crossmark
Kaposi’s Sarcoma-Associated Herpesvirus Inhibitor of cGAS (KicGAS), Encoded by ORF52, Is an Abundant Tegument Protein and Is Required for Production of Infectious Progeny Viruses Wenwei Li, Denis Avey, Bishi Fu, Jian-jun Wu, Siming Ma, Xia Liu,
Fanxiu Zhu
Department of Biological Science, Florida State University, Tallahassee, Florida, USA
ABSTRACT
IMPORTANCE
The tegument proteins of herpesviruses, including Kaposi’s sarcoma-associated herpesvirus (KSHV), play key roles in the viral life cycle. Each of the three subfamilies of herpesviruses (alpha, beta, and gamma) encode unique tegument proteins with specialized functions. We recently found that one such gammaherpesvirus-specific protein, ORF52, has an important role in immune evasion during KSHV primary infection, through inhibition of the host cytosolic DNA sensing pathway. In this report, we further characterize ORF52 as a tegument protein with vital roles during KSHV lytic replication. We found that ORF52 is important for the production of infectious viral particles, likely through its role in virus assembly, a critical process for KSHV replication and pathogenesis. More comprehensive investigation of the functions of tegument proteins and their roles in viral replication may reveal novel targets for therapeutic interventions against KSHV-associated diseases.
K
aposi’s sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus 8 (HHV-8), is the etiologic agent of Kaposi’s sarcoma (KS) (1) and, also, two lymphoproliferative disorders, primary effusion lymphoma (PEL) (2) and multicentric Castleman disease (MCD) (3). KSHV belongs to the Rhadinovirus genus in the Gammaherpesvirinae subfamily and is related to rhesus rhadinovirus (RRV), herpesvirus saimiri (HVS), and murine gammaherpesvirus 68 (MHV-68). The closest relative of KSHV among the known human herpesviruses is Epstein-Barr virus (EBV), which belongs to the same subfamily (4, 5). Like all herpesviruses, KSHV has two alternative life cycles: latent and lytic. During latency, only a few viral latent genes are expressed. During the lytic replication cycle, the full complement of viral genes are expressed in a temporal cascade, beginning with immediate early (IE) genes, followed by early (E) genes, and then late (L) genes, whose expression depends on viral DNA replication. Successful completion of this lytic replication culminates in the release of progeny virions (6, 7). A typical herpesvirus virion consists of a linear doublestranded viral DNA core enclosed within an icosahedral capsid, an outer envelope with viral glycoproteins, and a tegument layer located between the capsid and envelope. Among these, the tegument is the most complex in composition and accounts for about
June 2016 Volume 90 Number 11
40% of the virion mass (8). While capsid proteins are conserved among all herpesviruses, several tegument proteins are unique to each subfamily. Regarding the functions of virion proteins, those of capsid and envelope proteins are generally better characterized than those of tegument proteins. Most of our knowledge pertaining to tegument proteins is derived from studies on alpha- and betaherpesviruses. Studies of the tegument of gammaherpesviruses, including KSHV and EBV, are lagging because they do not replicate as robustly as alpha- and betaherpesvirus in cultured cells.
Received 16 October 2015 Accepted 8 March 2016 Accepted manuscript posted online 23 March 2016 Citation Li W, Avey D, Fu B, Wu J-J, Ma S, Liu X, Zhu F. 2016. Kaposi’s sarcomaassociated herpesvirus inhibitor of cGAS (KicGAS), encoded by ORF52, is an abundant tegument protein and is required for production of infectious progeny viruses. J Virol 90:5329 –5342. doi:10.1128/JVI.02675-15. Editor: J. U. Jung Address correspondence to Fanxiu Zhu,
[email protected]. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /JVI.02675-15. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Journal of Virology
jvi.asm.org
5329
Downloaded from http://jvi.asm.org/ on April 4, 2019 by guest
Although Kaposi’s sarcoma-associated herpesvirus (KSHV) ORF52 (also known as KSHV inhibitor of cGAS [KicGAS]) has been detected in purified virions, the roles of this protein during KSHV replication have not been characterized. Using specific monoclonal antibodies, we revealed that ORF52 displays true late gene expression kinetics and confirmed its cytoplasmic localization in both transfected and KSHV-infected cells. We demonstrated that ORF52 comigrates with other known virion proteins following sucrose gradient centrifugation. We also determined that ORF52 resides inside the viral envelope and remains partially associated with capsid when extracellular virions are treated with various detergents and/or salts. There results indicate that ORF52 is a tegument protein abundantly present in extracellular virions. To characterize the roles of ORF52 in the KSHV life cycle, we engineered a recombinant KSHV ORF52-null mutant virus and found that loss of ORF52 results in reduced virion production and a further defect in infectivity. Upon analysis of the virion composition of ORF52-null viral particles, we observed a decrease in the incorporation of ORF45, as well as other tegument proteins, suggesting that ORF52 is important for the packaging of other virion proteins. In summary, our results indicate that, in addition to its immune evasion function, KSHV ORF52 is required for the optimal production of infectious virions, likely due to its roles in virion assembly as a tegument protein.
Li et al.
MATERIALS AND METHODS Cell culture and transfection. HeLa cells were cultured under 5% CO2 at 37°C in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and antibiotics. iSLK cells were cultured in DMEM containing 10% FBS, 450 g/ml G418, and 1 g/ml puromycin. Transient transfections were performed in 12-well plates with FuGENE 6 transfection reagent (Promega, Madison, WI) or in 100-mm dishes with calcium phosphate methods. Antibodies and Western blot analysis. Monoclonal antibodies against ORF52 were generated by the FSU hybridoma facility. The detailed procedures for the production of antibodies were described in our previous study (29). Antibodies against ORF26, ORF65, ORF33, ORF38, and ORF45 used in this study were described previously (15, 29, 30). Antibody against RTA was offered by Ke Lan at Institut Pasteur of Shanghai. Anti-PF8 antibody was provided by Robert Ricciardi at the University of Pennsylvania. Anti-K8.1 antibody was obtained from Bala Chandran at Rosalind Franklin University of Medicine and Science. A monoclonal antibody against -actin was purchased from Sigma. For Western blot analysis, proteins were resolved by SDS-PAGE and transferred to nitrocellulose membranes. The membranes were blocked in 5% dry milk in 1⫻ phosphate-buffered saline with 0.2% Tween 20 and then incubated with
5330
jvi.asm.org
diluted primary antibodies for 2 h at room temperature or overnight at 4°C. Anti-rabbit and anti-mouse IgG conjugated to horseradish peroxidase (Pierce) were used as the secondary antibodies. SuperSignal chemiluminescence reagents (Pierce) were used for detection. Immunofluorescence staining. Cells were cultured on coverslips in 12-well plates, fixed with 2% formaldehyde in phosphate-buffered saline (PBS) for 10 min, permeabilized with 0.2% Triton X-100 in PBS (PBST) for 20 min on ice, blocked with 3% bovine serum albumin in PBST for 30 min, and then incubated with primary antibody for 1 h. After three washes with PBST, the cells were incubated with Alexa Fluor-conjugated secondary antibodies (Invitrogen, Carlsbad, CA) for 1 h. After another three washes, the cells were counterstained with DAPI (4=,6-diamidino-2-phenylindole; Sigma, St. Louis, MO) and then mounted in antifade reagent (Invitrogen, Carlsbad, CA) and visualized with a fluorescence microscope. The plasmids carrying endomembrane gene markers were provided by David Meckes from Florida State University. The plasmids expressing TGN (catalog number 55145), ␣-tubulin (catalog number 49149), and microtubule-associated protein 4 (MAP4; catalog number 55076) were purchased from Addgene. Virus stock preparation and treatment. As previously described (15, 19), six or more T150 flasks with cells were induced for 5 days, and then the medium was collected and centrifuged to remove cell debris. Virions were pelleted at 100,000 ⫻ g for 1 h on a 25% sucrose cushion with a Beckman SW28 rotor. The virus pellets were dissolved overnight in 1/100 volume of TNE (10 mM Tris-Cl, pH 8.0, 150 mM NaCl, 1 mM EDTA) buffer and stored at ⫺80°C. For trypsin treatment, as previously described (19), purified virions were treated with trypsin (4 g/ml; Promega, Madison, WI) in 100 l of buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM CaCl2) at 37°C for 1 h. Trypsin digestions were terminated by adding phenylmethylsulfonyl fluoride (PMSF) to a concentration of 0.5 mM and 1/100 volume of protease inhibitors (Sigma). In parallel, Triton X-100 was added to a final concentration of 1% to remove the viral envelope