Cent. Eur. J. Biol.• 5(5) • 2010 • 664-673 DOI: 10.2478/s11535-010-0055-8
Central European Journal of Biology
Molecular identification of diazotroph microbial consortia in mountain soil Research Article
Rahela Carpa1,*, Anca Butiuc-Keul2, Cristina Dobrotă1, Vasile Muntean2 Department of Experimental Biology, Faculty of Biology and Geology, Institute of Technology, Babeş Bolyai University, 400084 Cluj-Napoca, Romania
1
Department of Experimental Biology, Faculty of Biology and Geology, Babeş Bolyai University, 400084 Cluj-Napoca, Romania
2
Received 29 December 2009; Accepted 07 May 2010
Abstract: N itrogen fixing microbial consortia from soil samples taken from five altitudinal vegetation zones (alpine, subalpine, coniferous, beech, Maleia flood plain) of Parâng Massif, Romania, were isolated and identified. Molecular characterisation of nitrogen fixing consortia was carried out by PCR and nested PCR with 7 primer sets specific to nifH genes. All nifH genes are specific to nitrogen fixation and are found within phylogenetically related organisms which have the nitrogenase enzyme complex. These molecular studies allowed the assessment of nifH gene diversity within these nitrogen fixing microbial consortia from different type of soils. At high altitude, a consortium of nitrogen fixing bacteria dominated by Azotobacter chroococcum and Azospirillum brasilense was found. Clostridium, Rhizobiales, Herbaspirillum, Frankia species were also found in different rations depending on the altitudinal vegetation zone. Keywords: Azotobacter chroococcum • Diazotroph consortium • Mountain soil • PCR © Versita Sp. z o.o.
1. Introduction Biological fixation of molecular nitrogen is carried out by diazotroph microorganisms. This complex process during which molecular nitrogen is converted to ammonia, involves a specific enzyme complex and a large quantity of ATP. Nitrogen conversion to ammonia is catalyzed by nitrogenase enzyme complex [1]. Generally, the enzymes involved in N2 reduction are Mo dependent, but there are also other nitrogenases where Mo from Fe-Mo cofactor is replaced by Fe (encoded by Anf gene) or vanadium (encoded by Vnf gene). Anf and Vnf systems have a lower N2 reduction activity as compared to Mo dependent systems [2,3]. The most common nitrogenase form in nature is the molybden dependent one. This enzyme is formed out of two metal protein components: dinitrogenase (MoFeprotein, component I) and dinitrogenase-reductase (Fe-protein, component II). Component I contains the
active site for nitrogen reduction and is formed out of two heterodimers (P-cluster and MoFe cofactor), while component II is a homodimer which couples ATP hydrolysis with electron transfer [4,5]. This system is encoded by nifHDK genes. The conventional system is synthesized when nitrogen lacks and molybden is available for the active metalic site. The small component, ferroprotein, is encoded by nifH gene while the big component, MoFe-protein, is encoded by nifD and nifK genes. All the nif genes are specific for nitrogen fixation and are found at phylogenetically related organisms which have the nitrogenase system. In order for Azotobacter chroococcum to perform the fixation process, 15 nif (nitrogen fixing) genes are needed. These are grouped in genome as follows: nifH, nifD, nifK, nifT, nifY, nifE, nifN, nifX, nifU, nifS, nifV, nifW, nifYZ, nifM and nifF [2,6]. All these genes perform important functions within the nitrogenase complex. Other 12 genes or ORFs, whose expression is supposed to be involved in Azotobacter specific nif
* E-mail:
[email protected]
664
Unauthenticated Download Date | 4/14/18 1:09 PM
Molecular identification of diazotroph microbial consortia in mountain soil
regulation, were also identified in the same cluster [7]. Out of this group nifH, nifD and nifK genes are structural genes. nifH gene is the marker gene which codes dinitrogenase-reductase. NifM protein is an important component of nitrogenase and no other protein with similar structure is able to fufill its role. In addition to electron transfer, NifH protein performs three more functions. It is involved, along with another seven nif genes, in MoFe cofactor biosynthesis [8,9]. It is also involved in alternative nitrogenase systems regulation. NifH protein participates in apodinitrogenase ripening. Apodinitrogenase is a dinitrogenase which lacks FeMo cofactor but contains the cluster P [10]. The nifH gene of Azotobacter vinelandii is 873 bp long. Due to the vast phylogenetic differences among the nitrogen fixing microorganisms, the nifH genes sequences are widely diversified. For example, the DNA sequences encoding preserved protein regions may differ due to the codon redundance. The design of universal nifH primer requires a high DNA sequence degenerative level and can determine a reduced specificity during PCR amplification [11]. However, by using diverse amplification essays the complexity of nitrogen fixing microorganisms from a certain habitat can be assessed. Considering these reasons we developed an experimental design concerning PCR identification and detection of nifH genes responsible for nitrogen fixation at nitrogen fixing bacterial consortia isolated from mountain soils. This analysis allows the rapid identification of the nitrogen fixing potential in different soils by mixed consortia of microorganisms in each soil type.
