates 29: 117–127. Harrison, T., Krigbaum, J. and J. Manser (2006). Primate biogeography and ecology on the Sunda Shelf Islands: A Paleontological and Zooarchaeological Perspective. In Primate Biogeography, (eds S.M. Lehman & J.G. Fleagle), pp. 331–372. Springer, New York, USA. Hasegawa, M., Kishino, H. and T. Yano (1985). Dating of human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22: 160–174. Hayasaka, K., Fujii, K. and S. Horai (1996). Molecular phylogeny of macaques: implications of nucleotide sequences from an 896-base pair region of mitochondrial DNA. Molecular Biology and Evolution 13: 1044–1053. Hudson, R.R., Boos, D.D. and N.L. Kaplan (1992). A statistical test for detecting population subdivision. Molecular Biology and Evolution 9: 138–151. Huelsenbeck, J.P. and F. Ronquist (2001). MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754– 755. Karimullah and A. Shahrul (2011). Condition and population size of Macaca fascicularis (long-tailed macaque). Journal of Cell and Animal Biology 5: 41– 46. Karuppannan K.V., Saaban, S., Firdaus Ariff, A.R. and A.R. Mustapa (2013). Non-surgical castration in controlling long tailed macaque (Macaca fascicularis) population by Department of Wildlife and National Parks (DWNP). Malaysian Journal of Veterinary Research 4(1): 33–36.

23

Rovie-Ryan et al.

Kawamoto, Y., Kawamoto, S., Matsubayashi, K., Nozawa, K., Watanabe, T., Stanley, M-A. and D. Perwitasari-Farajallah (2008). Genetic diversity of the longtail macaques (Macaca fascicularis) on the island of Mauritius: an assessment of nuclear and mitochondrial DNA polymoprhisms. Journal of Medical Primatology 37: 45–54. Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotides sequence. Journal of Molecular Evolution 16: 111–120. Lawler, S.H., Sussman, R.W. and L.L. Taylor (1995). Mitochondrial DNA of the Mauritian macaques (Macaca fascicularis): an example of the founder effect. American Journal of Physical Anthropology 96: 133–141. Librado, P. and J. Rozas (2009). DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 1451–1452. Ling, T.S. (2006). Behavioral study of Macaca fascicularis and interaction with humans at Taman Botani, Pulau Pinang. B.Sc. thesis, Universiti Kebangsaan Malaysia, Selangor, Malaysia. Melnick, D.J. and G.A. Hoelzer (1992). Differences in male and female macaque dispersal lead to contrasting distributions of nuclear and mitochondrial DNA variation. International Journal of Primatology 13: 379–393. Melnick, D.J., Hoelzer, G.A., Absher, R. and M.V. Ashley (1993). MtDNA diversity in rhesus monkeys reveals overestimates of divergence time and paraphyly with neighboring species. Molecular Biology and Evolution 10: 282–295. Moritz, C. (1994). Defining ‘Evolutionary Significant Units’ for conservation. Trends in Ecology and Evolution 9: 373–375. Nei, M. (1987). Molecular Evolutionary Genetics. Columbia University Press, New York, USA. Perwitasari-Farajallah, D., Kawamoto, Y. and B. Suryobroto (1999). Variation in blood proteins

24

and mitochondrial DNA within and between local populations of longtail macaques, Macaca fascicularis on the Island of Java, Indonesia. Primates 40(4): 581– 595. Perwitasari-Farajallah, D., Kawamoto, Y. and R. C. Kyes (2001). Genetic characterization of long-tailed macaques (Macaca fascicularis) on Tabuan Island, Indonesia. Primates 42(2): 141–152. Ping, K.O. (2003). Behavioral study of Macaca fascicularis and interaction with humans at Taman Belia, Pulau Pinang. B.Sc. thesis, Universiti Kebangsaan Malaysia, Bangi, Malaysia. Purvis A. (1995). A composite estimate of primate phylogeny. Philosophical Transactions of the Royal Society B: Biological Sciences 348: 405–421. Rovie-Ryan, J.J., Abdullah, M.T., Sitam, F.T., Abidin, Z.Z. and S.G. Tan (2013). Y-chromosomal gene flow of Macaca fascicularis (Cercopithecidae) between the insular and mainland peninsula of Penang state, Malaysia. Journal of Science and Technology in the Tropics 9: 113-126. Rozen, S. and H. Skaletsky (2000). Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology (eds. S. Krawetz & S. Misener), pp. 365–386. Humana Press, Totowa, USA. Sathimurthy, E. and H.K. Voris (2006). Maps of Holocene sea level transgression and submerged lakes on the Sunda Shelf. Natural History Journal of Chulalongkorn University Supplement 2: 1–44. Schillaci M.A., Saravia, S., Lee, B.P.Y.-H. and C. Matheson (2011). Preliminary report on mitochondrial DNA variation in Macaca fascicularis from Singapore. The Raffles Bulletin of Zoology 59(1): 101–108. Shiina, T., K. Tanaka, Y. Katsuyama, K. Otabe, K. Sakamoto, M. Kurata, M. Nomura, H. Yamanaka, H. Nakagawa, H. Inoko and M. Ota, (2010). Mitochondrial DNA diversity among three subpopulations of cynomolgus macaques (Macaca fascicularis) originating from the Indochinese region. Experimental Animal 59: 567–578.

© University of Andalas / Copenhagen Zoo

Genetic diversity of M. fascicularis

Shuan, H.H. (2006). A study on aggressive and submissive behaviour in Macaca fascicularis at Botanical Garden, Penang. B.Sc. thesis, Universiti Kebangsaan Malaysia, Selangor, Malaysia.

Thayaparan, S., Robertson, I.D., Fairuz, A., Suut, L. and M.T. Abdullah (2014). Leptospirosis, an emerging zoonotic disease in Malaysia. Malaysian Journal of Pathology 35(2): 125–134.

Smith, D.G., McDonough, J.W. and D.A. George (2007). Mitochondrial DNA variation within and among regional populations of longtail macaques (Macaca fascicularis) in relation to other species of the fascicularis group of macaques. American Journal of Primatology 69: 182–198.

Tosi, A.J. and C.S. Coke (2007). Comparative phylogenetics offer new insights into the biogeographic history of Macaca fascicularis and the origin of the Mauritian macaques. Molecular Phylogenetics and Evolution 42: 498–504. Tosi, A.J., Morales, J.C. and D.J. Melnick (2002). Y-Chromosome and mitochondrial markers in Macaca fascicularis indicate introgression with Indochinese M. mulatta and a biogeographic barrier in the Isthmus of Kra. International Journal of Primatology 23: 161–178.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and S. Kumar (2011). Mega version 5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731–2739.

Tosi, A.J., Morales, J.C. and D.J. Melnick (2003). Paternal, maternal, and biparental molecular markers provide unique windows onto the evolutionary history of macaque monkeys. Evolution 57: 1419–1435.

Thayaparan, S., Robertson, I., Amran, F., Su’ut, L. and M.T. Abdullah (2013). Serological prevalence of leptospiral infection in wildlife in Sarawak, Malaysia. Borneo Journal of Resource Science and Technology 2(2): 79–82.

Voris, H.K. (2000). Maps of Pleistocene sea levels in Southeast Asia: shorelines, river systems and time durations. Journal of Biogeography 27(5): 1153–1167.

Appendix 1. Comparison between the HVI and HVII of the mtDNA CR from different regional populations of M. fascicularis. Number of haplotypes (H) and haplotype diversity (h) were calculated by considering sites with alignment gaps. HVIa (546 bp) N

Seg. Length

HVIIb (466 bp)

No

Population

CS

1

Penang1

46

536-7

490

2

Malaysia

149

536-9

378

VS

H

h

N

Seg. Length

CS

VS

PIS

π

H

h

0.021

17

0.91

46

461

451

10

6

0.003

9

0.64

0.064

104

0.99

PIS

π

47

40

163

147

3

Indonesia

70

537-9

390

152

131

0.075

55

0.99

65

438-61

384

82

64

0.033

56

0.99

4

Philippines

83

537-40

430

110

64

0.023

34

0.81

14

438-58

451

13

8

0.010

7

0.87

89

538-40

441

99

85

0.039

48

0.97

5

Vietnam

6

Cambodia

7

Mauritius

68

537

523

14

10

0.001

8

Total

511

546

346

200

176

0.072

261

23

461-2

408

55

35

0.027

22

1.00

48

441-62

392

71

35

0.021

42

0.99

0.27

6

439-59

461

1

1

0.001

4

0.87

0.98

202

466

332

134

93

0.05

140

0.98

Seg. Length= Sequence Length, CS= Conserved sites, VS= Variable sites, PIS= Parsimony informative sites, π= Nucleotide diversity (Nei, 1987), H= No. of haplotypes, h= Haplotype diversity (Nei, 1987). a Smith et al. (2007) b Shiina et al. (2010), Kawamoto et al. (2008), and Blancher et al. (2008)

2014 Journal of Indonesian Natural History Vol 2 No 1

25

Asiatic Soft-shell Turtle Amyda cartilaginea in Indonesia: A Review of its Natural History and Harvest Mirza D. Kusrini1, Ani Mardiastuti1, Mumpuni2, Awal Riyanto2, Sri M. Ginting3, and Badiah3 Department of Forest Resources Conservation and Ecotourism, Faculty of Forestry, Bogor Agricultural University, Indonesia Museum Zoologicum Bogoriense, Research Center for Biology, Indonesian Institute of Science, Indonesia 3 Ministry of Forestry, Republic of Indonesia 1 2