and expose the tegumented capsid to the protease. Samples were then analyzed by Western blotting. For detergent treatment, purified virions were treated with different concentrations of detergents in TNE buffer for 30 min at 37°C. For salt treatment, virions were treated with 1% Triton X-100 containing different concentrations of NaCl in TNE buffer for 30 min at 37°C. The reaction mixture was separated into two fractions, supernatant and pelleted tegument-nucleocapsid, by centrifugation at 100,000 ⫻ g for 1 h. Equal amounts of protein from the supernatant and pellet were analyzed by Western blotting. Genetic manipulation of KSHV BAC16 genome. Mutagenesis of BAC16 was performed as previously described (15) by using a recombineering system as described by Tischer et al. (31, 32). In brief, the Kan/ I-SceI cassettes were amplified from plasmid pEPKan-S by PCR with primers KS52-STOP-5= (5=-ACATCTACGCGTACCTGACATGGCCGC GCCCAGGGGCAGAAAGCTTTGATTAATTGACCCAAAAAGGACCT TACGATAGGATGACGACGATAAGTAGGG-3=) and KS52-STOP-3= (5=-TCTTTGCGGTTAGGTCTTCCATCGTAAGGTCCTTTTTGGGTC AATTAATCAAAGCTTTCTGCCCCTGGGCGCGGCCAGCCAGTGTT ACAACCAATTAACC-3=) for mutant BAC16-Stop52; primers KS52S123A-5= (5=-ACCGCCTCCTGGTGCCAATAACAGGCGACGAAGAG GAGCCGCGACAACACGGGCGGGGGTTGAAGGATGACGACGATA AGTAGGG-3=) and KS52-S123A-3= (5=-GCTGGTCCGCGGTTCAGTC ATCAACCCCCGCCCGTGTTGTCGCGGCTCCTCTTCGTCGCCTGT GCCAGTGTTACAACCAATTAACC-3=) were used for mutant BAC1652S123A. The purified PCR fragment was electroporated into BAC16containing GS1783 cells that had been induced at 42°C for 15 min. The recombinant clones were selected at 32°C on LB plates containing 34 g/ml chloramphenicol and 50 g/ml kanamycin and then characterized by restriction fragment length polymorphism (RFLP). Positive clones were induced again at 42°C and plated on LB plates containing 1% L-arabinose for secondary recombination. Then, replicas of the clones were
Journal of Virology
June 2016 Volume 90 Number 11
Downloaded from http://jvi.asm.org/ on April 4, 2019 by guest
Our laboratory has long been interested in tegument proteins of KSHV, especially those that are specific to gammaherpesviruses. Our previous work on a gammaherpesvirus-specific tegument protein, ORF45, revealed its crucial functions in many facets of the KSHV lytic life cycle, including evasion of the host antiviral innate immune responses by suppression of IRF7 (9–11), modulation of cellular kinase signaling (12–15), and transport of freshly assembled viral particles along microtubules (16). KSHV ORF52 is predicted to encode a protein of 131 amino acids (aa) that is conserved among gammaherpesviruses. ORF52 itself, as well as its homologues in MHV-68, RRV, and EBV (BLRF2), have all been detected in virions by mass spectrometry (17–21). ORF52 of MHV-68 has been characterized as a tegument protein with a key role in the tegumentation and secondary envelopment of virions in the cytoplasm (22–24). ORF52 of RRV has recently been shown to be a tegument protein required for the maturation and vesicle-mediated egress of viral particles (25). Phosphorylation of EBV BLRF2 by serine/arginine-rich protein kinase 2 (SRPK2) has been shown to be important for viral replication (26). We originally became interested in ORF52 not only because it is a gammaherpesvirus-specific virion protein but also because it is one of only a few KSHV proteins which contain a conserved phosphorylation motif (RXRXXS/T) of the ORF45-activated cellular kinase p90 ribosomal S6 kinase (RSK) and, thus, represents a potential viral substrate of RSK (12–15). Moreover, we recently found that KSHV ORF52 plays a role in innate immune evasion by directly inhibiting enzymatic activity of the host cytosolic DNA sensor, cGAS (27, 28). Because ORF52 is the first reported viral inhibitor of cGAS and its functions were previously uncharacterized, we named it KicGAS (KSHV inhibitor of cGAS). Although we have shown that ORF52/KicGAS inhibits the innate immune response during KSHV primary infection, the exact roles of this protein during the KSHV life cycle remain unknown. Here, we report the characterization of KSHV ORF52 and its roles during KSHV lytic replication, made possible through the generation and use of an ORF52-null bacterial artificial chromosome 16 (BAC16) mutant. Our results demonstrate that ORF52 is an abundant tegument protein that is required for the production of infectious virions.
Roles of KicGAS/ORF52 in KSHV Replication
picked from L-arabinose plates onto plates with 34 g/ml chloramphenicol alone or plates with 34 g/ml chloramphenicol plus 50 g/ml kanamycin. The kanamycin-sensitive clones were considered second-recombinant clones and confirmed by RFLP and sequencing. To make a revertant mutant, we replaced the mutant ORF52 with a wild-type ORF52 sequence by a homologous recombination strategy similar to that described above. For constructing the BAC16-Rev52 revertant mutant, the Kan/I-SceI cassettes were amplified from plasmid pEPKan-S by PCR with the following primers: KS52-STOP-R-5= (5=-ACATCTACG CGTACCTGACATGGCCGCGCCCAGGGGCAGACCCAAAAAGGAC CTTACGATAGGATGACGACGATAAGTAGGG-3=) and KS52-STOPR-3= (5=-TCTTTGCGGTTAGGTCTTCCATCGTAAGGTCCTTTTTG GGTCTGCCCCTGGGCGCGGCCAGCCAGTGTTACAACCAATTA ACC-3=). Reconstitution of recombinant KSHVs. Briefly, iSLK cells seeded in a 24-well plate were transfected with 0.5 g of BAC DNAs by using Effectene (Qiagen). One day after transfection, cells were subcultured into a T150 flask with fresh medium containing 450 g/ml G418 and 1 g/ml puromycin. The next day, hygromycin was added to a final concentration of 500 g/ml for selection. After about 12 days of selection, hygromycinresistant colonies were trypsinized, pooled, and subcultured at a 1:9 dilution every 3 days. To induce viral lytic replication, BAC-containing iSLK cells were seeded into 6-well plates or T150 flasks and, 1 day later, the medium was replaced with fresh medium containing 2 g/ml doxycycline and 1 mM butyrate. Preparation and quantification of viral genomic DNA. The preparation and quantification of viral genomic DNA were performed as previously described (33). Briefly, the medium from induced BAC-iSLK cells was collected, centrifuged, and passed through a 0.45-m filter to clear cell debris. Treatment of 100 l of the cleared supernatant with 10 units of Turbo DNase (Ambion, Austin, TX) at 37°C for 1 h degraded extravirion
June 2016 Volume 90 Number 11
DNAs. The reaction was stopped by the addition of 10 mM EDTA followed by heating at 70°C for 15 min with 0.4 mg of proteinase K (Qiagen, Valencia, CA) in 0.5⫻ buffer AL (Qiagen, Valencia, CA). Then, the mixture was extracted with phenol-chloroform. The DNA was precipitated by ethanol with glycogen as a carrier, and the DNA pellet was dissolved in 40 l of Tris-EDTA buffer. Two microliters of such DNA was used in a real-time quantitative PCR with SYBR dyes. Viral DNA copy numbers were calculated with external standards of known concentrations of BAC16 DNA. The primers ORF73-LCN (5=-CGCGAATACCGCTATGT ACTCA-3=) and ORF73-LCC (5=-GGAACGCGCCTCATACGA-3=) were previously described by Krishnan et al. (34). Viral infection and FACS. Infection was carried out as previously described (15, 33). Briefly, HEK293 cells were plated into 24-well plates the day before infection and then incubated with concentrated virus with Polybrene (4 g/ml) and spun at 800 ⫻ g for 1 h at room temperature. The plates were then incubated at 37°C for another 2 h, and the inocula were then removed and replaced with fresh medium with 5% FBS. The next day, the medium was replaced with fresh medium containing 1% FBS. After 48 h of infection, the cells were examined by fluorescence-activated cell sorting (FACS) for the expression of green fluorescent protein (GFP). Briefly, the cells were trypsinized, washed with PBS, and then fixed in 2% paraformaldehyde in PBS for 10 min at room temperature. The cells were then washed and resuspended in PBS, followed by analysis with a BD FACSCanto analyzer.
RESULTS
KSHV ORF52 can be phosphorylated by p90RSK. We recently identified several putative substrates of ORF45-activated RSK (35). Of these, ORF52 was one of the few viral proteins for which phosphorylation was detected at the consensus RSK phosphory-
Journal of Virology
jvi.asm.org
5331
Downloaded from http://jvi.asm.org/ on April 4, 2019 by guest
FIG 1 KSHV ORF52 is expressed with late gene kinetics. (A, B) Anti-ORF52 mouse monoclonal antibodies (4H4 and 8C8) specifically recognize ORF52 protein in both transiently transfected cells (A) and induced BCBL-1/iSLK.219 cells (B). (C) The two anti-ORF52 monoclonal antibodies were used for epitope mapping by Western blot analysis, using purified glutathione S-transferase (GST)-ORF52 proteins encompassing a series of 10-aa internal deletion mutants. (D) iSLK.BAC16 cells were induced in the presence or absence of PAA for the indicated times (days postinduction [dpi]). Viral protein levels were assessed by Western blotting with antibodies to the indicated proteins. IE, immediate early gene; E, early gene; L, late gene.