2. Experimental Procedures 2.1 Microorganisms
The diazotroph strains used in this study were isolated from soil samples from the altitudinal vegetation zones of North-Western Parâng Mountains, România (alpine, subalpine, coniferous, beech and Maleia flood plain). The standard Azotobacter chroococcum 2286T – DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH) strain was used as a control [12,13]. From the soil samples diazotroph consortia were isolated on solid medium specific to Azotobacter sp. Because the specificity of the media is not absolute, the growth of other diazotroph species can occur. Thus, the cultures obtained on these media represent bacterial consortia specific to each altitudinal vegetation zone. An autolysed bacterial suspension in UP/UV water was made from each culture and then analysed by PCR
and nested PCR. Accordingly, we have used more types of primers in order to determine the presence of different nitrogen fixing groups in each consortium. The presence of nifH genes at the nitrogen fixing bacterial consortia isolated from mountain soils and cultivated on specific medium [14] was proved by PCR and nested PCR. The nifH gene is the marker gene which codes for nitrogenase, the key enzyme in nitrogen fixation.
2.2 DNA amplification
In order to evaluate the nitrogen fixing consortia from different altitudinal vegetation zones, the specificity and sensitivity of nifH genes (genes encoding nitrogenase reductase) detection was analysed [15]. Seven primers, specific to well preserved regions of nifH genes, were used. Because many nitrogen fixing species are present, degenerate primers were also used. The length and degeneracy of the primers were suited for simultaneous use in a nested PCR, and the primers were chosen in order to correspond to all the nifH control sequences with 14 nucleotides at their 3’ ends. These primers were initially used by Zehr and McReynolds in 1989 and Ueda et al., in 1995 [16,17]. The position of primers with 20 nucleotides in the nif cluster was determined related to nifH encoding sequence from Azotobacter vinelandii. This gene has 873 bp (sequence positions 1240 to 2112 of the nif gene cluster) [18]. DNA sequence degeneracies were indicated by using the International Union of Pure and Applied Chemistry conventions, as follows: R=A/G; Y=C/T; W=A/T; V=A/C/G; B=C/G/T; M=A/C; S=C/G; K=G/T; N=A/C/G/T [19,20]. Inosine (I) was used to reduce the degeneracy of the primers by replacing fourfold degenerate positions (N) in the 5’ portions [17,21,22]. The 7 primer sets are specific to nifH genes and they come from Eurogentec SA. The sequences are rendered in Table 1. These were noted as follows: primer 1 - nifH univ, is universal; primer 2 - nifH g1, having specificity for Azotobacter chroococcum; primer 3 - nifH c1, with specificity for Clostridium; primer 4 - nifH 1b with specificity for Herbaspirillum seropedicae; primer 5 - nifH a2, with specificity for Azospirillum brasilense; primer 6 - nifH f1, with specificity for Frankia; primer 7 nifH a1, with specificity for Rhizobiales. The PCR amplification protocol of nifH genes fragments comprised the following phases: an autolysed bacterial suspension in water UV/UP (75 µl) was obtained from the analyzed cultures; the gene of interest was amplified by PCR. The nucleotide fragment located in positions 19 to 482 (464 bp) was amplified by PCR and the one in positions 112 to 482 (371 bp) was amplified by nested PCR. The reaction mix contains: 25 ng DNA, 1x Taq polymerase buffer, 0.75 U