Corresponding author: Mirza D. Kusrini, Email: [email protected] Abstrak Makalah ini mengulas tentang biologi dan pemanenan labi-labi Amyda cartilaginea di Indonesia. A. cartilaginea tersebar secara luas di Indonesia, terutama pada lahan basah di pulau-pulau besar. Dari berbagai survey diketahui bahwa A. cartilaginea ditemukan pada berbagai habitat perairan tawar, sebagian bahkan dapat ditemukan di sekitar permukiman. Individu betina dapat bertelur beberapa kali dalam setahun, namun masa biak tidak dapat ditentukan dengan pasti. Labi-labi betina diperkirakan mulai mampu bereproduksi sekitar usia 3 tahun. Meski pun labi-labi tidak pernah ditemukan dalam jumlah banyak pada suatu wilayah karena warnanya yang tersamar, jumlah populasinya secara umum melimpah. Mengingat bahwa spesies ini telah terdaftar dalam CITES Appendiks II, maka pemanenan labi-labi A. cartilaginea untuk tujuan ekspor telah diatur oleh pemerintah Indonesia. Pemanenan labi-labi dilakukan sepanjang tahun, tanpa memperhatikan jenis kelamin. Penelitian lebih mendalam tentang ekologi labi-labi dan dampak pemanenannya masih diperlukan. Pemanenan labi-labi dianggap mengkhawatirkan bagi kelestarian spesies ini. Untuk pengelolaan spesies, pemantauan tahunan terhadap pemanenan dengan menggunakan metoda standard perlu dilakukan, khususnya pada lokasi dengan jumlah pemanenan yang tinggi. Abstract This paper provides a review of the natural history and harvest levels of the Asiatic soft-shell turtle Amyda cartilaginea in Indonesia. A. cartilaginea is distributed widely in Indonesia, mostly in wetlands of the major islands. Surveys have found that A. cartilaginea reside in various freshwater habitats, even some near the vicinity of human settlements. There is no apparent breeding season, and females might lay more than one clutch during the year. It is estimated that females become reproductive around 3 years of age. Although A. cartilaginea is never seen in large numbers in one area, mostly due to its cryptic nature, it is generally considered abundant. Harvest of A. cartilaginea for export is regulated by the Government of Indonesia, as part of its inclusion in Appendix II of CITES. In practice, harvest is conducted all year, with no apparent preference for sex, but more research is needed regarding the species ecology and impact of harvest. The harvest of A. cartilaginea in Indonesia is a major concern for the conservation of the species. Annual monitoring of harvest levels using standardized methods should be carried out especially in locations subjected to high harvesting pressure, to assist management of the species. Keywords: Amyda cartilaginea, harvest, trade, population

Introduction The Asiatic soft-shell turtle, Amyda cartilaginea, is distributed in Southeast Asia from Myanmar to Indonesia. It is one of the largest fresh-water turtle species in Indonesia with a carapace length reaching up to 80 cm (Iskandar, 2000). The turtles occupy a wide range of habitats, such as muddy rivers, ponds and irrigation canals, slow moving lowland streams and Received 4th February 2014; Revision accepted 29th April, 2014

26

rivers, swamps, and oxbow lakes adjacent to large rivers (Lim & Das, 1999). In Indonesia, the species is found almost in all big islands, such as Borneo, Sumatra, Java, Bali and Sulawesi except for Papua (Auliya, 2000; Iskandar, 2000; Koch et al., 2008). A. cartilaginea is exploited for consumption in Indonesia (Asian Turtle Trade Working Group, 2000; Iskandar, 2000) and due to years of extensive harvesting the population has declined in all range countries except Brunei Darussalam, Cambodia and India (CITES, 2004). The species is now listed as “Vulnerable” on the IUCN Red-list, mostly due to habitat loss and

© University of Andalas / Copenhagen Zoo

Natural history and harvest of A. cartilaginea

over-exploitation (Asian Turtle Trade Working Group, 2000). As the only country with a quota for export, Indonesia is under scrutiny for its extensive legal hunting of A. cartilaginea. According to data by the WCMC database, the harvest quota for individuals of this species was 25,200 heads in 2013. At the inclusion of this species in CITES as Appendix II, exports of live turtles in Indonesia exceeded quota levels (2005 to 2007), whereas after 2008 the export never exceeded the legal quota (Tab.1). Despite the large off-take of this species, information pertaining to harvesting effort, demography, ecology or conservation of the species in Indonesia is lacking. From 2009 to 2012, a series of research activities on A. cartilaginea were conducted in various locations in Indonesia, consisting of harvest monitoring in Kalimantan and Sumatra, and breeding biology in experimental breeding farms. This paper aims to compile available knowledge about a) ecology and life history, b) population dynamics, and c) review the existing information about harvest and trade of A. cartilaginea in Indonesia.

Ecology and life history The Asian soft-shell turtle, Amyda cartilaginea, is a big sized freshwater turtle. The maximum carapace length (CL) of A. cartilaginea has been reported to reach 100 cm, although the CL of most A. cartilaginea found in the wild measure up to 60 cm (Iskandar, 2000). The

Table 1. Exports and quotas of Amyda cartilaginea from 2005 – 2013 (Source: WCMC, CITES Trade Database*, Directorate General of Forest Protection and Nature Conservation). Year

Export Quota

Actual Exports*

Purpose

2005

27000

34066

Consumption

2006

27000

32665

Consumption

2007

27000

26710

Consumption

2008

25200

25197

Consumption

2009

25200

25200

Consumption

2010

25200

25104

Consumption

2011

23400 1800

24764

Consumption Pet

2012

25200

No data

Consumption

2013

25200

No data

Consumption

2014 Journal of Indonesian Natural History Vol 2 No 1

longest carapace length reported, based on survey data, is 80 cm in East Kalimantan (Kusrini et al., 2009) and 70 cm in Riau (Mumpuni and Riyanto, 2010). In East Kalimantan, turtles harvested for trade typically weigh 13.5 kg (n = 612) but have been recorded up to 65 kg (Kusrini et al., 2009). There is no literature available on growth rates. There are no records on A. cartilaginea longevity, age at first reproduction or maximum breeding age. However, Mumpuni and Riyanto (2010) reported that the CL of a 2 year old mature female measure approximately 30 cm. Using data from East Kalimantan (Kusrini et al., 2009), a 30 cm CL corresponds to a 3 kg body mass for A. cartilaginea. Results from dissections of female turtles collected in Jambi Province (Sumatra) showed that the smallest size of sexually mature females measured 28.5 cm CL, 24 cm Carapace Width (CW) and 2.2 kg body mass (Mumpuni & Riyanto, 2010). Ginting (2012) reported that the smallest sexually matured female turtle dissected with egg follicles measured 32.4 cm CL and 3.19 kg body mass. Therefore, it is reasonable to assume that a 2 year old female is already able to reproduce. Reports on the number of eggs per clutch varied. Iskandar (2000) indicates 40 as the maximum clutch size, whereas Liat and Das (1999) stated that the clutch sizes range from 5 – 30 eggs. Hunters in East Kalimantan reported that the number of eggs per clutch was 20-50 (Kusrini et al., 2009). From nine nests occurring at Belawa Villages (West Java), the number of eggs found was 3 – 17 per nest (Kusrini et al., 2007). Susanti (2013) reported that the number of eggs from 10 nests at an experimental farm was 11 – 19 eggs per clutch. Based on dissection of 6 specimens, Mumpuni and Riyanto (2010) found the number of follicles ranged from 16 – 29 with at least two different sizes, which suggest that the species might be able to release eggs at least twice during breeding season. New eggs are usually pure white in color, translucent (somewhat transparent) and the outer skin of the egg is soft. Eggs that have been long in the nest are a white or creamy white bone colour (not shiny), smooth, and hard-shelled, but fragile (Kusrini et al., 2007). The size of A. cartilaginea eggs is shown in Table 2. Incubation time differs for each clutch, which reflects environmental variables such as nest temperature and humidity, as is the case for other turtle species. Iskandar (2000) reported that eggs of A. cartilaginea hatch after 135-140 days, whereas Susanti (2013) reported

27

Mirza et al.

Mean

Range

Diameter (mm)

Weight (g)

Diameter (mm)

Weight (g)

Pritchard (1979)

-

-

30.5 – 35.5

-

Liatt & Das (1999)

-

-

21.0 – 40.0

-

32.3

17.2

31.1 – 33.2

14.5 – 18.8

-

-

21.0 – 33.0

-

Kusrini et al (2007)

30.0

17.6

27.0 – 32.0

13.9 – 21.4

Susanti (2013)

31.8

19.5

28.4 – 34.6

12.0 – 24.0

Age group

Approximate age (year)

# of dead individuals

Un-reproductive adults

> 80

7

Reproductive adults

3-20

80

Juveniles

0-1

Source

Kusdinar et al. (1999) Iskandar (2000)

Table 3. Amyda cartilagenea mortality in Belawa Village Cirebon during the infection episode in 2010 (Source: Sunyoto 2013).

125 Total

Table 2. Diameter and weight of Amyda cartilaginea eggs.