Li et al.
lation motif RXRXXS*/T* (asterisks indicate phosphorylated residues) (36). We used bioinformatic tools to scan the genomes of gammaherpesviruses and identified dozens of open reading frames (ORFs) bearing this motif. However, only the RXRXXS*/T* motif in ORF52 is positionally conserved (see Fig. S1A in the supplemental material). We found that ORF52 is efficiently phosphorylated by RSK at the predicted Ser123 residue and that this phosphorylation is increased by ORF45 (see Fig. S1B and C). We have further confirmed ORF45-ORF52 interaction (see Fig. S1D), which is consistent with previous observations (37, 38). KSHV ORF52 is expressed as a true late gene. Although the ORF52s of MHV-68 and RRV have been shown to be required for virion morphogenesis (23, 25), the roles of KSHV ORF52 have not been characterized. In order to investigate the characteristics and functions of ORF52, we first generated two monoclonal antibodies against it, 4H4 and 8C8. Both antibodies detected specific signals of the expected size of ORF52 (131 aa) in transfected cells (Fig. 1A). The antibodies also detected signals in tetradecanoyl phorbol acetate (TPA)-induced BCBL-1 cells and doxycyclineinduced iSLK cells but not in uninduced cells (Fig. 1B), further confirming the specificities of these antibodies and also suggesting that ORF52 is expressed only during the lytic phase. Using a series of ORF52 internal deletion mutants, we revealed the distinct epitopes of these two antibodies (Fig. 1C). We next investigated the kinetics of ORF52 expression. As shown by the results in Fig. 1D, ORF52 was expressed only after cells were induced to undergo lytic replication. The expression kinetics are similar to the kinetics of the late gene (L) and capsid triplex dimer protein, ORF26, and slower than the kinetics of RTA (immediate early [IE]) and PF8/ORF59 (early [E]), suggesting that ORF52 is a late gene. To provide further evidence that ORF52 is indeed a true late gene, we induced cells in the presence of
5332
jvi.asm.org
phosphonoacetic acid (PAA), which inhibits viral DNA replication. As expected, we observed that the expression of early genes was minimally affected, while ORF52 expression was abolished (Fig. 1D, lanes 6 to10), confirming that ORF52 is a true late gene. KSHV ORF52 is a cytoplasmic protein. Although the ORF52s of RRV and MHV-68 were found to be mostly cytoplasmic (23– 25), EBV BRLF2 was observed mostly in the nucleus (26). We and others have shown that GFP-tagged or myc-tagged KSHV ORF52 exhibits mostly cytoplasmic localization (27, 39). Here, we used our monoclonal antibodies to examine the subcellular localization of ORF52, and both antibodies detected specific signals of transfected ORF52 exclusively in the cytoplasm (Fig. 2A). Importantly, when induced iSLK/BAC16 or BCBL-1 cells were stained by these antibodies, ORF52 was also observed predominantly in the cytoplasm (Fig. 2B). These results indicate that ORF52 is a cytoplasmic protein. In addition to its clear cytoplasmic localization, we also observed some punctate and bundled signals, which are similar to what had been previously observed in MHV-68 ORF52-transfected cells (24) and RRV-infected cells (25). The punctate structures are reminiscent of the endomembrane system. To further characterize these punctate structures, we cotransfected KSHV ORF52 with markers for different components of the endomembrane system. We observed modest signal overlap of KSHV ORF52 with the trans-Golgi network (TGN), and, to a lesser extent, with the endoplasmic reticulum (ER) but detected no overlap with endosomal markers (see Fig. S2 in the supplemental material). The bundled and filamentous structure of ORF52 is suggestive of microtubules. Indeed, we observed that transfected ORF52 colocalized with ␣-tubulin, as well as MAP4 (see Fig. S2B and C). To further confirm this colocalization in KSHV-infected cells, we modified iBAC (a BAC16 mutant that has been engineered to express RTA from a doxycycline-inducible promoter
Journal of Virology
June 2016 Volume 90 Number 11
Downloaded from http://jvi.asm.org/ on April 4, 2019 by guest
FIG 2 ORF52 exhibits cytoplasmic localization. (A) HeLa cells transfected with an ORF52-expressing vector were fixed 24 h after transfection and stained with mouse monoclonal antibodies to ORF52 (4H4 and 8C8) and DAPI. (B) Cytoplasmic localization of ORF52 was confirmed in induced iSLK.BAC16 (top) and BCBL-1 (bottom) cells using antibody 4H4. (C) SLK.iBAC-GFP52 cells were cultured in the presence (induced) or absence (uninduced) of doxycycline for 72 h. Cells were then fixed and stained with monoclonal anti–␣-tubulin antibody and DAPI.
Roles of KicGAS/ORF52 in KSHV Replication
iSLK.BAC16 cells (lanes 1 and 2) and gradient-purified KSHV virions (lane 3) were resolved by SDS-PAGE and analyzed by Western blotting with antibodies to the indicated proteins. (B) KSHV virions were fractionated on a 20-to-60% sucrose gradient. Fractions and input were analyzed by Western blotting with antibodies to the indicated proteins. (C) Viral DNA of each fraction in shown in panel B was extracted and analyzed by quantitative PCR (qPCR) (red), and the percentage of sucrose of each fraction was calculated from the refractive index (green). The two values were plotted for each fraction collected.
[35]) by fusing GFP to the C terminus of ORF52. Stable cells harboring this designed KSHV BAC DNA (SLK.iBAC-GFP52) were then cultured in the presence or absence of doxycycline. The ORF52-GFP signals were only detected in the induced cells and often displayed punctate and bundled patterns in the perinuclear region. The IFA results confirmed significant signal overlap between ORF52 and ␣-tubulin (Fig. 2C). KSHV ORF52 is an abundant tegument protein. Although ORF52 was identified in purified KSHV virions by mass spectrometry (19), its localization in virions was not investigated. We confirmed that ORF52 is present in purified KSHV virions, along with other known virion proteins, such as capsid protein ORF26 and tegument protein ORF45 (Fig. 3A). When concentrated KSHV virions were analyzed by sucrose gradient centrifugation, the ORF52 protein was found to cofractionate well with ORF45 and the majority of ORF52 protein comigrated with the capsid protein ORF26 (Fig. 3B, fractions 9 to 16). The peak fractions for ORF26 protein content (Fig. 3B, fractions 11 to 15) also contained large proportions of ORF52 and ORF45 signals, as well as viral genomic DNA (Fig. 3B and C), indicating that these fractions likely represent intact viral particles. To determinate whether ORF52 resides within the viral enve-
June 2016 Volume 90 Number 11
Journal of Virology
jvi.asm.org
5333
Downloaded from http://jvi.asm.org/ on April 4, 2019 by guest
FIG 3 ORF52 is a virion protein. (A) Cell lysates of uninduced and induced
lope, we treated virions with trypsin in the presence and absence of Triton X-100, a detergent that dissolves membranes. As expected, the envelope glycoprotein K8.1 was degraded even in the absence of Triton X-100, the tegument proteins ORF45 (19, 40), ORF33, and ORF38 (30) were degraded only in the presence of the detergent, and the capsid protein ORF26 remained resistant to digestion. Similarly to tegument proteins, ORF52 was degraded by trypsin only when the viral envelope was disrupted by Triton X-100, suggesting that ORF52 is located inside the viral envelope (Fig. 4A). To investigate the association between ORF52 and capsid, we treated virions with increasing concentrations of detergent and then separated the capsid from the dissociated proteins by centrifugation through a 25% sucrose cushion. Both the supernatant (containing dissociated proteins) and pellet (containing capsid and associated proteins) were analyzed by Western blotting. As expected, envelope protein K8.1 became soluble and was detected in the supernatant in the presence of detergent. In contrast, capsid protein ORF26 was always detected in the pellet, as was ORF33 (Fig. 4B), a panherpesvirus conserved tegument protein that apparently associates directly with capsid (30, 41). With the detergent treatment, ORF52 and ORF45 became dissociated from capsids. However, ORF52 protein was more easily stripped off from the virion into the supernatant than ORF45 (Fig. 4B). At a higher concentration of detergent, about half of the ORF52 was dissociated from the capsid, while the majority of the ORF45 was still associated with the capsid. Similar trends were obtained upon treatment of purified virions with increasing concentrations of the anionic detergent sodium dodecyl sulfate (SDS) (Fig. 4C). As the concentration of SDS was increased, most of the ORF52 was detached from the capsid, while more than half of the ORF45 remained associated with the capsid. At the highest concentration of SDS, more than 98% of the ORF52 was stripped off into the supernatant, while about 50% of the ORF45 stayed in the pellet. Under the same conditions, small portions of capsid protein ORF26 and inner tegument protein ORF33 became detectable in the supernatant, indicating that the capsid had disintegrated. We also treated virions with increasing concentrations of NaCl. Again, the tegument proteins ORF52 and ORF45 were detected in both fractions. At higher NaCl concentrations, more ORF52 protein was detected in the supernatant than in the pellet (Fig. 4D). In contrast, the majority of ORF45 protein remained associated with the viral pellet even at the highest NaCl concentration (Fig. 4D). All of these experiments suggested that ORF52 is a tegument protein and is more loosely associated with the viral capsid than ORF45. KSHV ORF52 is required for production of infectious virions. In an attempt to characterize the roles of ORF52 in the KSHV life cycle, we generated an ORF52-null mutant of the infectious bacterial artificial chromosomal clone of KSHV, BAC16, using a seamless recombineering technique (Fig. 5A) (31, 32, 42). We terminated ORF52 translation prematurely by introducing a triple stop codon into its coding region near the N terminus (after the 7th codon) (Fig. 5B, red letters). To facilitate analysis of the recombinants, a HindIII site was also introduced (Fig. 5B, underlined letters). To ensure that any phenotypic changes are indeed caused by the designed mutation rather than unintentional secondary mutations, we further generated a revertant, BAC16-Rev52, in which the ORF52 coding sequence was restored to the wild type (Fig. 5B). To
Li et al.