665
Unauthenticated Download Date | 4/14/18 1:09 PM
R. Carpa et al.
SEQUENCE (DEGENERACY) OF PRIMER
nifH-univ
Fw-A GCIWTITAYGGNAARGGNGG(128)
Tm
Tm
Fw-B (nested)
°C
°C
56
Rev
Tm °C
AMPLICON (bp)
GCRTAIABNGCCATCATYTCc (48)
56
460
nifH-g1
GGTTGTGACCCGAAAGCTGA (0)
62
GCGTACATGGCCATCATCTC (0)
62
370
nifH-c1
GGWTGTGATCCWAARGCVGA (24)
60
GCATAYASKSCCATCATYTC (32)
60
370
nifH-b1
GGCTGCGATCCCAAGGCTGA (0)
66
GCGTACATGGCCATCATCTC (0)
62
370
nifH-a2
GGCTGCGATCCGAAGGCCGA (0)
68
GCGTAGAGCGCCATCATCTC (0)
64
370
nifH-f1
GCSTTCTACGGMAAGGGTGG (4)
64
GCGTACATSGCCATCATCTC (2)
62
460
nifH-a1
GCRTTYTACGGYAARGGSGG (32)
64
GCATAGAGCGCCATCATCTC (0)
62
460
Table 1.
The sequences of primer sets used in PCR and nested PCR analyses.
Taq polymerase, 1.5 mM MgCl2, 0.4 µM each primer, 0.2mM dNTP and UP/UV water to a final reaction volume of 25 µl. Two repetitions were performed. The amplification was carried out with a PalmCycler termocycler, Corbet. For all the six bacterial strains, the first experiments consisted of PCR amplification with the following primers: primer 1 (nifH universal), primer 6 (nifH f1), primer 7 (nifH a1). For specificity, fragments were analysed with specific primers, by a nested PCR approach based on target sites. The nested PCR amplifications for all the studied strains were carried out with the following degenerate primers: primer 2 (nifH g1), primer 3 (nifH c1), primer 4 (nifH b1), primer 5 (nifH a2).
2.3 Detection of isolated fragments
After amplification, the samples were analyzed by electrophoresis in Ultra Pure 1.5% (Fermentas) agarose gels containing 500 ng/µl ethidium bromide. The quality and quantity of PCR and nested PCR amplification products were determined by UV visualization due to ethidium bromide added to the gel. The variability being distinguished based on presence or absence of a specific amplification product.
3. Results and Discussion From the soil samples originating from the 5 vegetation zones, cultures (bacterial consortia) were isolated on solid media. From these, as well as the Azotobacter chroococcum standard strain, autolysed bacterial suspensions were prepared in order to be analysed by PCR and nested PCR. The bacterial consortia originate
from soils on which physico-chemical characterisation and soil type assessment (specific to each mountain vegetation zone) was established before [23]. The aim of these PCR analyses was to identify the main diazotroph groups which compose these consortia, specific for each altitudinal vegetation zone. Figure 1a shows that at universal primer 1 (nifH univ) amplification obtained single bands of the expected dimension (about 460 bp) of nifH gene fragment. This happened for the strains originating from the acid Umbrisol of alpine vegetation zone, the acid Spodisol of the coniferous vegetation zone, and at the strains isolated from the very mildly acid soil of the flood plain. These results indicate that the Azotobacter chroococcum species may be found in the soils from those altitudinal vegetation zones. Amplification with primer 2 (nifH g1) was carried out by nested PCR. The nested PCR carried out with degenerate primers was also tested with nifH gene DNA fragments This method provided nifH gene fragments from pure cultures of 23 reference strains representing 14 Proteobacterial genera and two genera of Gram positive bacteria [24,25]. Using this technique, bands were found only at the control strain and at the samples from coniferous and beech vegetation zones. 370 bp bands occured, indicating the presence of Azotobacter chroococcum in these samples. By comparing with the standard Azotobacter chroococcum strain it was confirmed that these altitudinal vegetation zones are populated with Azotobacter chroococcum, assuming that primer 2 is targeting this species. Amplification with primer 3 (nifH c1) was also carried out through nested PCR and emphasized 370 bp bands characterizing the diazotroph consortium 666
Unauthenticated Download Date | 4/14/18 1:09 PM
Molecular identification of diazotroph microbial consortia in mountain soil
a
b
c
d
Figure 1. n ifH
gene amplification with primers 1 and 2 (a), with primers 3 and 4 (b), with primers 5 and 6 (c) and with primer 7 (d) at the nitrogen fixing species from different mountain soil samples: 1 = alpine, 2 = subalpine, 3 = coniferous, 4 = beech, 5 = flood plain, C (control) = A. chroococcum; m = marker O’Range Ruler 100 bp DNA Ladder, Fermentas, 0.5 µg/µl. Separation in 1.5% agarose gel stained by ethidium bromide. The melting temperature was the one indicated in Table 1.
