Molecular mechanisms of growth and development inhibition in ... - RUA [PDF]

“Molecular mechanisms of growth and development inhibition in fungi and plants by chitosan”

Federico López Moya

“Molecular mechanisms of growth and development inhibition in fungi and plants by chitosan” Federico López Moya Tesis presentada para optar al grado de DOCTOR POR LA DE ALICANTE MENCIÓN DE DOCTOR INTERNACIONAL PROGRAMA DE DOCTORADO EN CIENCIAS DEL MAR Y BIOLOGÍA APLICADA

Dirigida por: Dr. Luis Vicente López Llorca

El Dr. D. Luis Vicente López Llorca, Catedrático de Botánica y Fitopatología del Departamento de Ciencias del Mar y Biología Aplicada de la Universidad de Alicante,

certifica: que el Licenciado D. Federico López Moya ha realizado bajo su dirección la presente memoria por la cual opta al título de Doctor en Biología, titulada “Molecular mechanisms of growth and development inhibition in fungi and plants by chitosan”.

Fdo.

Luis Vicente López Llorca

Alicante, 26 de Octubre 2016

AGRADECIMIENTOS En este apartado de la tesis es donde se deben de reflejar todos los agradecimientos y reconocimientos al apoyo mostrado por la gente para el desarrollo de la misma. Esta parte es de las más difíciles de escribir para mí, ya que me resulta complicado plasmar en sólo unas líneas todo lo vivido, pero sobretodo, todo lo agradecido. En primer lugar me gustaría dedicar y agradecer esta Tesis doctoral a la persona que me facilitó la posibilidad de llevarla a cabo: mi director de tesis LuisVi. LuisVi: durante esta etapa he aprendido mucho de ti, de tu tenacidad, de tu tesón. En ocasiones hemos tenido que pelear mucho, pero de todo lo vivido me quedo con los momentos más positivos: con tus mensajes de ánimo cuando a mi primera publicación le costaba llegar, con las divertidas historias que me traje de Estados Unidos e Inglaterra, con nuestro viaje a Yosemite. Tu presencia ha sido imprescindible para mi formación no sólo como científico, sino también como persona. De igual manera quisiera agradecer la consecución de esta tesis doctoral a Sandra, mi amiga, mi pareja, mi otra mitad. Aunque ya lo sabes, quiero aprovechar la oportunidad para plasmar mi admiración hacia ti y mi agradecimiento por acompañarme durante etapa de mi vida. Por prestarme el apoyo necesario siempre que lo he necesitado sin pedir nada a cambio. Eres la persona más especial que jamás pensé que podría encontrar. En el año 2010 empezamos esta aventura juntos y hoy, en el 2016, la acabamos igualmente juntos. Gracias, pequeña. Dentro de las personas especiales que han formado parte de este proyecto, por supuesto, he de destacar el papel de mi familia, mis padres y mi hermana (mi cuñado también). Susi y Fede, papá y mamá, vosotros sois las personas más

importantes de mi vida. Siempre me habéis apoyado en todas y cada una de mis etapas, bajo cualquier condición y circunstancia. Sin vosotros esto no hubiera sido posible. Alejandra e Iván, igualmente vosotros sois piezas claves en mi vida y gracias a vuestra dedicación, apoyo y cariño hemos hecho que este barco llegue a puerto. Gracias. Quisiera agradecer esta Tesis al resto de mi familia a mi tía Rosa, mi tío Pepe y a mi prima Rosa por ser una parte importante de mi vida. A Fuensanta, Antonio, Lidia, Lucía, Adrián, Jose por nuestras comidas de domingo con cariño y buen ambiente. A toda mi otra familia: a Maria Jose, por su incansable ayuda. Al tío Toni, por ser único. A Maria Elena, Héctor, Pedro, Fran, Pepe, Elena, Izan, Héctor. Gracias. Esta tesis doctoral tampoco se podría entender sin mis compañeros y amigos del Fitolab. Creo que la comunión y el equipo que hemos formado durante estos años han resultado imprescindibles para llevar a cabo este proyecto de tesis. Quisiera agradecer a Nuria todo lo que hemos compartido, aunque es tanto que me cuesta resumir. Sin embargo, sé que no olvidaré nuestros días surcando los campos de palmeras infectadas de picudo, nuestra travesía “suicida” a través del estado de California o las palabras de ánimo en momentos donde las circunstancias no acompañaban. Gracias por todo. Por otro lado, Ernesto, el Pura, ha sido una de mis grandes apoyos durante todo el desarrollo de este trabajo. Hemos trabajado muy duro, pero siempre con una sonrisa en la cara. También me llevo 1.000 anécdotas: nuestro viaje a Londres viendo a México ganar el oro, nuestras risas en las ya famosas clock party, pedir indicaciones en Portugal…una liada tras otra. Gracias. Otra de las personas más importantes durante la consecución de esta tesis ha sido Almudena, la primera persona que dirigí en el laboratorio. De ella destacaré que