assess the extent to which the ORF45/RSK-dependent phosphorylation of ORF52 at Ser123 plays a role in lytic reactivation, we mutated this residue to alanine to generate BAC1652S123A (Fig. 5B). All BAC mutants were analyzed by restriction fragment length
5334
jvi.asm.org
polymorphism (RFLP) and further verified by sequencing of the affected region. Due to the insertion of a HindIII site into the ORF52 locus in the BAC16-Stop52 clone, the ⬃5.5-kb HindIII fragment was split into two bands of sizes ⬃4.1 kb and ⬃1.4 kb (Fig. 5C, red arrows). As expected, digestion of the BAC DNAs
Journal of Virology
June 2016 Volume 90 Number 11
Downloaded from http://jvi.asm.org/ on April 4, 2019 by guest
FIG 4 ORF52 is a tegument protein. (A) Purified virions were left untreated (lane 1) or treated with trypsin either in the absence (lane 2) or in the presence (lane 3) of 1% Triton X-100 for 1 h at 37°C. The proteolysis reactions were terminated by the addition of 0.5 mM phenylmethylsulfonyl fluoride (PMSF) and 1⫻ protease inhibitor. The samples were analyzed by Western blotting with antibodies to the indicated proteins. (B) Purified virions were treated with different concentrations (from 2% to 0%) of Triton X-100 in TNE buffer for 30 min and then centrifuged at 100,000 ⫻ g for 1 h. The supernatant (S) and pellet (P) were dissolved in SDS-PAGE loading buffer and analyzed by Western blotting with antibodies against virion proteins as indicated. (C) Purified virions were left untreated (no detergent) or treated with different concentrations (from 1% to 0%) of SDS in TNE buffer containing 1% Triton X-100 and 0.5% deoxycholate (DOC) for 30 min and then centrifuged and analyzed as described for panel B. (D) Purified virions were treated with different concentrations (from 1 M to 150 mM) of NaCl in TNE buffer with 1% Triton X-100 for 30 min or left untreated (input) and then centrifuged and analyzed as in the experiments whose results are shown in panels B and C. Teg, tegument protein; Cap, capsid protein; Env, envelope protein. The percentages of proteins stripped off into the supernatant were plotted for indicated virion proteins based on the results of the Western blotting.
Roles of KicGAS/ORF52 in KSHV Replication
Downloaded from http://jvi.asm.org/ on April 4, 2019 by guest FIG 5 Construction of ORF52 mutants. (A) Schematic diagram of KSHV BAC16 DNA with expected restriction fragment sizes shown for HindIII (left) and KpnI (right). (B) Schematic diagram of genome structure surrounding ORF52. KpnI/HindIII restriction sites are indicated, and the nucleotide sequences of the designed mutations are shown. Reed letters shown the triple stop codon, and underlined lettered show the HindIII site. (C) Restriction enzyme digestion of purified KSHV BAC DNAs with KpnI or HindIII. Red arrows indicate the expected changes in the HindIII digestion pattern of BAC16-Stop52. No nonspecific or spurious rearrangements were observed in any of the mutant BACs. (D) iSLK cells containing either BAC16-Stop52 DNA or its revertant mutant (Rev52) were analyzed by IFA for ORF52 expression (red) and BAC16 DNA (green).
with KpnI revealed no discernible differences between the wild type and mutants (Fig. 5C). The BAC DNAs were transfected into iSLK cells, and stable cell lines were established after selection with hygromycin (15). Immunofluorescence assays confirmed the loss of ORF52 expression in doxycycline-induced iSLK.BAC16-Stop52 cells (Fig. 5D). To compare the viral growth curves of the mutants and wild-type KSHV, we collected extracellular viruses from the medium and
June 2016 Volume 90 Number 11
determined viral genome copies by real-time PCR as previously described (33, 43). As shown by the results in Fig. 6A, BAC16Stop52 produced significantly fewer progeny viruses at each time point than BAC16-WT and BAC16-Rev52. At 5 days postinduction, the defect was about 30-fold. In contrast, the S123A mutation seemed to have little effect on progeny virion production. When the viruses were analyzed by Western blotting, the defect in genome copy number was mirrored by the loss of capsid pro-
Journal of Virology
jvi.asm.org
5335
Li et al.
ORF52-null (Stop52), or revertant (Rev52) viral genome were induced to undergo lytic reactivation. Extracellular virions were collected from the medium on the indicated days postinduction (dpi), and viral genome copies in the medium were determined by qPCR as described in Materials and Methods. (B) Extracellular virions were collected and concentrated (⬃100-fold) as described in Materials and Methods. Equal volumes of concentrated medium from different cell lines were analyzed by Western blotting with antibodies to the indicated proteins. (C) Purified BAC16-Stop52 and Rev52 viruses were normalized by viral genome copy number (2 ⫻ 106 per lane) and then analyzed by Western blotting with anti-ORF26 and anti-ORF52 antibodies. (D) HEK293 cells were infected with twofold serial dilutions of the indicated viruses (normalized by viral genome copy number, starting from 100 viral genome copies per cell) and then analyzed by flow cytometry at 48 h postinfection. Values are the average results of two biological duplicates.
teins ORF26 and ORF65, and it appeared that the Stop52 virions were further deficient in the packaging of other tegument proteins, including ORF45 and ORF33 (Fig. 6B). These results confirmed that the loss of ORF52 reduced the production of progeny viruses and also suggested that it may impair the tegumentation process. To compare the infectivities of the extracellular virions, we first normalized the viruses by genomic copies of virus. The comparable amount of viruses was confirmed by the detection of similar levels of capsid protein ORF26 in each sample (Fig. 6C). Twofold serial dilutions of each virus were used to infect HEK293 cells, and the outcome of infection was quantified by FACS analysis of the GFP signal at 48 h postinfection. As shown by the results in Fig. 6D, the infection rate of BAC16-Rev52, as assessed by the percentage of GFP-positive cells, was comparable to that of BAC16-WT, but the infection rate of BAC16-Stop52 virus was dramatically lower (Fig. 6D). These results suggested that, in addition to reducing viral particle production, the loss of ORF52 compromises the infectivity of progeny virions. KSHV ORF52 plays a role in virion assembly. To investigate the potential mechanism(s) responsible for the observed defect in the production of infectious virions, we first analyzed the levels of various viral proteins over a time course of lytic reactivation. With the exception of the loss of ORF52, the levels of the viral proteins
5336
jvi.asm.org
we assessed were not significantly affected by the Stop52 mutation (Fig. 7A). We next determined whether ectopic expression of ORF52 could rescue the deficiency of BAC16-Stop52 in progeny virion protein in iSLK cells. We transduced iSLK/BAC16-WT with empty lentiviral vector and iSLK/BAC-Stop52 with either empty or ORF52-expressing lentiviral vector. The expression of ORF52 in iSLK/BAC-Stop52 was partially restored (Fig. 7B, bottom), as was the yield of extracellular viruses (Fig. 7B, top), further confirming that the deficient virion production of BAC16-Stop52 was indeed due to the loss of ORF52. Because BAC16-Stop52 viruses infect cells less efficiently than the wild-type or BAC16-Rev52 viruses (Fig. 6D), we next sought to determine whether ectopic expression of ORF52 in HEK293 cells could rescue the defect in infectivity of BAC16Stop52 virions. However, the expression of ORF52 in HEK293 cells had no apparent effect on the infection rate of BAC16Stop52 viruses, suggesting that trans-supplied ORF52 in the infected cells was not sufficient to compensate for the loss of ORF52 in BAC16-Stop52 virions (Fig. 7C). Based on these data and those presented in Fig. 6B, we reasoned that BAC16Stop52 viruses may have additional defects in virion protein components. To assess virion composition, we analyzed the virions of
Journal of Virology
June 2016 Volume 90 Number 11
Downloaded from http://jvi.asm.org/ on April 4, 2019 by guest
FIG 6 ORF52 is required for production of infectious progeny viruses. (A) Stable iSLK cells carrying BAC16 WT or a phosphorylation-deficient (S123A),
Roles of KicGAS/ORF52 in KSHV Replication
BAC16-Rev52 and BAC16-Stop52 following fractionation on a 20-to-60% sucrose gradient. As shown by the results in Fig. 8A, BAC16-Rev52 virion capsids were enriched in fractions 11 to 13, with the peak containing a concentration of ⬃34% sucrose (Fig. 8A). In contrast, BAC16-Stop52 virions exhibited a distinct shift in the peak of capsid signal to lighter fractions, fractions 8 to 10, containing ⬃28% sucrose. This shift in capsid distribution is indicative of a lower buoyant density of Stop52 virions, suggesting altered virion composition. To determine which viral proteins might be missing in BAC16-Stop52 virions, we normalized the number of virions, as well as cell lysate, by ORF26 protein level and analyzed them by Western blotting for envelope protein K8.1 and several tegument proteins, including ORF45, ORF33, and ORF38. As shown by the results in Fig. 8B, BAC16-Stop52 extracellular virions contained no detectable ORF45 and had significantly reduced levels of ORF33, and ORF38 compared to BAC16Rev52 virions, despite the comparable levels of ORF26 and K8.1 between Stop52 and Rev52 virions (Fig. 8B, compare lanes 3 and 6). To assess the integrity of the envelope, we examined the sensitivity of tegument proteins to trypsin digestion as in the experiment whose results are shown in Fig. 4A. As shown in Fig. 8C, despite its lower level in the BAC16-Stop52 virions, ORF38 was resistant to trypsin digestion in the absence of detergent, suggesting that envelopment of virions was not affected by the loss of ORF52. Altogether, these results suggest that ORF52 is required for the incorporation of certain tegument proteins, especially ORF45, into virions.