from the subalpine acid Spodisol and from the Protisol of Maleia flood plain (Figure 1b). This primer is targeting the Clostridium species, which are obligate anaerobes and sporulate [26]. Our results indicate their presence in these altitudinal vegetation zones where the oxygen level is low due to the altitudinal zone and high humidity. By amplification with primer 4 (nifH b1), a primer which targets Herbaspirillum sp., single bands of expected dimension were obtained at
the samples from the alpine and subalpine altitudinal vegetation zones and from Maleia flood plain (Figure 1b). In these altitudinal vegetation zones, the Poaceae species are abundant, representing the favourite hosts of these species [27]. Nested PCR amplification carried out with primer 5 (nifH a2), specific for Azospirillum brasilense, produced specific bands for the samples from the alpine soil, the soil of the conifers and also of the soil
667
Unauthenticated Download Date | 4/14/18 1:09 PM
R. Carpa et al.
from beech vegetation zone and from the flood plain (Figure 1c). In these altitudinal vegetation zones, the vegetation is abundant (considering the climatic conditions) and Azospirillum brasilense populates and interacts positively with the roots of the plants [28]. The formation of bands at the samples from the coniferous zone is surprising but not unreasonable because the herbaceous vegetation is less developed due to the very acid pH. Naturally, at the standard control strain, no bands were obtained because this primer targets Azospirillum brasilense. It is surprising that the PCR amplification with primer 6 (nifH f1), which targets the diazotroph actinobacteria Frankia, 460 bp bands were obtained at the strains from the alpine altitudinal vegetation zone as well as from the coniferous zone (Figure 1c). In the alpine zone of Parâng Mountains, the most likely explanation is given by the presence of Frankia genus bacteria in the nodules of Dryas octopetala. Some references indicated that other species of Dryas genus form nodules with Frankia [29,30]. The symbiosis between Dryas octopetala and frankia was not recorded but the amplification pattern could suggest a relationship. Identification in further studies of Frankia symbiosis at this species would represent a scientific novelty. The presence of bands in the coniferous vegetation zone may be the result of nonsymbiotic strains of Frankia, because no symbiosis between plant and actinobacteria was noticed in this place and it is known that these actinobacteria can also live free [31]. Using PCR amplification by primer 7 (nifH a1) (which targets the species of Rhizobiales), single 460 bp bands were obtained at the strains from the subalpine zone
(Figure 1d). This presence is due to Rhizobiales bacteria forming symbiosis with some clover species (Trifollium repens, trifollium alpestre) and other Fabaceae species which populate this zone. The presence/absence of different groups of the bacterial nitrogen fixing consortia in the studied habitats was recorded by PCR and nested PCR amplifications (Table 2). Because the primer 1 is universal we may conclude that in the alpine vegetation zone, the coniferous zone and in the flood plain, nitrogen fixing species of Azotobacter genus are present. Amplification with primer 2, specific to Azotobacter chroococcum species, generated singular bands for the standard strain. We also found specific bands for the strains of coniferous and beech zones, indicating the presence of Azotobacter chroococcum in these two altitudinal vegetation zones. Clostridium was part of the bacterial nitrogen fixing consortium (proved with primer 3, nifH c1) and appears to be present in the subalpine zone and the flood plain. The presence in these habitats is connected to the characteristics of the zones (high humidity and low aeration) and related to their physiological specificity: sporulant, anaerobic and free bacteria [32]. Another diazotroph species was Herbaspirillum seropedicae highlighted with the specific primer nifH b1; single bands were obtained through amplification for alpine, subalpine and food plain zones. When primer 5 (nifH f1) was used for amplification, single 370 bp bands were formed at the bacterial strains from the alpine, coniferous, beech vegetation zones and from the flood plain, indicating that these altitudinal Primer
Strains from
1 Alpine 2 Subalpine 3 Coniferous 4 Beech 5 Food plain C Control
Table 2.
1
2
3
4
5
6
7
(nifH univ)
(nifH g1)
(nifH c1)
(nifH b1)
(nifH a2)
(nifH f1)
(nifH a1)
universal
Azotobacter
Clostridium
Herbaspirillum
Azospirillum
Frankia
Rhizobiales
+
-
-
+
+
+
-
-
-
+
+
-
-
+
+
+
-
-
+
+
-
-
+
-
-
+
-
-
+
-
+
+
+
-
-
-
+
-
-
-
-
-
PCR and nested PCR amplification.