212

Table 4. Habitat characteristics of Amyda cartilagenea at different locations in Indonesia. Habitat type

Adjacent landscape

Water body width

Depth (m)

Bulungan, Berau, and Malinau Regencies at the northern part of East Kalimantan Province

River

Rural and ex logging concession area

5-20m

3-8

Sambas and Ketapang Regency, West Kalimantan

River

Not available

Not available

Not available

25m (river) 1200ha (fresh-water swamp)

2-7

2-5m (river) 5-7ha (peat swamp)

1.5-2

Location

Ogan Komering Ilir Regency, South Sumatra

River, swamp and flood plain

Rokan Hulu and Siak Regency of Riau Province, Sumatra

River and peat swamp

West Sumatra

Irrigation Rice fields, human channel, river habituation

0.5 – 2m (water irrigation)

0.3-1.2

Belawa Village, Cirebon Regency of West Java Province

Man-made fish pond

0.01-0.2ha

1.5-3

28

Palm oil plantation

Human habituation

Vegetation around water bodies

Source

Hard wood and bushes, mostly unshaded

Kusrini et al 2009

Not available

Lily 2010

Grass and bushes, Oktaviani 2007 Mostly unshaded Grass and bushes, Mumpuni & mostly unshaded Riyanto 2010 Paddy, grass, garden plants, mostly unshaded

Mumpuni et al. 2011

Few garden plants, mostly unshaded

Kusrini et al. 2007

© University of Andalas / Copenhagen Zoo

Natural history and harvest of A. cartilaginea

that from three clutches of eggs induced by artificial incubation, juveniles emerged after 95 - 102 days of incubation. Newly hatched juveniles live primarily on their egg yolk for 3-5 days after hatching. The size of newly hatched juveniles range from 4.0 – 5.1 cm CL with a body weight of 9.0 – 17.0 g (Susanti, 2013). In Riau, Mumpuni and Riyanto (2010) reported that the diet of A. cartilaginea consisted of oil palm seeds, cassava, scrap, fish, unidentified leaf and seeds and avifauna. Furthermore, Mumpuni et al. (2011) indicated that the soft-shelled turtle at Bandar Gadang (West Sumatra Province) in rice fields consumed primarily snails of the species Pomacea canaliculata, similar to the finding of Ginting (2012) in Jambi, suggesting that A. cartilaginea is an important predator of this pest. In Belawa (West Java) the turtles are sometimes given food by villagers consisting of water spinach, dried fish, and other food scraps (Kusrini et al., 2007). All of this is relevant to the conclusions of previous researchers that A. cartilaginea is an opportunistic omnivore (Amri & Khairuman, 2002; Iskandar, 2002; Jensen & Das, 2006; Pritchard, 1979). Information on the diseases of A. cartilaginea is scarce. In 2010, Indonesian media reported that hundreds of A. cartilaginea died in Belawa, West Java (Haryadi & Pamungkas, 2010). An unpublished report by the fisheries quarantine laboratories in Cirebon revealed that these turtles were infected by Saprolegnia sp. fungus, along with Edwardsiella tarda and Aeromonas veronii bacteria (Badan Karantina Ikan Pengendalian Mutu dan Keamanan Hasil Perikanan, undated). Sunyoto (2010) reported that more than 200 turtles died from the infection in a very short time (Tab. 3). A report by Indonesia CITES MA (2008) cited information by traders in Kalimantan and Sumatra that many A. cartilaginea were infested by leeches. Information by Sudiana et al. (2000) in Java showed that 90% of the samples of wild A. cartilaginea were infested by the ectoparasite worm, Pseudocalceostoma sp. both on the carapace and plastron. There has been little information on micro-habitat use and movement of the A. cartilaginea. Kusrini et al. (2009) reported that hunters in East Kalimantan find A. cartilaginea in underground cavities of riverbanks, where they rest, mate, and congregate. Furthermore, hunters reported that 7 to 12 A. cartilaginea can use the same mud cavity at the same time. A. cartilaginea is primarily aquatic but, as with most turtles, females lay eggs in terrestrial nests near water bodies. Almost all reports stated that key

2014 Journal of Indonesian Natural History Vol 2 No 1

habitats consist of a variety of freshwater habitats: ponds, lakes (including oxbow lakes adjacent to large rivers), streams and rivers (upland streams and muddy, slow-flowing lowland streams, and rivers), peat swamps, canals, and possibly estuaries (Auliya, 2007; Iskandar, 2000). Surveys in the last few years in Kalimantan, Sumatra and Java shows that key habitat is not necessarily situated in natural areas with dense vegetation surrounding the water bodies (Ginting, 2012; Kusrini et al., 2009; Lilly, 2010; Mumpuni & Riyanto, 2010; Mumpuni et al., 2011; Oktaviani, 2008). Instead, A. cartilaginea is well adapted to water bodies near human habitation or man-made habitats such as fish ponds and water channels adjacent to paddy fields (Tab. 4). This might explain its wide distribution. Nesting usually take place near water bodies. In East Kalimantan, hunters reported that A. cartilaginea lays eggs underground in muddy substrate or among tree buttresses covered with leaves and rotten wood (Kusrini et al., 2009). Surveys by Mumpuni et al. (2011) in West Sumatra found a nest containing 6 eggs near an irrigation channel for rice fields, beneath a kapok tree (Ceiba pentandra). In Belawa, Cirebon (West Java), nests were found on sloping ground at the edge of the pond, covered by grass, with the distance to the water of about 1.9-4.5 m (Kusrini et al., 2007).

Population estimates Previous reports categorized the population of A. cartilaginea in Indonesia as “common” or “locally abundant” (Samedi & Iskandar 2000). In contrast, a report by Setyobudiandi and Zairion (1997) mentioned difficulties in finding the species in West Java, which resulted in A. cartilaginea in Java being considered “not suitable for commercial harvest”. However, to date there exists no reliable population estimate with the current estimates subjected to various biases. For example, in Belawa Cirebon, the local people often reported that the present harvesting numbers of A. cartilaginea were lower compared to past harvesting numbers. While it may provide a relative indication of population size, it may also merely reflect changes in harvesting efforts. In 1995, Kusdinar et al. (1999) found 88 individual turtles in Cikuya River in Belawa (consisting of 6 hatchlings, 12 juveniles and 70 mature individuals). This is approximately half of what was found in a 2007 survey (Kusrini et al., 2007) where 161 individuals were recorded. Low sightings and capture

29

Mirza et al.

rates do not necessarily mean low population size but can be a result of sampling bias as experienced in many other herpetological surveys (Plummer et al., 2008; Wilson et al., 2008), especially for cryptic species. Since A. cartilaginea tends to stay covered in mud for prolonged periods of time (Sunyoto, 2012) they are particularly subject to estimation bias. Efforts to estimate populations were carried out in East Kalimantan (Kusrini et al., 2009) and Sumatra (Mumpuni et al., 2010, 2011). Using a series of baited hooks for two weeks, 36 individual A. cartilaginea were captured collectively in East Kalimantan (Kusrini et al., 2009). A rough estimate revealed a relative density of 0.66 A. cartilaginea per kilometer of river in East Kalimantan. A higher value was provided by Mumpuni et al. (2011) in their survey in West Sumatra, where the relative density of A. cartilaginea in water irrigation channels reached 16 individuals/km. In Lubuk Dalam peat swamp in Riau, in the vicinity of an oil palm plantation, the relative density of A. cartilaginea was 21 individuals/ha (Mumpuni et al., 2010). These results indicate that the density of the soft-shelled turtles varied according to location. However, there might be bias in calculating density due to (1) observer variation, (2) unequal capture effort and difficulties, (3) inclusion of escaped captured turtles, and (4) movement and migration of turtle. Surveys showed that the soft-shelled turtle tend to be solitary, able to be submerged in water for long periods of time, thus visually difficult to detect and most probably has a wide home range. Irrespective of natural densities or habitat types, tens of thousands of turtles are captured and traded every year (Tab. 1).

Harvest and trade Harvesting techniques varied according to location. In East Kalimantan Kusrini et al. (2009) reported that hunters harvest turtles using baited hooks, except in Sebuku, where respondents used long sticks to locate turtles. To fish for turtles, a series of 10 – 70 baited hooks are placed at certain distances along a riverbank. Bait consists of meat from a variety of species such as chicken, fish, wild boar (Sus scrofa), monitor lizard (Varanus salvator), reticulated python (Python reticulatus), and even primates e.g. Proboscis monkey (Nasalis larvatus). Fishing lines with hooks are usually placed during high water and checked at least three times, each with an hour interval, before the hunter moves to another hunting site(s). If a turtle takes the bait,

30

the hunters remove it and transports them to a collector alive. The use of baited hooks was also reported by Walter (2000) in Sentarum Lake, West Kalimantan. In West Sumatra, harvesting is carried out by pole fishing and a blunt stick (Mumpuni et al., 2011). The first method is usually applied by fishermen mainly to catch fish, with turtles not the main target and being a by-catch. The second method is used by professional turtle hunters. A team consisting of 3 to 5 people will walk along small creeks or tunnels to search turtle using a blunt stick to probe the bottom. Whenever the tip of the stick strikes a turtle, the hunters will surround and catch it. The method is usually applied during dry season between February and June. In Air Hitam Dalam River in Sumatra, professional turtle hunters used fishing rods to capture A. cartilaginea as well as rattan funnel traps using duck-meat as bait. The fishing rod was checked every day in the afternoon. In Riau and Jambi, nylon funnel traps known as lukah measuring 100 cm x 80 cm x 100 cm and metal funnel traps (pengilar), measruing 80 cm long and 40 cm in diameter were also used, as well as electric fishing methods (Mumpuni & Riyanto, 2010). In general, hunters do not differentiate between males and females of A. cartilaginea in Indonesia, which is illustrated by the equal proportion of females and males captured (Kusrini et al., 2009; Lilly, 2010; Ginting, 2012). Instead, the sex ratio of the harvested specimens of A. cartilaginea seemed to illustrate the success of capture effort. We assumed that these conditions were primarily caused by the nature of harvesting, which occurs all year round, excluding the possibility of catching only one specific sex (e.g. if only hunting in the nesting season). In addition, there are no specific consumer preference for neither males nor females. This is of critical conservation importance, because preference for particularly breeding females can have several negative consequences. A high proportion of female Pig-nosed turtle (Carettochelys insculpta) is harvested in Papua New Guinea, which are typically captured during the nesting seaon (Eisemberg, 2010), and similarly for the Mekong snail-eating turtle (Malayemys subtrijuga) in Cambodia, because of comsumer demand for females with eggs as special dishes (Platt et al., 2008). Harvest size-limits are imposed by Indonesia’s CITES Management Authority, and are based on weight. By these rules hunters are allowed to harvest specimens weighing less than 5.5 kg (mostly for pets) or more than 13.5 kg (for meat/consumption), leaving most of