June 2016 Volume 90 Number 11
DISCUSSION
We initially became interested in ORF52 because it is a gammaherpesvirus-specific virion protein and, more importantly, because it contains a positionally conserved RSK phosphorylation motif (RXRXXS*/T*) at serine 123. Although we confirmed that KSHV ORF52 could be phosphorylated by RSK (see Fig. S1B in the supplemental material), this phosphorylation was only slightly increased by coexpression of ORF45 (see Fig. S1C) and was not apparently affected by inhibition of RSK (data not shown), suggesting that RSK may not be the sole kinase capable of phosphorylating this site. Recently, Duarte et al. reported that the homologue of ORF52 in EBV, BRLF2, is phosphorylated by the serine/ arginine-rich protein-specific kinase SRPK2 on serines near this conserved motif (RaRS*RS* in BRLF2 and RpRS*KS* in MHV-68 ORF52) and that this phosphorylation is functionally important for viral replication (26). However, in our work, mutation of serine 123 of KSHV ORF52 had little effect on the production of virions. Further analyses of the ORF45/RSK-mediated phosphorylation of ORF52 and other viral substrates are necessary to uncover the potential regulatory roles of these modifications. Mass spectrometric analyses of the purified virions of several gammaherpesviruses, including KSHV, RRV, MHV-68, and EBV, have identified ORF52 as an abundant component of their virions (17–21). However, there was no experimental evidence demonstrating that KSHV ORF52 resides in the tegument layer of virions. Using custom-generated specific monoclonal antibodies, we showed here that KSHV ORF52 is expressed late during the lytic
Journal of Virology
jvi.asm.org
5337
Downloaded from http://jvi.asm.org/ on April 4, 2019 by guest
FIG 7 Complementation of ORF52-null mutant. (A) Stable iSLK cells carrying ORF52-null (Stop52) or the revertant (Rev52) were induced for the indicated times (days postinduction [dpi]). Cell lysates were analyzed by Western blotting with antibodies to the indicated proteins. (B) iSLK.BAC16-Stop52 cells stably transduced by ORF52 or empty control lentiviral expression vector were induced for 5 days, and then viral DNA was extracted from the supernatant and genome copy number was analyzed by qPCR. Values shown are relative to the results for iSLK.BAC16 WT transduced with empty vector. Expression of ORF52 was confirmed by Western blotting (bottom). (C) WT or Stop52 virions were normalized by viral genome copy number and then used to infect HEK293 cells stably transduced by ORF52 or empty control lentiviral expression vector. Cells were analyzed by flow cytometry at 48 h postinfection. Expression of ORF52 was confirmed by Western blotting (right).
Li et al.
Downloaded from http://jvi.asm.org/ on April 4, 2019 by guest FIG 8 ORF52 is required for virion assembly. (A) Crude virion pellets of BAC16-Rev52 (blue) or BAC16-Stop52 (red) were layered over a 20-to-60% sucrose gradient and then ultracentrifuged at 100,000 ⫻ g for 1 h. Fractions were collected, separated by SDS-PAGE, and immunoblotted for capsid protein ORF26. The distribution ratio of ORF26 (left axis) and percentage of sucrose (right axis; green) was plotted for each fraction. (B) Equal amounts of uninduced and induced iSLK.BAC16-Rev52 (lanes 1 and 2) or BAC16-Stop52 (lanes 4 and 5) cell lysates or virions (lanes 3 and 6) were resolved by SDS-PAGE and analyzed by Western blotting with antibodies to the indicated proteins. (C) Equal DNA copy numbers of purified virions of BAC16-Stop52 and BAC16-Rev52 were left untreated (lanes 1 and 4) or treated with trypsin in the presence (lanes 3 and 6) or absence (lanes 2 and 5) of Triton X-100. The samples were analyzed by Western blotting with antibodies to the indicated proteins.
cycle (Fig. 1D) and localizes to the cytoplasm (Fig. 2). Importantly, we further revealed that ORF52 is readily detected in gradient-purified virions and cofractionates with other virion components (Fig. 3). Furthermore, ORF52 resides inside the viral envelope, because it is protected from trypsin digestion of intact
5338
jvi.asm.org
virions (Fig. 4A). Collectively, these results confirmed that KSHV ORF52 is indeed an abundant tegument protein in KSHV extracellular virions. We confirmed that KSHV ORF52 is mostly a cytoplasmic protein, consistent with previous studies (27, 39). Interestingly, like
Journal of Virology
June 2016 Volume 90 Number 11
Roles of KicGAS/ORF52 in KSHV Replication
June 2016 Volume 90 Number 11
teracts with pUL25 and pUL43 (60, 61), and the loss of pp65 impairs the incorporation of other tegument proteins into virions (62). Interactions among gammaherpesvirus-specific tegument proteins may also exist (38, 48, 52, 63, 64). However, because robust lytic replication systems of EBV and KSHV are lacking, studies of gammaherpesvirus assembly are lagging behind those of alpha- and betaherpesviruses. Studies on alpha- and betaherpesvirus-specific tegument proteins will shed light on the mechanisms of virion assembly of gammaherpesviruses. Although ORF52 is considered to be unique to gammaherpesviruses, Hew et al. revealed low but discernible structural conservation between the core domain of VP22 (conserved C terminus) and MHV-68 ORF52 (65). More interestingly, the two appear to be positionally conserved in the genome; both reside in the same gene block, which is conserved in all herpesviruses, and next to the gene encoding the conserved glycoprotein N (gN; encoded by ORF53 in KSHV and by UL49.5 in HSV-1) (66). VP22, encoded by UL49, is an abundant alphaherpesvirus-specific tegument protein of HSV-1 which is known to be heavily phosphorylated (67, 68) and may partially colocalize with the TGN (69). VP22 was also found to colocalize with and induce the stabilization of microtubules (44, 45). This is reminiscent of what we have observed for KSHV ORF52 (Fig. 2C). Furthermore, it has been reported that loss of VP22 causes reduced incorporation of other viral proteins into virions, such as ICP0 (70, 71). VP22 also exists in a virion protein interaction network which is important for viral assembly. Besides binding to the tegument protein ICP0, VP22 interacts with its major binding partner VP16, which links to other alphaherpesvirus-specific tegument proteins (46, 53). Furthermore, VP22 is also incorporated into the gE-VP22-gM complex, which may associate with the UL11-UL16 complex via its interaction with glycoproteins (72). If ORF52 and VP22 indeed share functional and structural similarities, a logical assumption is that ORF52 is similarly involved in virion assembly through its intricate interactions with other virion proteins. On the other hand, VP22 may also inhibit cGAS. Consistent with this notion, VP22, like ORF52, is positively charged and has been shown to bind to DNA (73). In the present report, we demonstrate that packaging of KSHV ORF45 is completely abrogated in ORF52-null virions, which is consistent with what has been observed for ORF52-null MHV-68 virus and the knockdown mutants of RRV (23, 25). However, our results indicate that KSHV ORF52 is more loosely associated with the capsid than is ORF45, in contrast to the result for MHV-68 ORF52. Moreover, based on electron microscopy, viral particles derived from MHV-68 ORF52-null and RRV ORF52 knockdown mutants accumulate in the cytoplasm and lack an envelope, suggesting a possible role of ORF52 in secondary envelopment (23, 25). As an abundant tegument protein, ORF52 may serve an essential role in linking the capsid to the viral envelope, similar to the function of alphaherpesvirus VP16/pUL48 (57–59). However, KSHV ORF52-null viruses appear to possess an intact membrane (Fig. 8C), which is reminiscent of the phenotype observed in HSV-1 VP22-null mutants (70, 74). We speculate that KSHV ORF52 reinforces the interaction network between virion proteins, much as HSV-1 VP22 and HCMV pp65 do (62, 72). The shared and unique structural features and functions of ORF52 homologues in KSHV, MHV-68, RRV, and EBV allude to the common, yet distinct strategies employed by these viruses to maintain persistent infection of their human host. Future studies
Journal of Virology
jvi.asm.org
5339
Downloaded from http://jvi.asm.org/ on April 4, 2019 by guest
KSHV ORF52, its homologues in both RRV and MHV-68 were found to be mostly cytoplasmic (23–25), but the homologue in EBV (BRLF2) was observed mostly in the nucleus (26). We often noticed punctuated and bundled structures of KSHV ORF52 in both transfected and KSHV-infected cells. Noticeable portions of the structures seemed to overlap the TGN and microtubules. The association of KSHV ORF52 with the TGN suggests its potential involvement in tegumentation and/or final envelopment, which has been shown for both RRV and MHV68 ORF52 homologues (23–25). Intriguingly, we also observed a potential association of ORF52 with microtubules. Associations with microtubules or associated proteins have been observed for a number of herpesviral tegument proteins—for example, KSHV ORF45 and HSV-1 VP22 (see below) (16, 44, 45). It will be interesting to determine the biological significance of the association of ORF52 with microtubules. To reveal the roles of ORF52 in KSHV lytic replication, we generated ORF52-null BAC16-Stop52 and its revertant and analyzed their phenotypes in iSLK cells. We found that BAC16Stop52 produced about 30-fold less progeny virions than the wildtype or revertant (Fig. 6A and B). Furthermore, this defect was largely rescued by ectopic expression of ORF52 (Fig. 7B). These observations clearly suggest that ORF52 is required for the production of progeny viruses. When the progeny virions were used to infect HEK293, reduced infectivity was also noticed (Fig. 6D). The reduced infectivity of BAC16-Stop52 is consistent with its role in inhibiting cGAS DNA sensing during primary infection. However, HEK293 cells do not express cGAS, suggesting that the observed phenotype must have an additional explanation. Upon further analysis, we noticed a difference between the composition of Stop52 virions and that of the revertant virions (Fig. 8A). In particular, the levels of several tegument proteins, most notably ORF45, were reduced in ORF52-null virions, suggesting that ORF52 plays a critical role in the assembly of progeny virions (Fig. 8B). The assembly of herpesvirus virions is a complex process that depends on intricate interactions among virion proteins. Among those tegument proteins, the interaction between ORF64 (homologue to pUL36 of HSV-1 and pUL48 of human cytomegalovirus [HCMV]) and ORF63 (homologue to pUL37 of HSV-1 and pUL47 of HCMV) and the interaction between ORF38 (homologue to pUL11 of HSV-1 and pUL99 of HCMV) and ORF33 (homologue to pUL16 of HSV-1 and pUL94 of HCMV) are well characterized and conserved in all three Herpesviridae subfamilies (38, 46–52). However, the best-characterized functions and the most abundant tegument proteins in any herpesvirus are often not in the conserved core set. Each subfamily of herpesviruses has unique tegument proteins, and interactions among these subfamily-specific tegument proteins also play important roles in viral assembly. Several studies have suggested that the alphaherpesvirus-specific tegument protein VP16 (encoded by pUL48) interacts with several other tegument proteins, including pUL49 (46, 53), pUL41 (54), pUL36 (46), and pUL46 (46, 55), thereby linking the capsid and inner tegument proteins with the outer tegument and membrane/glycoproteins during viral assembly (56–59). It is worth noting that among these interacting partners, all except pUL36 are unique to alphaherpesviruses. Similar interactions between tegument proteins of betaherpesviruses have also been reported. The most abundant tegument protein of HCMV, pp65 (pUL83), in-
Li et al.