668
Unauthenticated Download Date | 4/14/18 1:09 PM
Molecular identification of diazotroph microbial consortia in mountain soil
and nested PCR was performed. We considered that a higher DNA quantity was necessary and a reamplification was carried out using as a matrix the PCR and nested PCR products from the amplifications presented above. For this reamplification the reaction conditions were modified. Thus, the number of cycles was changed and the melting temperature was increased with 4 degrees above the temperatures presented in Table 1. In Figure 2a it can be noticed that by amplification with primer 1 (nifH univ) single bands were obtained (the expected nifH gene fragment dimension of 460 bp) at
vegetation zones sheltered another species of the nitrogen fixing consortium: Azospirillum brasilense. These bacteria populate the rhizosphere of herbaceous plants fixing the molecular nitrogen [33,34]. The results obtained with primers 6 and 7 were also strictly correlated to the vegetation of the zones where individual bands appear. In order to obtain more conclusive results regarding the amplification specificity and the high precision detection of nifH gene from the diazotroph strains isolated from the mountain soils, a reamplification through PCR
a
b
c
Figure 2.
nifH gene amplification with primers 1 and 2 (a), with primers 3 and 5 (b), with primers 6 and 7 (c) at the nitrogen fixing species from different mountain soil samples: 1 = alpine, 2 = subalpine, 3 = coniferous, 4 = beech, 5 = flood plain, C (control) = A. chroococcum; m = marker O’Range Ruler 100 bp DNA Ladder, Fermentas, 0.5 µg/µl. Separation in 1.5% agarose gel stained by ethidium bromide. The melting temperature was raised 4 degrees above the one indicated in Table 1.
669
Unauthenticated Download Date | 4/14/18 1:09 PM
R. Carpa et al.
the strains from the alpine altitudinal vegetation zone, the coniferous one and the flood plain. For primer 2 (nifH g1), reamplification with products resulted from nested PCR with more cycles, individual bands for the strains from the alpine, subalpine and coniferous zones and from the control were generated. These individual bands showed the presence of Azotobacter chroococcum in these zones (Figure 2a). Reamplifying with primer 3 (nifH c1) and with products resulted from nested PCR, showed specific 370 bp bands for the strains coming from the mildly acid Cambisol of the beech zone and for the strains isolated from the Protisol of Maleia flood plain (Figure 2b). These primers target Clostridium, species which can be found in the two zones where specific conditions occured (high humidity and anaerobiotic conditions). For the control strain and for the strains from alpine, subalpine and coniferous altitudinal vegetation zones no single 370 bp bands were formed. By reamplification with primer 4 (nifH b1) with products from nested PCR with more cycles, no singular bands of expected dimension were obtained at any of the five mountain strains. Primer 4 is targeting Herbaspirillum seropedicae, which is considered an endophyte diazotroph species [19]. At reamplification with primer 5 (nifH a2), single bands specific to the fragment of interest at the strains from the alpine, coniferous and beech zones (Figure 2b) were recorded. This primer targets the nitrogen fixing Azospirillum brasilense. In the alpine vegetation zone and also in the beech zone the herbaceous vegetation was abundant, and Azospirillum populated their rhizosphere, so the presence of these diazotrophs in these altitudinal vegetation zones can be explained.
The presence of singular bands at the strains from the coniferous vegetation zone showed the presence of Azospirillum strains in this altitudinal vegetation zone. Although the herbaceous layer was less developed it was proved that Azospirillum could also live in this habitat [35,36]. Figure 2c shows the reamplification with primers 6 and 7 and with PCR products. When reamplifying with PCR products with primer 6 (nifH f1), which targets the diazotroph actinobacteria Frankia, individual 460 bp bands were obtained, at the strains coming from the alpine and coniferous zones. At reamplification with PCR products and with primer 7 (nifH a1), primer aiming Rhizobiales, singular bands were obtained only at the strains from the beech zone. This may be explained by the existence of Fabaceae as clover (Trifollium repens) and bird’s foot trefoil (Lotus corniculatus) in the vegetation zone. The variability of different groups of the diazotroph consortium in the habitats was established by reamplifying, using more cycles in PCR, and nested PCR products. This variability was highlighted based on the presence or absence of a specific amplification product (Table 3). It can be seen that PCR and nested PCR reamplification with primers 1 and 2 which detect Azotobacter chroococcum species determined the emergence of single bands at almost all the strains isolated from the vegetation zones of Parâng Mountains, except the samples from the beech zone. This means that Azotobacter chroococcum occured in the soils from most of the vegetation zones. Clostridium species can be found in the beech zone and in the Maleia flood plain (proved with primer 3) where there are anaerobic conditions. In the beech Primers
Strains from
1 Alpine 2 Subalpine 3 Coniferous 4 Beech 5 Food plain C Control
Table 3.