© University of Andalas / Copenhagen Zoo

Natural history and harvest of A. cartilaginea

the reproductive individuals (Indonesia CITES MA, 2008). Unfortunately, in practice all measurements of the harvested turtles reveal that more than half fell within the prohibited range of 5.5-13.5 kg. Based on surveys carried out in Kalimantan (Kusrini et al., 2009; Lily, 2010), and Sumatra (Ginting, 2012; Mumpuni et al., 2011; Oktaviani, 2007), the population structure, based on the body weight, showed a heavy bias towards small individuals, with the smaller turtles captured at a much higher rate than larger reproductive individuals. The fact that harvests mostly captured small size turtles probably corresponds with the size structure of actual populations in the wild. Assuming that the demography of A. cartilaginea in Belawa represented the wild population elsewhere, results of Kusrini et al. (2009) surveys showed that the population of A. cartilaginea scattered in ponds in Belawa consisted mostly of small individuals. Of the 161 turtles found, 3.7% were hatchling, 50.9% were juvenile, 33.6% were sub-adult and only 11.8% were adult. In 2009, 18 exporters established the association APEKLI (Asosiasi Pengusaha Kura-kura dan Labi-labi

Konsumsi Indonesia; Association of Turtle and Softshelled Turtle Traders). Quota levels for turtle harvest set by Indonesia CITES MA were disseminated to the members of the Association. Export quotas for A. cartilaginea is based on heads, and not by weight. Since the price of A. cartilaginea for consumption depends on weight, traders prefer to sell bigger sized turtles, rather than smaller sized. All exporters get turtles from their collectors, and although exporters might decide to refuse turtles when quota limits are passed (Indonesia CITES MA, 2008), in reality traders claim that rejecting harvesters is not possible due to social concerns (Maraden Purba, pers. comm). Small turtles are sometimes kept in holding ponds until they grow to sufficient sizes (Ginting, 2012; Indonesia CITES MA, 2008; Oktaviani, 2007) or they are sold for domestic and international markets beyond the quota limits. At the moment, there is no information on the estimated number of turtles used for domestic consumption. The export quota for A. cartilaginea remained stable at 27,000 heads between 2005 and 2007. In 2008, the export quota for A. cartilaginea was adjusted

Figure 1. The distribution of 2010 harvest of Amyda cartilagenea from Indonesia (Data Source: Directorate General of Forest Protection and Nature Conservation).

2014 Journal of Indonesian Natural History Vol 2 No 1

31

Mirza et al.

downwards to 25,200. The quota covers two purposes, namely for consumption and for pets, in which more than 80% are for consumption (Tab. 4). Based on 20052012 CITES trade data, A. cartilaginea from Indonesia is exported to 22 countries from Asia, Europe, North America and Middle East, with the majority going to Singapore (49%), Hong Kong (36%) and China (9%). Except for the Netherlands, that still imports of small numbers of A. cartilaginea in 2010 and 2011, export of Indonesian A. cartilaginea to Europe stopped after a European Union Wildlife Trade Regulation suspended A. cartilaginea from Indonesia in 2008. Based on data published annually by Indonesia CITES MA, the source of A. cartilaginea came from two main islands of Indonesia: Kalimantan and Sumatra. Using the 2010 harvest data, two provinces have the highest production of A. cartilaginea namely East Kalimantan and North Sumatra Province (Fig. 1). The high number of reproductively active A. cartilaginea captured each year has raised concerns about maintaining a stable population in the wild. The available data on the relative density of the A. cartilaginea from previous surveys might be useful to gain insight into the number of harvestable specimens within a province. The risk of this, however, is that such data may provide an inaccurate estimation of A. cartilaginea population in a province and, therefore, a false foundation for quota setting. Whereas key habitat of A. cartilaginea consists mainly of fresh water wetlands, possibly shallow freshwater wetlands located below 500 m above sea levels (Oktaviani, 2007) there is no available data on size of freshwater wetlands in each province in Indonesia. It is estimated that there are more than 20 million ha of freshwater habitat in Indonesia, excluding rivers (Komite Nasional Pengelolaan Lahan Basah Indonesia, 2004). Considering the availability of a wide range of key habitats for A. cartilaginea, it is estimated that the potential number of harvestable turtles is in fact higher than the existing quota. Estimations of harvest levels in East Kalimantan indicate that the capture rate was still far below the production of A. cartilaginea in the survey area. However, without accurate data on national or international trade, or turtle populations, a precautionary approach should be used in harvesting regimes. The export harvest for two companies in Balikpapan in 2008 was 3,979 heads which included 13% mortality (ID CITES MA, 2008). Currently, there are no A. cartilaginea breeding farms in Indonesia, however,

32

breeding trials are already underway in several locations. In Siak Regency, Riau (Sumatra), the pulp and paper company of Sinar Mas Group has prepared a facility to breed A. cartilaginea, and started with a holding of 48 parent stock (Mumpuni et al., 2010). Unfortunately, there have been no further reports on the development or success of this facility over the past several years. The association of turtle traders has begun to encourage members to carry out breeding trials in Tangerang (Banten Province), and nine parent stock (6 females and 3 males) kept in a pond by PT Ekanindya Karsa since 2008 successfully breed at the end of 2011 (Susanti, 2013). The company, whose main commodity is captive breeding of crocodiles, has expanded with ponds designed to house the new juvenile A. cartilaginea.

Conservation recommendations It is clear from the limited available data that there is a need for more information to assess the impact of harvesting on the populations of A. cartilaginea in site specific regions. Further research on reproduction, ecology and population dynamics should be undertaken at localities across the range of A. cartilaginea for comparative purposes. Long term research should be initiated in areas where the A. cartilaginea is abundant, in harvested and non-harvested areas. Standard methods to monitor A. cartilaginea population should be developed, including methods to mark individual for the purpose of mark-recapture studies. Modeling of habitat suitability of A. cartilaginea should be carried out. Trade monitoring should be done monthly and be reported annually by the respective Regional Forestry Office in each province (BKSDA). To assess population structure and seasonal fluctuation, exporters should provide a record of size/weight collected by harvesters. Trade monitoring should also include monitoring of A. cartilaginea for domestic consumption.

References Amri K and Khairuman (2002). Mengenal lebih dekat Labi-labi: Komoditas Perikanan Multimanfaat. PT. Agro Media Pustaka, Jakarta.

© University of Andalas / Copenhagen Zoo

Natural history and harvest of A. cartilaginea

Asian Turtle Trade Working Group (2000). Amyda cartilaginea. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. . Downloaded on 29 March 2013. Auliya, M (2007). An identification guide to the tortoise and freshwater turtles of Brunei Darussalam, Indonesia, Malaysia, Papua New Guinea, Philippines, Singapore and Timor Leste. TRAFFIC Southeast Asia. Petaling Jaya, Malaysia. Badan Karantina Ikan Pengendalian Mutu dan Keamanan Hasil Perikanan (Undated). Kura Kura Belawa, Fauna Khas Cirebon Yang Terancam Punah: Laboratorium Stasiun Karantina Ikan Kelas II Cirebon Mendektesi adanya Bakteri Edwardsiella tarda HPIK golongan II. Download at http://www.bkipm.kkp.go.id/ new_puskari/detil_kegiatan.php?id=139 on 8 January 2012. CITES (2004). Amendments to Appendix I and II of CITES. Thirteenth Meeting of the Conference of the Parties. Bangkok (Thailand), 2-14 October 2004. Eisemberg, C.C. (2010). Nesting ecology, harvest and conservation of the Pig-nosed turtle (Carettochelys insculpta) in The Kikori Region, Papua New Guinea. Australia [PhD thesis] University of Canberra. Ginting, S.M. (2012). Tata niaga, parameter demografi populasi panenan dan karakteristik habitat labi-labi Amyda cartilaginea (Boddaert 1770) di Provinsi Jambi [MS Thesis]. Program Pascasarjana, Institut Pertanian Bogor. Haryadi, R. and W.W. Pamungkas (2010). Akhir tragis si bulat dan si dekok. Majalah Gatra Nomor 22, Kamis 8 April 2010. Download at http://arsip.gatra.com/201004-17/versi_cetak.php?id=136834 pn on 8 Januaray 2012.