are necessary to understand the mechanisms by which ORF52 and other tegument proteins contribute to key processes throughout the viral life cycle, including virion assembly and primary infection.
13.
ACKNOWLEDGMENTS 14.
15.
16.
FUNDING INFORMATION
17.
This work, including the efforts of Fanxiu Zhu, was funded by HHS | National Institutes of Health (NIH) (R01DE016680). This work, including the efforts of Denis R. Avey, was funded by HHS | National Institutes of Health (NIH) (F31CA183250).
18.
REFERENCES
19.
1. Chang Y, Cesarman E, Pessin MS, Lee F, Culpepper J, Knowles DM, Moore PS. 1994. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi’s sarcoma. Science 266:1865–1869. http://dx.doi .org/10.1126/science.7997879. 2. Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM. 1995. Kaposi’s sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity– based lymphomas. N Engl J Med 332:1186 –1191. http://dx .doi.org/10.1056/NEJM199505043321802. 3. Luppi M, Barozzi P, Maiorana A, Artusi T, Trovato R, Marasca R, Savarino M, Ceccherini-Nelli L, Torelli G. 1996. Human herpesvirus-8 DNA sequences in human immunodeficiency virus-negative angioimmunoblastic lymphadenopathy and benign lymphadenopathy with giant germinal center hyperplasia and increased vascularity. Blood 87:3903–3909. 4. Moore PS, Gao SJ, Dominguez G, Cesarman E, Lungu O, Knowles DM, Garber R, Pellett PE, McGeoch DJ, Chang Y. 1996. Primary characterization of a herpesvirus agent associated with Kaposi’s sarcomae. J Virol 70:549 –558. 5. Davison A, Eberle R, Ehlers B, Hayward G, McGeoch D, Minson A, Pellett P, Roizman B, Studdert M, Thiry E. 2009. The order Herpesvirales. Arch Virol 154:171–177. http://dx.doi.org/10.1007/s00705-008 -0278-4. 6. Speck SH, Ganem D. 2010. Viral latency and its regulation: lessons from the ␥-herpesviruses. Cell Host Microbe 8:100 –115. http://dx.doi.org/10 .1016/j.chom.2010.06.014. 7. Ganem D. 2007. Kaposi’s sarcoma-associated herpesvirus, p 2847–2888. In Knipe DM, Howley PM, Griffin DE, Lamb RA, Martin MA, Roizman B, Straus SE (ed), Fields virology 5th ed, vol 2. Lippincott Williams & Wilkins, Philadelphia, PA. 8. Gibson W. 1996. Structure and assembly of the virion. Intervirology 39: 389 – 400. 9. Zhu FX, King SM, Smith EJ, Levy DE, Yuan Y. 2002. A Kaposi’s sarcoma-associated herpesviral protein inhibits virus-mediated induction of type I interferon by blocking IRF-7 phosphorylation and nuclear accumulation. Proc Natl Acad Sci U S A 99:5573–5578. http://dx.doi.org/10 .1073/pnas.082420599. 10. Zhu FX, Sathish N, Yuan Y. 2010. Antagonism of host antiviral responses by Kaposi’s sarcoma-associated herpesvirus tegument protein ORF45. PLoS One 5:e10573. http://dx.doi.org/10.1371/journal.pone.0010573. 11. Liang Q, Fu B, Wu F, Li X, Yuan Y, Zhu F. 2012. ORF45 of Kaposi’s sarcoma-associated herpesvirus inhibits phosphorylation of interferon regulatory factor 7 by IKKε and TBK1 as an alternative substrate. J Virol 86:10162–10172. http://dx.doi.org/10.1128/JVI.05224-11. 12. Kuang E, Tang Q, Maul GG, Zhu F. 2008. Activation of p90 ribosomal S6 kinase by ORF45 of Kaposi’s sarcoma-associated herpesvirus and its
5340
jvi.asm.org
20.
21. 22.
23.
24.
25.
26.
27.
28. 29.
Journal of Virology
June 2016 Volume 90 Number 11
Downloaded from http://jvi.asm.org/ on April 4, 2019 by guest
We are grateful to Klaus Osterrieder for providing plasmid pEPKan-S, Gregory Smith for providing E. coli strain GS1783, Rolf Renne for providing E. coli strain GS1783 carrying BAC16, and Jinjong Myoung and Don Ganem for providing the iSLK cells. We thank Ke Lan for the anti-RTA monoclonal antibody and Robert Ricciardi for the anti-PF8 polyclonal antibody. We thank David Meckes for providing endomembrane gene markers. We thank Timothy Migraw at the Florida State University College of Medicine for assistance with confocal imaging. We thank Ruth Didier at the Florida State University Flow Cytometry Facility for assistance with flow cytometry. We thank members of the Zhu laboratory for critical readings of the manuscript and for helpful discussions.