1
2
3
4
5
6
7
(nifH univ)
(nifH g1)
(nifH c1)
(nifH 1b)
(nifH a2)
(nifH f1)
(nifH a1)
universal
Azotobacter
Clostridium
Herbaspirillum
Azospirillum
Frankia
Rhizobiales
+
+
-
-
+
+
-
-
+
-
-
-
-
-
+
+
-
-
+
+
-
-
-
+
-
+
-
+
+
-
+
-
-
-
-
+
+
-
-
-
-
-
Amplification with PCR and nested PCR products.
670
Unauthenticated Download Date | 4/14/18 1:09 PM
Molecular identification of diazotroph microbial consortia in mountain soil
zone the leaf layer is thick enough to create almost anaerobic conditions specific to Clostridium genus. The presence of bands at the strains from Maleia flood plain is explained by the wet character of this zone, which determines a less oxygenated living environment, favourable to Clostridium genus. When reamplifying with primer 4 (nifH b1) no singular bands of expected dimension were obtained in the five mountain strains. When reamplifying with primer 5 (nifH a2), primer targeting the diazotroph bacteria Azospirillum brasilense, single bands were obtained at the strains from alpine, coniferous and beech altitudinal vegetation zones showing the presence of these species in the mentioned zones. The presence of single bands when reamplifying with primer 6 sustains the assumption that a symbiosis between Frankia and Dryas octopetala is established in the alpine zone. As mentioned above, identifying nodules containing Frankia at Dryas octopetala would be a novelty. Frankia nodules being found only at Dryas drummondii [29]. In the coniferous altitudinal vegetation zone, the presence of specific bands was explained by nonsymbiotic frankia strains, being known that these can be found in the soil on which spruce (Picea abies) grows [37].
4. Conclusions The genetic heterogenity of nitrogen fixing microorganisms, in the mountain ecosystems, was highlighted by amplifying with different primers which target the nif gene. In the alpine altitudinal vegetation zone (1) the nitrogen fixing consortium is prevailingly composed of species of Azotobacter and Azospirillum genera, but bacteria from Frankia and Herbaspirillum species may also be found. In the subalpine altitudinal vegetation zone (2) the consortium is composed of free fixing bacteria of
Azotobacter genus, anaerobe sporulant Clostridium species, Azospirillum and Herbaspirillum species and symbiotic diazotrophs of Rhizobiales. In the coniferous altitudinal vegetation zone (3), characterised by very high soil acidity, the existence of a bacterial consortium which includes nitrogen fixing bacteria as Azotobacter, Azospirillum and Frankia was noticed. No data attesting that these species would develop in such acid environment was recorded in literature. Further confirmations considering this aspect would be of complete novelty. In the beech altitudinal vegetation zone (4), the Azospirillum species have a greater influence in the nitrogen fixing consortium. Beside these, species of Azotobacter, Clostridium and Rhizobiales were also noticed. In the Maleia flood plain (5) the bacterial consortium is composed of several nitrogen fixing bacteria such as Azotobacter, Clostridium, Herbaspirillum and Azospirillum. Using PCR techniques, the detection of nitrogen fixing species was possible without prior bacterial DNA isolation. This is a remarkable advantage, which make possible the rapid characterization of nitrogen fixing consortium from soil samples. It was noticed that a change in reaction conditions was not always appropriate, as in the case of primer 4. The detection protocol was improved by using amplicons in nested PCR, which are enhancing both sensibility and specificity of nifH amplification. Thus, a high specificity detection of nifH gene in the DNA of bacterial suspensions from mountain soils was obtained.
Acknowledgements This work was financially supported by grants CNCSIS PN II TD - 337 – 2007/ 2008, representing government funds offered by The National Council of Scientific Research from Superior Education from Romania.