he visto como entraba una tímida estudiante, pero aquí dejo una gran investigadora. Recuerdo nuestra lucha contra los cucus, así como la alegría cuando me aceptaron el primer artículo. Hemos sufrido multitud de reveses pero creo que juntos hemos aprendido a levantarnos y seguir hacia adelante. Gracias, Almu. Quisiera agradecer a Johari por ser un compañero ejemplar y estar dispuesto a ayudar siempre que lo necesité. A Irais, porque aunque no hemos podido compartir demasiado tiempo en Lab, creo que eres una compañera ejemplar. A Marta y Jokin, los últimos fichajes del Fitolab por los buenos momentos del final, siempre con una sonrisa por delante. Por supuesto quisiera agradecer la implicación en esta tesis a las personas que han pasado durante todos esto años (algunos aún siguen por aquí) por el Fitolab y que han sido determinantes para la misma. A Leti, por ser un referente para mí y por estar siempre abierta para una buena charla cuando más se le necesitaba. A Sonia, por su inestimable ayuda y buenos consejos en momentos clave de esta Tesis. A Jose Gaspar y a Berenice, por guiarme cuando entré en el Laboratorio y por ayudarme en la redacción de proyectos y escritura de artículos siempre que lo he necesitado. A Javi, por ayudarme sobremanera durante mi estancia en Berkeley, además de por servirme como inspiración para muchos de los trabajos reflejados en esta Tesis. A Edu, por transmitirme la pasión por la Biología Molecular y por su implicación durante mis primeras extracciones de ADN. A Rafa, por ser siempre un compañero ejemplar. A Miguel, por ayudarme con la bioinformática. A Aurora, por su ayuda incondicional con todo tipo de experimentos pese a nuestras diferencias futbolísticas. A Ana, por ser la alegría hecha persona y por transmitir siempre buen ambiente. A Sito, por su colaboración en los experimentos con plantas y estar siempre dispuesto a ayudar. A Rodrigo, por las carcajadas incontrolables cuando descubrimos la palabra procrastinar. A Marc, por las apasionantes conversaciones sobre política y nacionalismo.