role in viral lytic replication. J Virol 82:1838 –1850. http://dx.doi.org/10 .1128/JVI.02119-07. Kuang E, Fu B, Liang Q, Myoung J, Zhu F. 2011. Phosphorylation of eukaryotic translation initiation factor 4B (EIF4B) by open reading frame 45/p90 ribosomal S6 kinase (ORF45/RSK) signaling axis facilitates protein translation during Kaposi sarcoma-associated herpesvirus (KSHV) lytic replication. J Biol Chem 286:41171– 41182. http://dx.doi.org/10.1074/jbc .M111.280982. Kuang E, Wu F, Zhu F. 2009. Mechanism of sustained activation of ribosomal S6 kinase (RSK) and ERK by Kaposi sarcoma-associated herpesvirus ORF45. J Biol Chem 284:13958 –13968. http://dx.doi.org/10 .1074/jbc.M900025200. Fu B, Kuang E, Li W, Avey D, Li X, Turpin Z, Valdes A, Brulois K, Myoung J, Zhu F. 2015. Activation of p90 ribosomal S6 kinases by ORF45 of Kaposi’s sarcoma-associated herpesvirus is critical for optimal production of infectious viruses. J Virol 89:195–207. http://dx.doi.org/10.1128 /JVI.01937-14. Sathish N, Zhu FX, Yuan Y. 2009. Kaposi’s sarcoma-associated herpesvirus ORF45 interacts with kinesin-2 transporting viral capsid-tegument complexes along microtubules. PLoS Pathog 5:e1000332. http://dx.doi .org/10.1371/journal.ppat.1000332. O’Connor CM, Kedes DH. 2006. Mass spectrometric analyses of purified rhesus monkey rhadinovirus reveal 33 virion-associated proteins. J Virol 80:1574 –1583. http://dx.doi.org/10.1128/JVI.80.3.1574-1583.2006. Bortz E, Whitelegge JP, Jia Q, Zhou ZH, Stewart JP, Wu T-T, Sun R. 2003. Identification of proteins associated with murine gammaherpesvirus 68 virions. J Virol 77:13425–13432. http://dx.doi.org/10.1128/JVI.77 .24.13425-13432.2003. Zhu FX, Chong JM, Wu L, Yuan Y. 2005. Virion proteins of Kaposi’s sarcoma-associated herpesvirus. J Virol 79:800 – 811. http://dx.doi.org/10 .1128/JVI.79.2.800-811.2005. Johannsen E, Luftig M, Chase MR, Weicksel S, Cahir-McFarland E, Illanes D, Sarracino D, Kieff E. 2004. Proteins of purified Epstein-Barr virus. Proc Natl Acad Sci U S A 101:16286 –16291. http://dx.doi.org/10 .1073/pnas.0407320101. Bechtel JT, Winant RC, Ganem D. 2005. Host and viral proteins in the virion of Kaposi’s sarcoma-associated herpesvirus. J Virol 79:4952– 4964. http://dx.doi.org/10.1128/JVI.79.8.4952-4964.2005. Benach J, Wang L, Chen Y, Ho CK, Lee S, Seetharaman J, Xiao R, Acton TB, Montelione GT, Deng H, Sun R, Tong L. 2007. Structural and functional studies of the abundant tegument protein ORF52 from murine gammaherpesvirus 68. J Biol Chem 282:31534 –31541. http://dx.doi.org /10.1074/jbc.M705637200. Bortz E, Wang L, Jia Q, Wu T-T, Whitelegge JP, Deng H, Zhou ZH, Sun R. 2007. Murine gammaherpesvirus 68 ORF52 encodes a tegument protein required for virion morphogenesis in the cytoplasm. J Virol 81: 10137–10150. http://dx.doi.org/10.1128/JVI.01233-06. Wang L, Guo H, Reyes N, Lee S, Bortz E, Guo F, Sun R, Tong L, Deng H. 2012. Distinct domains in ORF52 tegument protein mediate essential functions in murine gammaherpesvirus 68 virion tegumentation and secondary envelopment. J Virol 86:1348 –1357. http://dx.doi.org/10.1128 /JVI.05497-11. Anderson MS, Loftus MS, Kedes DH. 2014. Maturation and vesiclemediated egress of primate gammaherpesvirus rhesus monkey rhadinovirus require inner tegument protein ORF52. J Virol 88:9111–9128. http: //dx.doi.org/10.1128/JVI.01502-14. Duarte M, Wang L, Calderwood MA, Adelmant G, Ohashi M, Roecklein-Canfield J, Marto JA, Hill DE, Deng H, Johannsen E. 2013. An RS motif within the Epstein-Barr virus BLRF2 tegument protein is phosphorylated by SRPK2 and is important for viral replication. PLoS One 8:e53512. http://dx.doi.org/10.1371/journal.pone.0053512. Wu J-J, Li W, Shao Y, Avey D, Fu B, Gillen J, Hand T, Ma S, Liu X, Miley W, Konrad A, Neipel F, Stürzl M, Whitby D, Li H, Zhu F. 2015. Inhibition of cGAS DNA sensing by a herpesvirus virion protein. Cell Host Microbe 18:333–344. http://dx.doi.org/10.1016/j.chom.2015.07.015. Diner BA, Cristea IM. 2015. Blowing off steam: virus inhibition of cGAS DNA sensing. Cell Host Microbe 18:270 –272. http://dx.doi.org/10.1016/j .chom.2015.08.012. Gillen J, Li W, Liang Q, Avey D, Wu J, Wu F, Myoung J, Zhu F. 2015. A survey of the interactome of Kaposi’s sarcoma-associated herpesvirus ORF45 revealed its binding to viral ORF33 and cellular USP7, resulting in stabilization of ORF33 that is required for production of progeny viruses. J Virol 89:4918 – 4931. http://dx.doi.org/10.1128/JVI.02925-14.
Roles of KicGAS/ORF52 in KSHV Replication
June 2016 Volume 90 Number 11
48. Uetz P, Dong Y-A, Zeretzke C, Atzler C, Baiker A, Berger B, Rajagopala SV, Roupelieva M, Rose D, Fossum E, Haas J. 2006. Herpesviral protein networks and their interaction with the human proteome. Science 311: 239 –242. http://dx.doi.org/10.1126/science.1116804. 49. Bechtel JT, Shenk T. 2002. Human cytomegalovirus UL47 tegument protein functions after entry and before immediate-early gene expression. J Virol 76:1043–1050. http://dx.doi.org/10.1128/JVI.76.3.1043 -1050.2002. 50. Liu Y, Cui Z, Zhang Z, Wei H, Zhou Y, Wang M, Zhang X-E. 2009. The tegument protein UL94 of human cytomegalovirus as a binding partner for tegument protein pp28 identified by intracellular imaging. Virology 388:68 –77. http://dx.doi.org/10.1016/j.virol.2009.03.007. 51. Phillips SL, Cygnar D, Thomas A, Bresnahan WA. 2012. Interaction between the human cytomegalovirus tegument proteins UL94 and UL99 is essential for virus replication. J Virol 86:9995–10005. http://dx.doi.org /10.1128/JVI.01078-12. 52. Fossum E, Friedel CC, Rajagopala SV, Titz B, Baiker A, Schmidt T, Kraus T, Stellberger T, Rutenberg C, Suthram S, Bandyopadhyay S, Rose D, von Brunn A, Uhlmann M, Zeretzke C, Dong Y-A, Boulet H, Koegl M, Bailer SM, Koszinowski U, Ideker T, Uetz P, Zimmer R, Haas J. 2009. Evolutionarily conserved herpesviral protein interaction networks. PLoS Pathog 5:e1000570. http://dx.doi.org/10.1371/journal.ppat .1000570. 53. Elliott G, Mouzakitis G, O’Hare P. 1995. VP16 interacts via its activation domain with VP22, a tegument protein of herpes simplex virus, and is relocated to a novel macromolecular assembly in coexpressing cells. J Virol 69:7932–7941. 54. Smibert CA, Popova B, Xiao P, Capone JP, Smiley JR. 1994. Herpes simplex virus VP16 forms a complex with the virion host shutoff protein Vhs. J Virol 68:2339 –2346. 55. Kato K, Daikoku T, Goshima F, Kume H, Yamaki K, Nishiyama Y. 2000. Synthesis, subcellular localization and VP16 interaction of the herpes simplex virus type 2 UL46 gene product. Arch Virol 145:2149 –2162. http://dx.doi.org/10.1007/s007050070045. 56. Ko DH, Cunningham AL, Diefenbach RJ. 2010. The major determinant for addition of tegument protein pUL48 (VP16) to capsids in herpes simplex virus type 1 is the presence of the major tegument protein pUL36 (VP1/2). J Virol 84:1397–1405. http://dx.doi.org/10.1128/JVI.01721-09. 57. Fuchs W, Granzow H, Klupp BG, Kopp M, Mettenleiter TC. 2002. The UL48 tegument protein of pseudorabies virus is critical for intracytoplasmic assembly of infectious virions. J Virol 76:6729 – 6742. http://dx.doi .org/10.1128/JVI.76.13.6729-6742.2002. 58. von Einem J, Schumacher D, O’Callaghan DJ, Osterrieder N. 2006. The ␣-TIF (VP16) homologue (ETIF) of equine herpesvirus 1 is essential for secondary envelopment and virus egress. J Virol 80:2609 –2620. http://dx .doi.org/10.1128/JVI.80.6.2609-2620.2006. 59. Mossman KL, Sherburne R, Lavery C, Duncan J, Smiley JR. 2000. Evidence that herpes simplex virus VP16 is required for viral egress downstream of the initial envelopment event. J Virol 74:6287– 6299. http://dx .doi.org/10.1128/JVI.74.14.6287-6299.2000. 60. To A, Bai Y, Shen A, Gong H, Umamoto S, Lu S, Liu F. 2011. Yeast two hybrid analyses reveal novel binary interactions between human cytomegalovirus-encoded virion proteins. PLoS One 6:e17796. http://dx.doi.org /10.1371/journal.pone.0017796. 61. Phillips SL, Bresnahan WA. 2011. Identification of binary interactions between human cytomegalovirus virion proteins. J Virol 85:440 – 447. http://dx.doi.org/10.1128/JVI.01551-10. 62. Reyda S, Tenzer S, Navarro P, Gebauer W, Saur M, Krauter S, Büscher N, Plachter B. 2014. The tegument protein pp65 of human cytomegalovirus acts as an optional scaffold protein that optimizes protein uploading into viral particles. J Virol 88:9633–9646. http://dx.doi.org/10.1128/JVI .01415-14. 63. Calderwood MA, Venkatesan K, Xing L, Chase MR, Vazquez A, Holthaus AM, Ewence AE, Li N, Hirozane-Kishikawa T, Hill DE, Vidal M, Kieff E, Johannsen E. 2007. Epstein-Barr virus and virus human protein interaction maps. Proc Natl Acad Sci U S A 104:7606 –7611. http: //dx.doi.org/10.1073/pnas.0702332104. 64. Lee S, Salwinski L, Zhang C, Chu D, Sampankanpanich C, Reyes NA, Vangeloff A, Xing F, Li X, Wu T-T, Sahasrabudhe S, Deng H, LaCount DJ, Sun R. 2011. An integrated approach to elucidate the intra-viral and viral-cellular protein interaction networks of a gamma-herpesvirus. PLoS Pathog 7:e1002297. http://dx.doi.org/10.1371/journal.ppat.1002297. 65. Hew K, Dahlroth S-L, Pan LX, Cornvik T, Nordlund P. 2015. VP22 core