Iskandar, D.T. (2000). Turtles and crocodiles of Indonesia and Papua New Guinea with notes on other species in Southeast Asia. PAL Media Citra. Bandung. Jensen, K.A. and I. Das (2008). Dietary observations on the Asian softshell turtle (Amyda cartilaginea) from Sarawak, Malaysian Borneo. Chelonian Conservation and Biology 7(1): 136–141. Koch, A., Ives, I., Arida, E. and D.T. Iskandar (2008). On the occurrence of the Asiatic softshell turtle, Amyda cartilaginea (Boddaert, 1770), on Sulawesi, Indonesia. Hamadryad 33: 121 – 127. Komite Nasional Pengelolaan Ekosistem Lahan Basah (2004) Strategi Nasional dan Rencana Aksi Pengelolaan Lahan Basah Indonesia. Kementerian Lingkungan Hidup. Jakarta. Kusrini, M.D., Wardiatno, Y., Mashar, A. and N. Widagti (2007). Kura - kura Belawa (Amyda cartilaginea Boddaert 1770). Technical Report submitted to Dinas Perikanan Provinsi Jawa Barat. Institut Pertanian Bogor. Kusrini, M.D., Mardiastuti, A., Darmawan, B., Mediyansyah and A. Muin (2009). Survey on harvest and trade of Asiatic softshell turtle Amyda cartilagenea in East Kalimantan, Indonesia. Nata Samastha Foundation. Bogor. Kusdinar, A., Priyono, A. and M.D. Kusrini (1999). Kajian aspek bioekologi dan konservasi kura-kura Belawa (Amyda cartilaginea). Dalam Prosiding Seminar Nasional Konservasi Keanekaragaman Amfibi dan Reptilia di Indonesia. Pusat Antar Universitas Ilmu Hayat – Institut pertanian Bogor bekerjasama dengan Pusat Penelitian dan Pengembangan Biologi – Lembaga Ilmu Pengetahuan Indonesia. Bogor.

Haitao, S., Parham, J.F., Zhiyong, F., Meiling, H. and Y. Feng (2008). Evidence for the massive scale of turtle farming in china. Oryx 42(1): 147-150.

Lim, B.L. and I. Das (1999). Turtles of Borneo and Peninsular Malaysia. Natural History Publications, Borneo.

[ID CITES MA] Indonesia Cites Management Authority (2008). Harvest sustainability of Asiatic softshell turtle Amyda cartilaginea in Indonesia. Director General of Forest Protection and Nature Conservation, Republic of Indonesia. Jakarta.

Lilly, L. (2010). Studi karakteristik populasi LabiLabi (Amyda cartilaginea) panenan di Sambas dan Ketapang Kalimantan Barat. [Thesis] Program Studi Konservasi Keanekaragaman Hayati, Institut Pertanian Bogor. Bogor.

2014 Journal of Indonesian Natural History Vol 2 No 1

33

Mirza et al.

Mumpuni and A. Riyanto (2010). Harvest, population and natural history of Soft-shelled turtle (Amyda cartilaginea) in South Sumatera, Jambi and Riau provinces, Indonesia: A report submitted to APEKLI. Cibinong.

Setyobudiandi, I. and Zairion (1997). Studi habitat dan distribusi penyu air tawar Amyda cartilaginea di Kabupaten Bogor. Lembaga Penelitian dan Pengabdian kepada Masyarakat. Institut Pertanian Bogor. [Abstract only].

Mumpuni, Mulyadi, Suharto, S., Adrinaldi and M.S. Nur (2011). Asiatic soft-shell turtle (Amyda cartilaginea) population survey for sustainable harvest in West Sumatera, Indonesia: A report submitted to CITES Secretariat. CITES Scientific and Management Authority of The Republic of Indonesia. Jakarta.

Sudiana, R., Taruni, P.S., Farajallah, A. (2000). Cacing parasit pada labi-labi (Dogania subplana dan Amyda cartilaginea) di Bogor. Paper presented at Seminar Nasional Aplikasi Biologi dalam Peningkatan Kesejahteraan Manusia dan Kualitas Lingkungan. Fakultas Biologi, Universitas Gadjah Mada, 22 September 2000. Yogyakarta. [Abstract only].

Oktaviani, D. (2007). Kajian habitat, biologi, dan perdagangan labi-labi (famili: Trionychidae) di Sumatera Selatan dan implikasinya terhadap konservasi labi-labi di masa datang. [MS Thesis]. Program Studi Biologi, Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Indonesia. Jakarta.

Sunyoto (2012). Konservasi labi-labi Amyda cartilaginea (Boddaert, 1770) di Desa Belawa, Kecamatan Lemah Abang, Kabupaten Cirebon, Provinsi Jawa Barat. [MS Thesis]. Sekolah Pasca Sarjana. Institut Pertanian Bogor.

Platt, S.G., Sovannara, H., Kheng, L., Holloway, R., Stuart, B.L., T.R. Rainwater (2008). Biodiversity, exploitation, and conservation of turtles in the Tonle Sap Biosphere Reserve, Cambodia, with notes on reproductive ecology of Malayemys subtrijuga. Chelonian Conservation and Biology 7(2):195–204.

Susanti, F.N. (2013). Pemeliharaan labi-labi (Amyda cartilaginea Boddaert, 1770) dan uji coba preferensi pakan anakan di penangkaran PT. Ekanindya Karsa, Kabupaten Serang. [Skripsi] Fakultas Kehutanan. Institut Pertanian Bogor.

Plummer, M.V., Krementz, D.G., Powell, L.A. and N.E. Mills (2008). Effects of habitat disturbance on survival rates of softshell turtles (Apalone spinifera) in an urban stream. Journal of Herpetology 42: 555–563.

Walter, O. (2000). A study of hunting and trade of freshwater turtles and tortoises at Danau Sentarum. Borneo Research Bulletin. Retrieved on 13 Apr, 2009 from http://findarticles.com/p/articles/mi_hb036/ is_2000_Annual/ai_n28816646/

Pritchard, P.C.H. (1979). Encyclopedia of turtle. T. F. H. Publication, Neptune N. J. Samedi , Iskandar DT (2000). Freshwater turtle and tortoise conservation utilization in Indonesia. Chelonian Research Monographs 2:106-111.

34

Willson, J.D., Winne, C.T. and M.B. Keck (2008). Empirical tests of biased body size distributions in aquatic snake captures. Copeia 2008: 401–408.

© University of Andalas / Copenhagen Zoo

Short communications

Aromatic Plants in Bali Botanic Garden Indonesia Wawan Sujarwo1,2 and Ida Bagus Ketut Arinasa1 Bali Botanic Garden - Indonesian Institute of Sciences (LIPI), Candikuning, Baturiti, Tabanan, Bali, Indonesia. Department of Science, University Roma Tre, Viale G. Marconi 446, Rome, Italy.

1 2

Corresponding author: Wawan Sujarwo, Email: [email protected]; [email protected]

Introduction

for preserving their habitat and monitoring the effect of rehabilitative efforts. Further, aromatic plants have considerable potential both in national and international market. Indonesia could increase its contribution to meet the growing demand by supplying high quality aromatic plant and its products. It contribute significantly to the nation’s foreign earnings and strengthen the economy of the country. There remain tremendous possibilities for increasing the production and trade of aromatic plant, both for internal consumption and export, but it calls for an integrated and continuous effort in conservation, sustainable utilization, cultivation, maintenance and production of aromatic plant resources. Currently, Indonesia has not yet initiated any in-situ and ex-situ conservation efforts of aromatic plants. Bali Botanic Garden (BBG) has become one of the conservation centers in Indonesia. The BBG is situated in the mountain tourist resort, Bedugul. It is situated on the east slope of Bukit Tapak Hill, at an elevation of 1,250-1,400 m above sea-level, adjacent to the Batukahu Nature Reserve (15,390 ha). The total area of the BBG measures 157.5 ha (Sumantera, 1993). By December 2013 BBG boasted 2693 species in its collection, consisting of 405 families, 1326 genera and including 336 species of medicinal plant and 216 species of ceremonial flora (Bali Botanic Garden, 2014). The collection and recording of a comprehensive aromatic plants list is important for the categorizing and understanding of the aromatic qualities of these plants that are freely available to interested users. This study provides an overview and discussion of aromatic plants collected by BBG.

Aromatic plants have a pleasant, characteristic fragrant smell. The fragrance of these plants is carried in the essential oil fraction. Many aromatic plants are condiment (Okigbo et al., 2009). Chandarana et al. (2005) defined spices as any dried, fragrant, aromatic or pungent vegetables or plant substances in whole, broken or in ground forms that contributes relish or piquancy of foods and beverages. Moreover, aromatherapy is a form of alternative medicine in which healing effects are ascribed to the aromatic compounds in essential oils and other plant extracts (Prabuseenivasan et al., 2006). Aromatic plants are also used for preservation of food and for adding pleasant and exotic flavours, fragrance, color and even texture. Indonesia - due to its wide range of geographical, ecological and biological diversities - possesses many species that are directly or indirectly used as sources of herbal, allopathic or homeopathic medicines and aromatic. However, many of these plant species are facing threats of extinction due to over and improper exploitation, habitat loss, fragmentation and degradation of land, urbanization pressure and our ignorance about them. On the other hand, the increasing global demand for aromatic and products warrants accelerated cultivation, marketing and conservation of aromatic plants. Hence, the scientific study of aromatic, derivation of essential oil through bioprospecting and systematic conservation of the concerned aromatic plants are of great importance. The major drawback in this area is scarcity of comprehensive and authoritative information on aromatic plants, which hinders an assessment of their status of availability, implementation activities necessary

Methods

Received 28th March 2014; Revision accepted 12th August, 2014

Literature on Java and Bali Flora published since 1963 was consulted for information about aromatic

2014 Journal of Indonesian Natural History Vol 2 No 1

35

Sujarwo and Arinasa

plants. This included several books (e.g., Backer and Van Den Brink 1963, 1965, 1968; Ochse and Van Den Brink, 1977; Van Steenis, 1997; Tengah et al., 1995; Lugrayasa et al., 2009). Information about species and the properties attributed to each plant, the plant part, life form, habitat and propagation technique was compiled (Tab. 1). The information also included plants used as condiments, but excluding beverages such as liqueurs and herbal teas. Scientific nomenclature was updated using databases (The Plant list, 2013). In order to extract information about the bioactive compounds for each plant, we conducted a search in recent international scientific literature, using scientific names to identify and review specific families (e.g., Chauhan, 1999).