References [1] Howard K.S., McLean P.A., Hansen F.B., Lemley P.V., Koblan K.S., Orme Johnson W.H., Klebsiella pneumoniae nifM gene product is required for stabilization and activation of nitrogenase iron protein in Escherichia coli, J. Biol. Chem., 1996, 261, 772-778 [2] Rubio L.M., Ludden P.W., Maturation of nitrogenase: a biochemical puzzle, J. Bacteriol., 2005, 187, 405-414
[3] Ying Z., Bian S.M., Zhou H.N., Huang J.F., Diversity of nitrogenase systems in diazotrophs, J. Integr. Plant Biol., 2006, 48, 745-755 [4] Curatti L., Brown C.S., Ludden P.W., Rubio L.M., Genes required for rapid expression of nitrogenase activity in Azotobacter vinelandii, Proc. Natl. Acad. Sci. USA, 2005, 102, 6291-6296 [5] Kim J., Rees D.C., Crystallographic structure and functional implications of the nitrogenase
671
Unauthenticated Download Date | 4/14/18 1:09 PM
R. Carpa et al.
molybdenum-iron protein from Azotobacter vinelandii, Nature, 1992, 360, 553-560 [6] Jacobson M.R., Brigle K.E., Bennett L.T., Setterquist R.A., Wilson M.S., Cash V.L., et al., Physical and genetic map of the major nif gene cluster from Azotobacter vinelandii, J. Bacteriol., 1989, 171, 1017-1027 [7] Dean D.R., Bolin J.T., Zheng L., Nitrogenase metalloclusters: Structures, organization and synthesis, J. Bacteriol., 1993, 175, 6737-6744 [8] Aquilanti L., Mannazzu I., Papa R., Cavalca L., Clementi F., Amplified ribosomal DNA restriction analysis for the characterization of Azotobacteraceae: a contribution to the study of these free living nitrogen fixing bacteria, J. Microbiol. Methods, 2004, 57, 197-206 [9] Lei S., Lakshmidevi P., Suh M.H., Identification of a second site compensatory mutation in the Fe-protein that allows diazotrophic growth of Azotobacter vinelandii UW97, FEBS Lett., 2000, 478, 192-196 [10] Pryia R., Shah V.K., Ludden P.W., ApoNifH functions in iron-molybdenum cofactor syntesis and apodinitrogenase maturation, Proc. Natl. Acad. Sci. USA, 1997, 94, 11250-11255 [11] Kirshtein J.D., Paerl H.W., Zehr J.P., Amplification, cloning and sequencing of a nifH segment from aquatic microorganisms and natural communities, Appl. Environ. Microbiol., 1991, 57, 2645-2650 [12] Skerman V.B.D., McGowan V., Sneath P.H.A., Approved Lists of Bacterial Names, DSMZ, Int. J.Syst. Bacteriol., 1980, 30, 225-420 [13] Thompson J.P., Skerman V.B.D., Azotobacteraceae – the taxonomy and ecology of the aerobic nitrogenfixing bacteria, DSMZ, Academic Press, London, 1979 [14] Atlas R.M., Handbook of Microbiological Media, 3rd Ed., CRC Press, New York, 2004 [15] Ohkuma M., Noda S., Usami R., Horikosi K., Kudo T., Diversity of nitrogen fixation genes in the symbiotic intestinal microflora of the termite Reticulitermes speratus, Appl. Environ. Microbiol., 1996, 62, 2747-2752 [16] Zehr J.P., McReynolds L.A., Use of degenerate oligonucleotides for amplification of the nifH gene from the marine cyanobacterium Trichodesmium thiebautii, Appl. Environ. Microbiol., 1989, 55, 2522-2526 [17] Ueda T., Suga Y., Yahiro N., Matsuguchi T., Remarkable N2-fixing bacterial diversity detected in rice roots by molecular evolutionary analysis of nifH gene sequences, J. Bacteriol., 1995, 177, 1414-1417
[18] Widmer F., Shaffer B.T., Porteous L.A., Seidler R.J., Analysis of nifH gene pool complexity in soil and litter at a Douglas Fir forest site in the Oregon Cascade Mountain Range, Appl. Environ. Microbiol., 1999, 65, 374-380 [19] Bürgmann H., Widmer F., von Sigler W., Zeyer J., New molecular screening tools for analysis of free living diazotrophs in soil, Appl. Environ. Microbiol., 2004, 70, 240-247 [20] Liebecq C., (Ed.), International Union of Pure and Applied Chemistry and International Union of Biochemistry and Molecular Biology Biochemical Nomenclature and related documents, 2nd Ed., Portland Press, London, UK, 1992 [21] Bartl S., Weissman I.L., PCR primers containing an inosine triplet to complement a variable codon within a conserved protein coding region, BioTechniques, 1994, 16, 246-250 [22] Candrian U., Furrer B., Hofelein C., Luthy J., Use of inosine containing oligonucleotide primers for enzymatic amplification of different alleles of the gene coding for heat stable toxin type I of enterotoxigenic Escherichia coli, Appl. Environ. Microbiol., 1991, 57, 955-961 [23] Carpa R., Gherman V.