Journal of Virology
jvi.asm.org
5341
Downloaded from http://jvi.asm.org/ on April 4, 2019 by guest
30. Wu J-J, Avey D, Li W, Gillen J, Fu B, Miley W, Whitby D, Zhu F. 2015. ORF33 and ORF38 of Kaposi’s sarcoma-associated herpesvirus interact and are required for optimal production of infectious progeny viruses. J Virol 90:1741–1756. http://dx.doi.org/10.1128/JVI.02738-15. 31. Tischer BK, Smith G, Osterrieder N. 2010. En passant mutagenesis: a two step markerless Red recombination system. Methods Mol Biol 634:421– 430. http://dx.doi.org/10.1007/978-1-60761-652-8_30. 32. Tischer BK, von Einem J, Kaufer B, Osterrieder N. 2006. Two-step Red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques 40:191–197. http: //dx.doi.org/10.2144/000112096. 33. Zhu FX, Li X, Zhou F, Gao S-J, Yuan Y. 2006. Functional characterization of Kaposi’s sarcoma-associated herpesvirus ORF45 by bacterial artificial chromosome-based mutagenesis. J Virol 80:12187–12196. http://dx .doi.org/10.1128/JVI.01275-06. 34. Krishnan HH, Naranatt PP, Smith MS, Zeng L, Bloomer C, Chandran B. 2004. Concurrent expression of latent and a limited number of lytic genes with immune modulation and antiapoptotic function by Kaposi’s sarcoma-associated herpesvirus early during infection of primary endothelial and fibroblast cells and subsequent decline of lytic gene expression. J Virol 78:3601–3620. http://dx.doi.org/10.1128/JVI .78.7.3601-3620.2004. 35. Avey D, Tepper S, Li W, Turpin Z, Zhu F. 2015. Phosphoproteomic analysis of KSHV-infected cells reveals roles of ORF45-activated RSK during lytic replication. PLoS Pathog 11:e1004993. http://dx.doi.org/10.1371 /journal.ppat.1004993. 36. Leighton IA, Dalby KN, Barry Caudwell F, Cohen PTW, Cohen P. 1995. Comparison of the specificities of p70 S6 kinase and MAPKAP kinase-1 identifies a relatively specific substrate for p70 S6 kinase: the N-terminal kinase domain of MAPKAP kinase-1 is essential for peptide phosphorylation. FEBS Lett 375:289 –293. http://dx.doi.org/10 .1016/0014-5793(95)01170-J. 37. Sathish N, Wang X, Yuan Y. 2012. Tegument proteins of Kaposi’s sarcoma-associated herpesvirus and related gamma-herpesviruses. Front Microbiol 3:98. http://dx.doi.org/10.3389/fmicb.2012.00098. 38. Rozen R, Sathish N, Li Y, Yuan Y. 2008. Virion-wide protein interactions of Kaposi’s sarcoma-associated herpesvirus. J Virol 82:4742– 4750. http: //dx.doi.org/10.1128/JVI.02745-07. 39. Sander G, Konrad A, Thurau M, Wies E, Leubert R, Kremmer E, Dinkel H, Schulz T, Neipel F, Stürzl M. 2008. Intracellular localization map of human herpesvirus 8 proteins. J Virol 82:1908 –1922. http://dx.doi.org/10 .1128/JVI.01716-07. 40. Zhu FX, Yuan Y. 2003. The ORF45 protein of Kaposi’s sarcomaassociated herpesvirus is associated with purified virions. J Virol 77:4221– 4230. http://dx.doi.org/10.1128/JVI.77.7.4221-4230.2003. 41. Shen S, Jia X, Guo H, Deng H. 2015. Gammaherpesvirus tegument protein ORF33 is associated with intranuclear capsids at an early stage of the tegumentation process. J Virol 89:5288 –5297. http://dx.doi.org/10 .1128/JVI.00079-15. 42. Brulois KF, Chang H, Lee AS-Y, Ensser A, Wong L-Y, Toth Z, Lee SH, Lee H-R, Myoung J, Ganem D, Oh T-K, Kim JF, Gao S-J, Jung JU. 2012. Construction and manipulation of a new Kaposi’s sarcoma-associated herpesvirus bacterial artificial chromosome clone. J Virol 86:9708 –9720. http://dx.doi.org/10.1128/JVI.01019-12. 43. Li X, Zhu F. 2009. Identification of the nuclear export and adjacent nuclear localization signals for ORF45 of Kaposi’s sarcoma-associated herpesvirus. J Virol 83:2531–2539. http://dx.doi.org/10.1128/JVI .02209-08. 44. Elliott G, O’Hare P. 1998. Herpes simplex virus type 1 tegument protein VP22 induces the stabilization and hyperacetylation of microtubules. J Virol 72:6448 – 6455. 45. Kotsakis A, Pomeranz LE, Blouin A, Blaho JA. 2001. Microtubule reorganization during herpes simplex virus type 1 infection facilitates the nuclear localization of VP22, a major virion tegument protein. J Virol 75:8697– 8711. http://dx.doi.org/10.1128/JVI.75.18.8697-8711.2001. 46. Vittone V, Diefenbach E, Triffett D, Douglas MW, Cunningham AL, Diefenbach RJ. 2005. Determination of interactions between tegument proteins of herpes simplex virus type 1. J Virol 79:9566 –9571. http://dx .doi.org/10.1128/JVI.79.15.9566-9571.2005. 47. Klupp BG, Fuchs W, Granzow H, Nixdorf R, Mettenleiter TC. 2002. Pseudorabies virus UL36 tegument protein physically interacts with the UL37 protein. J Virol 76:3065–3071. http://dx.doi.org/10.1128/JVI.76.6 .3065-3071.2002.
Li et al.
66.
67.
68. 69. 70.
5342
jvi.asm.org
71.
72.
73.
74.
type 1 facilitates viral spread in cultured cells and the mouse cornea. J Virol 80:8664 – 8675. http://dx.doi.org/10.1128/JVI.00498-06. Potel C, Elliott G. 2005. Phosphorylation of the herpes simplex virus tegument protein VP22 has no effect on incorporation of VP22 into the virus but is involved in optimal expression and virion packaging of ICP0. J Virol 79:14057–14068. http://dx.doi.org/10.1128/JVI.79.22 .14057-14068.2005. Maringer K, Stylianou J, Elliott G. 2012. A network of protein interactions around the herpes simplex virus tegument protein VP22. J Virol 86:12971–12982. http://dx.doi.org/10.1128/JVI.01913-12. van Leeuwen H, Okuwaki M, Hong R, Chakravarti D, Nagata K, O’Hare P. 2003. Herpes simplex virus type 1 tegument protein VP22 interacts with TAF-I proteins and inhibits nucleosome assembly but not regulation of histone acetylation by INHAT. J Gen Virol 84(Pt 9):2501– 2510. http://dx.doi.org/10.1099/vir.0.19326-0. Pomeranz LE, Blaho JA. 2000. Assembly of infectious herpes simplex virus type 1 virions in the absence of full-length VP22. J Virol 74:10041– 10054. http://dx.doi.org/10.1128/JVI.74.21.10041-10054.2000.
Journal of Virology
June 2016 Volume 90 Number 11
Downloaded from http://jvi.asm.org/ on April 4, 2019 by guest
domain from herpes simplex virus 1 reveals a surprising structural conservation in both the Alpha- and Gammaherpesvirinae subfamilies. J Gen Virol 96:1436 –1445. http://dx.doi.org/10.1099/vir.0.000078. Pellett PE, Roizman B. 2007. Herpesviridae: a brief introduction, p 2480 – 2499. In Knipe DM, Howley PM, Griffin DE, Lamb RA, Martin MA, Roizman B, Straus SE (ed), Fields virology 5th ed, vol 2. Lippincott Williams & Wilkins, Philadelphia, PA. Knopf K-W, Kaerner HC. 1980. Virus-specific basic phosphoproteins associated with herpes simplex virus type 1 (HSV-1) particles and the chromatin of HSV-1-infected cells. J Gen Virol 46:405– 414. http://dx.doi .org/10.1099/0022-1317-46-2-405. Elliott G, O’Reilly D, O’Hare P. 1996. Phosphorylation of the herpes simplex virus type 1 tegument protein VP22. Virology 226:140 –145. http: //dx.doi.org/10.1006/viro.1996.0638. Brignati MJ, Loomis JS, Wills JW, Courtney RJ. 2003. Membrane association of VP22, a herpes simplex virus type 1 tegument protein. J Virol 77:4888 – 4898. http://dx.doi.org/10.1128/JVI.77.8.4888-4898.2003. Duffy C, LaVail JH, Tauscher AN, Wills EG, Blaho JA, Baines JD. 2006. Characterization of a UL49-null mutant: VP22 of herpes simplex virus