Lontar Usada almost 500 different species are described for its aromatic and medicinal properties (Adiputra, 2013; Sutomo, 2007). Leaves are the most cited parts of plants used for aromatic properties and condiments. Of the 66 plants identified in this study, leaves of 31 species, flowers of 16 species, stems, rhizomes, seeds, and roots of 4 species, gum or barks of 2 species, and rind of 1 species were used for aromatic properties and condiment (Fig. 2). A total of 66 species was distributed into different groups with trees (53%) being the most common, followed by herbs (24%), shrubs (17%), and woody climber (6%) (Fig. 3).

Results and Discussion Plants of Cupressaceae and Rutaceae are important botanical resources of aromatic properties. This study classified 66 taxa of ethno flora, 56 with aromatic properties and 8 with condiment properties. The 66 species belonged to 50 genera in 31 families. The five most frequently used families are illustrated in Figure 1. All 66 species (100%) identified in this study are also documented in the “Lontar Usada Bali”, ancient Balinese scripts that are written on palm leaves and describes forms of healing, medicinal ingredients and methods in traditional Balinese medicine (Sutomo, 2007; Tengah et al., 1995). In the traditional Balinese

Figure 2. The frequency of use of different aromatic plants divided into parts of the plant.

Figure 1. The frequency of use of different aromatic plants divided into families.

Figure 3. The distribution of aromatic plant taxa arranged by life forms.

36

© University of Andalas / Copenhagen Zoo

Aromatic plants in Bali Botanic Garden

Table 1 presents a comprehensive summary of plants with aromatic and condiment uses described in at least five books (Backer and Van Den Brink, 1963, 1965, 1968; Ochse and Van Den Brink, 1977; Van Steenis, 1997; Tengah et al., 1995; Lugrayasa et al., 2009). A few species, which are not native to tropical southeast Asia but commercialised locally are also included in this table. All of these species are recorded in Balinese traditional medicine literature as plants with medicinal properties. Usages and dosages differs if they are used for medicinal purposes under the guidance of Balinese traditional medicine theory. General properties of relevant plant families The use of traditional Balinese medical treatment can be traced back for centuries, and there is little doubt that guidance described in “Lontar Usada Bali” result in positive effects. This does not mean, however, that each guidance and treatment method has been tested in a systematic scientific manner and the following descriptions of the properties and use of various plants reflects only traditional use and beliefs of many Balinese citizens. Cupressaceae Species belonging to this family have perfect expectorant qualities that is believed to produce a very effective treatment for a number of respiratory ailments such as coughs and bronchitis. Inhaling the aromatic vapour of these plants is supposed to speed up the healing process of ulcers and other wounds. They are also known to minimize the appearance of any form of cellulite, combat insomnia, stress and nervous tension (Chauhan, 1999). Rutaceae These plants are used primarily for pain relief and for the improvement of blood circulation. They contain properties believed to cure acne and contain essential oils that reduce chances of cholesterol related ailments (Chauhan, 1999). Lauraceae and Myrtaceae Plants such as Cinnamomum burmanni, Cinnamomum camphora, Cinnamomum verum and Massoi aromatica are used as tonic, stimulant, bactericide, antiviral and antifungal. They are known to alleviate complications in the respiratory tract and the respiratory system at large (Chauhan, 1999).

2014 Journal of Indonesian Natural History Vol 2 No 1

Lamiaceae This group of plants is used in aromatherapy, because they possess chemical components in their leaves that provide aromatherapy properties (Chauhan, 1999). The therapeutic properties of these plants are used to cure headaches, provide relief in case of nasal congestion and suppress any muscular pain.

Conclusion This study constitutes one of few ethno-botanical reviews of aromatic plants used on Bali. Results can be used to check the authenticity and origin of aromatic plants on Bali. It listed 66 aromatic plant species belonging to 50 genera in 31 families that were used in traditional Balinese medicine and aromatherapy. Since many are believed to have beneficial effects on health these plants may be offer good potential for commercialization. Therefore, more resources should be allocated to search for new aromatic products from plants, especially in plants indigenous to the tropical countries.

Acknowledgement The authors wish to thank all the colleagues who contributed to this study with their knowledge and friendship. We also thank anonymous reviewers for constructive comments to improve the manuscript.

References Adiputra, I.G.K (2013). Tinjauan taksonomi dan metabolit sekunder coumarins pada tanaman usada Bali. Widaya biologi 4(2): 10-21. Backer, T.C.A. & Van Den Brink, R.C. (1963). Flora of Java Vol I. Wolters Noordhoff N.V, Groningen, The Netherlands. Backer, T.C.A. & Van Den Brink, R.C. (1965). Flora of Java Vol II. Wolters Noordhoff N.V, Groningen, The Netherlands. Backer, T.C.A. & Van Den Brink, R.C. (1968). Flora of Java Vol III. Wolters Noordhoff N.V, Groningen, The Netherlands.

37

Sujarwo and Arinasa

Bali Botanic Garden (2013). Updated Collection Number: February 2014. Bali Botanic Garden.

Sumantera, W. (1993). Bali’s Botanic Garden, Indonesia, BGC News.

Chandarana, H., Baluja, S. and S.V. Chand (2005). Comparison of Antibacterial Activities of Selected Species of Zingiberaceae Family and Some Synthetic Compounds. Turc J.Biol 29:83-97.

Sutomo (2007). Exploitation and inventory of the Usada Bali medicinal plants in some areas of Buleleng district, Bali. In: Seminar Konservasi Tumbuhan Usada Bali dan Peranannya dalam Mendukung Ekowisata (eds M. Siregar, H.M. Siregar, I. B. K. Arinasa and W. S. Lestari), 2007; pp. 92-7. UPT Balai Konservasi Tumbuhan Kebun Raya “Eka Karya” Bali Lembaga Ilmu Pengetahuan Indonesia, Kebun Raya Bali.

Chauhan, N.S. (1999). Medicinal and Aromatic Plants of Himachal Pradesh. Indus Publishing Company, New Delhi. Lugrayasa, I.N., Warnata, I.W. and I.B.K. Arinasa (2009). An Alphabetical List of Plant Species Cultivated in Eka Karya Bali Botanic Garden Catalogue. LIPI Press, Jakarta. Ochse, J.J. & Van Den Brink, R.C. (1977). Vegetables of the Dutch East Indies. A.Asher & Co. B.V, Amsterdam, The Netherlands. Okigbo, R.N., Anuagasi, C.L. and J.E. Amadi (2009). Advances in Selected Medicinal and Aromatic Plants Indigenous to Africa. Journal of Medicinal Plants Research 3: 86-95.

Tengah, I.G.P., Arka, I.W., Sritamin, N.M., Gotama, I.B.K. and H. Sihombing (1995). Studi Tentang: Inventarisasi, Determinasi dan Cara Penggunaan Tanaman Obat Pada “Lontar Usada” di Bali. Puslitbang Farmasi Balitbang Kesehatan Departemen Kesehatan RI, Jakarta. The Plantlist (2013). The Plantlist Database. Http:// www.theplantlist.org [accessed 1 February 2014]. Van Steenis, C.G.G.J. (2007). Flora Pegunungan Jawa. Pusat Penelitian Biologi LIPI, Cibinong, Jawa Barat.

Prabuseenivasan, S., Jayakumar, M. and S. Ignacimuthu (2006). In Vitro Antibacterial Activity of Some Plant Essential Oils. BMC Complement Altern Med 6:39.

Table 1. Aromatic and condiment Plants currently found in Bali Botanic Garden along with descriptions of its basic use. Scientific name, botanical family

Local names

Part(s) used

Use

Life form

Habitat

Gandapura

Seed

Aromatic

Shrub

Full sun

Seed

Acorus calamus L. (Acoraceae)

Jangu

Rhizome

Condiment

Herb

Semi shade

Rhizome

Acronychia trifoliata Zoll. (Rutaceae)

Empag

Leaf

Aromatic

Tree

Full sun

Seed

Agathis dammara (Lamb.) L. C. Rich (Araucariaceae)

Agatis

Gum

Aromatic

Tree

Full sun

Seed

Abelmoschus moschatus Medik. (Malvaceae)

Propagation

Alyxia reinwardtii Bl. (Apocynaceae)

Pulesari

Stem

Aromatic

Woody climber

Semi shade

Seed

Amomum cardamomum L. (Zingiberaceae)

Kapulago

Rhizome

Aromatic

Herb

Semi shade

Rhizome

Aquilaria malacensis Lam. (Thymelaeaceae) Artemisia vulgaris L. (Asteraceae) Bixa orellana L. (Bixaceae) Boenninghausenia albiflora (Hook) Rchb. ex Meissn. (Rutaceae) Brunfelsia uniflora (Pohl.) D. Don. (Solanaceae) Camellia sinensis (L.) O. K. (Theaceae) Cananga odorata (Lmk) Hook. F. & Thoms. (Annonaceae) Cestrum nocturnum L. (Solanaceae)