-D., Dragan-Bularda M., Motoc M., Pancu E.A., Physical-chemical and bacteriological characterization of the soil types from various altitudinal vegetation zones in the Parâng Mountains, Revista de Chimie, Bucureşti, 2008, 59, 1057-1061 [24] Beyer W., Glockner P., Otto J., Boehm R., A nested PCR method for the detection of Bacillus anthracis in environmental samples collected from former tannery sites, Microbiol. Res., 1995, 150, 179-186 [25] El Fantroussi S., Mahillon J., Naveau H., Agathos S.N., Introduction of anaerobic dechlorinating bacteria into soil slurry microcosms and nested PCR monitoring, Appl. Environ. Microbiol., 1997, 63, 806-811 [26] Göβner A.S., Küsel K., Schulz D., Trez S., Acker G., Lovell C.R., et al., Trophic interaction of the aerotolerant anaerobe Clostridium intestinale and the acetogen Sporomusa rhize sp. nov. isolated from roots of the black needlerush Juncus roemerianus, Microbiology, 2006, 152, 1209-1219 [27] Olivares F.L., Baldani V.L.D., Reis V.M., Baldani J.I., Döbereiner J., Occurrence of the endophytic diazotrophs Herbaspirillum spp. in roots, stems and leaves, predominantly of Gramineae, Biol. Fertil. Soils, 1996, 21, 197-200 [28] Barassi C.A., Sueldo R.J., Creus C.M., Carrozzi L.E., Casanovas E.M., Pereyra M.A., Azospirillum spp., a dynamic soil bacterium favourable to 672
Unauthenticated Download Date | 4/14/18 1:09 PM
Molecular identification of diazotroph microbial consortia in mountain soil
vegetable crop production, In: Dynamic Soil, Dynamic Plant, Global Science Books, 2007, 6882 [29] Huss-Danell K., Sverrison H., Hahlin A.S., Danell K., Occurrence of Alnus-infective Frankia and Trifolium-infective Rhizobium in Circumpolar Soils, Arctic, Antarctic and Alpine Res., 1999, 31, 400406 [30] Maunuksela L., Hahn D., Haahtela K., Effect of freezing of soils on nodulation capacities of total and specific Frankia populations, Symbiosis, 2000, 29, 107-119 [31] Pawlowski K., Frankia and Actinorhizal Plants, in Nitrogen Fixation: From Molecules to Crop Productivity, In: Pedrosa F.O., Hungria M., Yates G., Newton W.E., (Eds.), Book series: Current Plant Science and Biotechnology in Agriculture, Springer Netherlands, 2000, 38, 451-452 [32] Hubbell D.H., Kidder G., Biological Nitrogen Fixation - the importance of nitrogen, IFAS Extention, University of Florida, 2003
[33] Bashan Y., Holguin G., de-Bashan L.E., Azospirillum plant relationship: physiological, molecular, agricultural and environmental advances (19972003), Can. J. Microbiol., 2004, 50, 521-577 [34] Myers M.L., Hubbell D.H., Plant Cell Wall Carbohydrates as Substrates for Azospirillum brasilense, Appl. Environ. Microbiol., 1987, 53, 2745-2748 [35] Lynch J.M., The Rhizosphere, John Wiley and Sons Ltd., West Sussex, UK, 1990 [36] Rich J.J., Heichen R.S., Bottomley P.J., Cromack K. Jr., Myrold D.D., Community Composition and Functioning of Denitrifying Bacteria from Adjacent Meadow and Forest Soils, Appl. Environ. Microbiol., 2003, 69, 5974-5982 [37] Maunuksela L., Zepp K., Koivula T., Zeyer J., Haahtela K., Hahn D., Analysis of Frankia populations in three soils devoid of actinorhizal plants, FEMS Microbiol. Ecol., 1999, 28, 11-21
673
Unauthenticated Download Date | 4/14/18 1:09 PM