38

Garu

Gum

Aromatic

Tree

Semi shade

Seed

Daun sudamala

Root

Aromatic

Herb

Full sun

Stolon

Kesumba

Leaf, root, seed

Aromatic

Shrub

Full sun

Seed

Inggu gunung

Leaf

Aromatic

Herb

Semi shade

Seed

Kembang pagi sore

Flower

Aromatic

Shrub

Full sun

Seed

Teh

Flower

Aromatic

Shrub

Full sun

Seed

Cananga

Flower

Aromatic

Tree

Full sun

Seed

Sedap malam

Flower

Aromatic

Shrub

Full sun

Seed

© University of Andalas / Copenhagen Zoo

Aromatic plants in Bali Botanic Garden Chamaecyparis lawsoniana (A. Murr.) Parl. (Cupressaceae)

Keires

Leaf

Aromatic

Tree

Full sun

Seed

Chamaecyparis obtusa (Sieb. & Zucc.) Endl. (Cupressaceae)

Cemara kipas

Leaf

Aromatic

Tree

Full sun

Seed

Chamaecyparis thyoides (Britton.) Stem & Poggenb (Cupressaceae)

Seed

Cemara kipas

Leaf

Aromatic

Tree

Full sun

Cinnamomum burmanni Nees ex Bl. (Lauraceae)

Kayu manis

Bark

Condiment

Tree

Full sun

Seed

Cinnamomum camphora (L.) Presl. (Lauraceae)

Kamper

Bark

Aromatic

Tree

Full sun

Seed

Sintok

Leaf

Aromatic

Tree

Full sun

Seed

Cinnamomum verum J.S. Presl. (Lauraceae)

Cinnamomum sintoc Bl. (Lauraceae)

Sintok lue

Leaf

Aromatic

Tree

Full sun

Seed

Citrus aurantifolia (Christm. & Panz.) Swingle (Rutaceae)

Jeruk nipis

Fruit

Condiment

Shrub

Full sun

Seed

Citrus grandis (L.) Osbeck (Rutaceae)

Jeruk Bali

Rind

Aromatic

Tree

Full sun

Seed

Jeruk purut

Fruit

Condiment

Shrub

Full sun

Seed

Cleome gynandra L. (Capparaceae)

Boangit

Leaf, flower

Aromatic

Herb

Full sun

Seed

Coleus atropurpureus Bth. (Lamiaceae)

Miana

Leaf

Aromatic

Herb

Full sun

Cutting

Kenikir

Leaf

Aromatic

Herb

Full sun

Seed

Cemara lilin

Leaf

Aromatic

Tree

Full sun

Seed

Citrus hystrix DC. (Rutaceae)

Cosmos caudatus H.B.K. (Asteraceae) Cupressus benthamii Endl. (Cupressaceae)

Cemara kipas

Leaf

Aromatic

Tree

Full sun

Seed

Cymbopogon citratus (DC.) Stapf. (Poaceae)

Cupressus chasmeriana Royle ex Carriere (Cupressaceae)

See

Leaf

Condiment

Herb

Full sun

Stolon

Cymbopogon winterianus Jowitt (Poaceae)

See wangi

Leaf

Aromatic

Herb

Full sun

Stolon

Dysoxylum caulostachyum Miq. (Meliaceae)

Majagau

Stem

Aromatic

Tree

Full sun

Seed

Eucalyptus alba Reinw. ex. Bl. (Myrtaceae)

Ampupu

Leaf

Aromatic

Tree

Full sun

Seed

Eucalyptus deglupta Bl. (Myrtaceae)

Leda

Leaf

Aromatic

Tree

Full sun

Seed

Eucalyptus urophylla S.T. Blake (Myrtaceae)

Huek

Leaf

Aromatic

Tree

Full sun

Seed

Foeniculum vulgare Mill. (Apiaceae)

Adas

Leaf

Aromatic

Herb

Full sun

Seed

Gardenia jasminoides Ellis (Rubiaceae)

Jempiring

Flower

Aromatic

Shrub

Full sun

Cutting

Jasminum sambac (L.) W.Ait. (Oleaceae)

Menuh

Flower

Aromatic

Woody climber

Semi shade

Cutting

Juniperus procera Hochst. ex Endl. (Cupressaceae)

Cemara natal

Leaf

Aromatic

Tree

Full sun

Seed

Leptospermum amboinense Bl. (Myrtaceae)

Mica bolong

Leaf

Aromatic

Tree

Full sun

Seed

Libocedrus formosana Florin (Cupressaceae)

Kipres pormosa

Leaf

Aromatic

Tree

Full sun

Seed

Tahlan

Stem

Aromatic

Tree

Full sun

Seed

Mesui

Stem

Aromatic

Tree

Full sun

Seed

Kayu putih

Leaf

Aromatic

Tree

Full sun

Seed

Lophopetalum javanicum (Zoll.) Turcz. (Celastraceae) Massoi aromatica Becc. (Lauraceae) Melaleuca leucadendra (L.) L. (Myrtaceae)

Poo

Leaf

Aromatic

Herb

Full sun

Stolon

Mesua ferrea L. (Clusiaceae)

Mentha arvensis L. (Lamiaceae)

Nagasari

Seed

Aromatic

Tree

Full sun

Seed

Michelia champaca L. (Magnoliaceae)

Cempaka

Flower

Aromatic

Tree

Full sun

Seed

Michelia montana Bl. (Magnoliaceae)

Kayu base

Flower

Aromatic

Tree

Full sun

Seed

Tanjung

Flower

Aromatic

Tree

Full sun

Seed

Kelor

Root, leaf

Aromatic

Tree

Full sun

Seed

Murraya paniculata (L.) Jack. (Rutaceae)

Kemuning

Flower

Aromatic

Tree

Full sun

Seed

Ocimum basilicum L. (Lamiaceae)

Kencarum

Flower

Aromatic

Herb

Full sun

Seed

Orthosiphon aristatus (Bl.) Miq. (Lamiaceae)

Kumis kucing

Flower

Aromatic

Herb

Full sun

Seed

Pandanus amaryllifolius Roxb. (Pandanaceae)

Pandan arum

Leaf

Aromatic

Shrub

Semi shade

Stolon

Pudak

Flower

Aromatic

Shrub

Semi shade

Stolon

Mimosops elengi L. (Sapotaceae) Moringa pterygosperma Gaertn. (Moringaceae)

Pandanus inermis Reinw. (Pandanaceae) Piper cubeba L.f. (Piperaceae)

Kemukus

Leaf

Aromatic

Woody climber

Semi shade

Cutting

Piper nigrum L. (Piperaceae)

Merica

Seed

Condiment

Woody climber

Semi shade

Seed

Belalang puak

Root

Aromatic

Tree

Full sun

Seed

Pogostemon cablin Bth. (Lamiaceae)

Dondelem

Leaf

Aromatic

Herb

Full sun

Cutting

Protium javanicum Burm. f. (Burseraceae)

Tenggulun

Leaf

Condiment

Tree

Full sun

Seed Seed

Pittosporum ferrugineum W. Ait. (Pittoporaceae)

Schima wallichii (DC.) Korth (Theaceae)

Puspa

Flower

Aromatic

Tree

Full sun

Talauma candollii Bl. (Magnoliaceae)

Cempaka gondok

Flower

Aromatic

Shrub

Semi shade

Seed

Thuja occidentalis L. (Cupressaceae)

Cemara kipas

Leaf

Aromatic

Tree

Full sun

Seed

Thuja orientalis L. (Cupressaceae)

Cemara kipas

Leaf

Aromatic

Tree

Full sun

Seed

Bangle

Rhizome

Aromatic

Herb

Semi shade

Rhizome

Jahe

Rhizome

Condiment

Herb

Semi shade

Rhizome

Zingiber casummunar Roxb. (Zingiberaceae) Zingiber officinale Roxb. (Zingiberaceae)

2014 Journal of Indonesian Natural History Vol 2 No 1

39

Not just mangroves: range expansion required for the mangrove whistler (Pachycephala grisola) on Borneo Marc L. Dragiewicz1, David A. Ehlers Smith1,2 and Mark E. Harrison1,2,3 Orangutan Tropical Peatland Project (OuTrop), Jl. Semeru 91, Palangka Raya, Central Kalimantan, Indonesia Centre for International Cooperation in the Management of Tropical Peatlands (CIMTROP), University of Palangka Raya, Indonesia 3 Department of Geography, University of Leicester. Leicester LE1 7RH, United Kingdom. 1 2

Corresponding author: David A. Ehlers Smith, Email: [email protected]

Introduction The mangrove whistler Pachycephala grisola (referred to as P. cinera by some authors) is considered a common inhabitant of coastal forest < 200 m above sea level throughout its range in South and South-East Asia (Del Hoyo et al. 2007; MacKinnon & Phillipps 1993; Myers 2009). Its range spans from India to the island of New Guinea, though it does inhabit forest in land-locked Laos (ibid). On Borneo, both Birdlife International (2013) and recent field guides illustrate its distribution as a ring circling the coastal regions of the island, implying that mangrove forest is the species’ preferred habitat (Myers 2009; Phillipps & Phillipps 2009). Myers (2009) and Birdlife International (2013) also list sub-tropical/tropical moist lowland forest (including heath and peat-swamp forest), sub-tropical/tropical moist montane forest as “suitable” habitats, and rural gardens and plantations as “marginal” habitats used by this species, however, suggesting that these distribution maps may be in need of updating. Indeed, it is curious that the Birdlife International map only illustrates the species distribution as coastal, given these habitat suitability descriptions on its website.

Methods We studied avifauna in Central Kalimantan, Indonesian Borneo over eight months spanning two dry seasons (July-Aug 2005, 2007) in the Natural Laboratory of Peat-Swamp Forest, Sabangau (2o19’ S, 113o54’ E); Received 12th March, 2014; Revision accepted 23rd April, 2014

40

one month during the wet season (February 2010) in the Mentaya-Katingan peat-swamp forest (2o25’ S, 113o07’ E); one month during the wet season (January 2010) in the Mungku Baru ironwood Eusideroxylon zwageri / heath forest (1o30’ S, 113o44’19 E); one week during the dry season (July 2010) in the Bawan heath / peat-swamp forest (1o36’ S, 113o59’ E); and two weeks in the dry season (August 2011) in Kalampangan peatswamp forest, Block C of the ex-Mega Rice Project area (2o20’ S, 114o02’ E; Figure 1). These sites are all part of larger contiguous lowland (≤ 55 masl) forest blocks, located approximately 100, 60 and 175 km, respectively, from the nearest coastline. All peat-swamp forest areas studied had been heavily logged, while the Mungku Baru heath forest site remains unlogged. The Kalampangan forest is highly degraded, as a result of severe drainage during the ex-Mega Rice Project, and much of the original heath forest in Bawan has been logged. We surveyed the avifauna using a combination of forest walks, formal line transects and point counts between 05:00 and 11:30 (Lambert 1992; Bibby et al. 2000).

Results Mangrove whistlers were seen at all five sites surveyed (see Figure 1). It is one of the most abundant birds in Sabangau and is one of the few birds that can be heard throughout the day at all study locations. We recorded the species occasionally foraging in mixed-species flocks with several babblers (Timaliidae spp.), hookbilled bulbuls (Setornis criniger), grey-chested jungle flycatchers (Rhinomyias umbratilis) and white-tailed

© University of Andalas / Copenhagen Zoo

Dragiewicz et al.

Figure 1. Location of study sites and sightings of mangrove whistlers in Central Kalimantan, Indonesia. Grey shading indicates range illustrated in current ornithological guidebooks for the region (Myers 2009; Phillipps & Phillipps 2009) and by Birdlife International (2013).

shamas (Copsychus malaaricus). It has also been seen feeding at swarms of Leptogenys sp. army ants, where it joins mixed flocks of understory Timaliidae babblers, the grey-chested jungle-flycatcher and hook-billed bulbul, sallying for flying insects flushed by the ants. While this behavior is well documented in Latin America and Africa, it has not previously been described in Asian birds. In the Mentaya-Katingan peat swamps, mangrove whistlers were seen on the River Tarantang, a tributary of the River Mentaya, and on the River Perigi, a tributary of the River Katingan. Over a five-day period at Mungku Baru, at least one individual was encountered daily near camp in alluvial forest alongside the River Rakumpit and, two others were seen in the heath forest. The species was regularly encountered (> 3 individuals per survey day) in Kalampangan and Bawan and forests.

Discussion These observations confirm the presence of the mangrove whistler outside of the coastal mangrove

2014 Journal of Indonesian Natural History Vol 2 No 1

belt described in the Birdlife International (2013) factsheet and contemporary field guides (Myers 2010; Phillipps & Phillipps 2009), including areas of Bornean peat-swamp and ironwood / heath forest up to 175 km from the nearest coastline. This indicates that current distribution maps for this species on Borneo require revision and, combined with observations of this species’ occurrence in areas of Laos > 200 km inland (Round 1988), suggests that the species may not be as restricted to coastal distribution as previously indicated (although some inland surveys have failed to detect the species in other parts of Kalimantan, e.g. Woxyold & Noske 2011). It is possible that the ongoing anthropogenic destruction of natural habitats on Borneo (Curran et al., 2004; Miettinen et al., 2011) is forcing avian species to expand outside of their natural range; however, the frequency with which the species was recorded at the study sites indicating that these habitats outside of this coastal range are in fact suitable for supporting populations. Additionally, the majority of sites surveyed here are themselves degraded, suggesting that the birds’ presence may not be due to avoidance of habitat disturbance.

41

Range expansion of mangrove whistler

These records are pertinent for conservation planning, as accurate distribution maps are a vital component of assessing a species threat status and developing appropriate species management. The absence of previous inland records in Borneo may be as a result of the scarcity in ornithological surveys conducted in Kalimantan outside of Barito or Tanjung Puting, especially in peat-swamp forest. This observation highlights the need for more extensive ornithological work at sites in Kalimantan.

Acknowledgements We thank the Centre for International Cooperation in Sustainable Management of Tropical Peatlands (CIMTROP) and the Indonesian Ministry of Science and Technology (RISTEK) for research permissions. Nicholas Boyd contributed the record for Kalampangan. Funding for research in Sabangau was provided by the US Fish and Wildlife Service Great Apes Conservation Fund, Wallace Foundation and Arcus Foundation. This work was conducted as part of the OuTrop-CIMTROP multidisciplinary research project in Sabangau, Kalampangan and Bawan; with Starling Resources and PT. Rimba Makmur Utama in the MentayaKatingan peat swamps; and with International Animal Rescue-Indonesia in Mungku Baru. We thank Hendri and all other research assistants for help and support in the field, and Simon Husson for comments on that helped improve the manuscript, and much support and encouragement over the years. Finally thanks to Fransiskus Agus Harsanto for Indonesian translations.

References

Birdlife International. (2013). Mangrove whistler Pachycephala grisola. http://www.birdlife.org/datazone/ speciesfactsheet.php?id=5639&m=0. Accessed 2nd November 2013. Del Hoyo, J. Elliott, A.D. and D. Christie (2007). Handbook of the Birds of the World. Volume 12: Picathartes to Tits and Chickadees. Lynx Edicions, Barcelona, Spain. Lambert, F.R. (1992). The consequences of selective logging for Bornean lowland forest birds. Philosophical Transactions of the Royal Society of London B 355: 443-57. MacKinnon, J. and K. Phillipps (1993). A Field Guide to the Birds of Borneo, Sumatra, Java, and Bali: The Greater Sunda Islands. Oxford University Press, Oxford, UK. Myers, S. (2009). Birds of Borneo: Brunei, Sabah, Sarawak, and Kalimantan. Princetown University Press, Princetown, USA. Phillipps, Q., Phillipps, K. (2009). Phillipps' Field Guide to the Birds of Borneo: Sabah, Sarawak, Brunei and Kalimantan. John Beaufoy Books, Oxford, UK. Round, P.D. (1988). Resident Forest Birds in Thailand: Their Status and Conservation. International Council for Bird Preservation, Cambridge, UK. Woxvold, I., Noske, R. A. (2011) The avifauna of kerangas, mixed dipterocarp and riparian forests in Central-East Kalimantan, Indonesia, and its conservation significance. Forktail 27: 44-59.

Bibby, C.J., Burgess, N.D., Hill, D.A. and S.H. Mustoe (2000). Bird Census Techniques: Second Edition. Academic Press, London, UK.

42

© University of Andalas / Copenhagen Zoo

First breeding record evidence of Hooded Pitta Pitta Sordida in mainland Sumatra, Indonesia Muhammad Iqbal, Ahmad Ridwan and Fadly Takari Daemeter Consulting. Jalan Tangkuban Perahu No.6, Taman Kencana, West Java 16151, Indonesia KPB-SOS, Jalan Tanjung api-api km 9 Komplek P and K Blok E 1, Palembang 30152, Indonesia.

1 2

Corresponding Author: Muhammad Iqbal, email: [email protected]

Introduction Hooded Pitta, Pitta sordida, range from the North Indian subcontinent, Nicobar Island, Southwest China, Greater Sundas, Philippines, Sulawesi and New Guinea region (Robson, 2011). It is reported to occupy a wide range of habitat, from all types of forest to overgrown rubber and coffee plantations (Erritzoe, 2003). Therefore, it is listed as “Least Concern” in on the IUCN red-list (IUCN, 2012) despite experiencing population decline in Thai-Malay Peninsula. In Greater Sundas, P. s. cucullata overwinters in the Malay Peninsula, Sumatra (including Nias, Islands in Malaca Straits and Bangka) and Java; and P. s. mulleri is resident on Borneo and Java (MacKinnon and Phillipps, 1993). The movement pattern of P. s. mulleri on Borneo is poorly understood and is further obscured by the possible winter visitor P. s. cucullata from northern Southeast Asia (Smythies, 1981; Mann, 2008). In Sumatra, Hooded Pitta is recorded throughout the mainland, but very little is known about its ecology and phylogenic history (Marle and Voous, 1988). The intermediate subspecies P. s. bangkana is found in Bangka and Belitung Island, southeast of Sumatra (Dickinson and Decker, 2000; Mees, 1986). Hooded Pitta is believed to be resident (P. s. mulleri on mainland; P. s. bangkana endemic on Bangka and Belitung) and winter visitor (P. s. cucullata) from mainland Southeast Asia (Marle and Voous, 1988). The endemic subspecies (P. s. bangkana) was recorded to breed in Belitung island west of Sumatra, because eggs were collected in March, April and May (Chasen, 1937; Marle and Voous, 1988). No breeding evidence was recorded for Hooded Pitta on the Sumatran Received 28th March, 2014; Revision accepted 30th August, 2014

2014 Journal of Indonesian Natural History Vol 2 No 1

mainland (Holmes, 1996; Marle and Voous, 1988; Balen et al., 2011; Balen et al., 2013). “Breeding” is defined as a record of nest-building, nests, eggs, fledging or young being fed (Davison, 1988). To our knowledge, this paper describes the first evidence that Hooded Pitta breed in mainland Sumatra.

Methods Study area The study site is located in Kuro village, Pampangan subdistrict, Ogan Komering Ilir district (3°12′S, 104°59′E), South Sumatra Province, Indonesia. The area consists of secondary forest bordering with rubber plantations from