No quisiera dejar de agradecer a muchas otras personas que de una manera u otra han contribuido en esta tesis: Virginia, Leo, Ari, Mº José, Patri, Marta, Toñi, Dani, David, Isa, Lorena, Adrián, Irene… ¡Gracias, chicos! Gracias a la gente de la Universidad de Alicante. A Jesús Salinas, por ser un buen amigo y estar siempre dispuesto a dar palabras de ánimo cuando las he necesitado. A Pepe, por ayudarme a revisar mis trabajos en los momentos más difíciles de esta Tesis y por los buenos momentos en el karaoke. A las Anas, por ayudarme en todo lo que he necesitado, por ser unas profesionales ejemplares y por nuestros debates de sobremesa. A Gema, por ayudarme mil y una veces con los temas administrativos y por estar pendiente siempre de mi situación. A Carlos Sanz, por las buenas comidas que hemos disfrutado aunque fueran en un tupper recalentado. A las morfólogas, Laurita, Laura, Gema, Violeta por estar siempre dispuestas a ayudar o a prestarme algo cuando lo necesitaba. A Juanjo e Iván de la OTRI, por su compromiso en la búsqueda de proyectos y por entender en cada momento la situación y tratar de llevar la nave a buen puerto. A Ana Martínez, por su inconfundible sonrisa en los momentos más complicados durante la solicitud de proyectos internacionales. También quisiera agradecer esta Tesis a Francisca Colom, Kika, por abrirme las puertas de su laboratorio durante el inicio de mi investigación con patógenos humanos y por mostrarme su apoyo a mí y a mi trabajo siempre que ha sido necesario. Gracias también a Jesús, Eduardo, Pascual y Jose Miguel su colaboración en las diferentes fases de mis investigaciones. I would like to thank Prof Louise Glass to give me the opportunity to perform my Project in her Lab and to provide me all the necessary tools to make me a better researcher. I thank David Kowbel, for his support during my stay in Berkeley, for

being my teacher about RNA extraction and RNAseq library construction. I also thank, James, Trevor, Joanna, Jiuhai, Sam, Timo… I would like to thank Prof Nick Talbot to open me the doors of his Lab and give me the opportunity of working with plant pathogenic fungi and to learn about cell imaging and fungal genetics. I thank Mick, Vincent, Washin, George, Lauren, Xia, Andy, Tina, Satish, Tang … for their help and support during my stay in the Lab. I would like to thank Afshoon, Trupti, Adriana, Tim, Felicity, Geena and Marwan about the amazing moments lived during my stay in Exeter. Quisiera agradecer a mis chicas de Exeter, a Miriam por ser siempre un apoyo y por estar dispuesta a ayudar en todo momento, por los momentos de confesiones necesarios e imprescindibles y por las buenas cerves después de un duro día de trabajo. A Magdalena, por su trabajo titánico, así como por su inigualable apoyo dentro del laboratorio y su labor como maestra a lo largo de este tiempo. A Clara, por ayudarme a buscar una casa, aún sin conocerme y por ser sinónimo de alegría. Esta tesis no se entendería sin mis grandes amigos. A Jose, el Bebeto, porque hemos crecido juntos y durante esta etapa, que no se entendería sin nuestras conversaciones que nadie entiende, siempre has estado ahí. A Manuela y Jordan, por ser parte de la vida de mi amigo y por tanto, por ser parte fundamental de la mía. A Adri, mi brother, porque sin él esta tesis no tendría sentido. Por ayudarme a superar los malos momentos y estar siempre dispuesto a todo. Por ser un amigo de verdad. A David Tortosa, por las quedadas y buenas conversaciones sobre Juego de Tronos o cualquier tema que estuviera en el candelero. A Raúl, el astronauta, porque aunque siempre hemos ido muy ocupados hemos sacado tiempo para contarnos batallitas y darnos una palabra de ánimo. A Javi, por nuestras conversaciones únicas y profundas. A Marcos y Aranza, por ser

siempre unos buenos amigos y estar siempre presentes en los momentos importantes. A Loreto, por ser una parte importante durante este tiempo. A mis amigos de la Coca Club de Fútbol por darme la alegría que necesitaba en todo momento y porque juntos hemos vivido momentos inigualables. Aquí dejo constancia de alguno de mis sentimientos y agradecimientos derivados de la consecución de esta Tesis. Gracias a todo el mundo que ha hecho posible que este sueño se haga realidad.

La dicha de la vida consiste en tener siempre algo que hacer, alguien a quien amar y alguna cosa que esperar. Thomas Chalmers (1780-1847)

A mis padres, a mi hermana, a Sandra

CONTENTS

Resumen General

1

General Introduction

27

Objectives and Structure of this PhD Thesis

57

Chapter 1. Carbon and nitrogen limitation increase chitosan 61 antifungal activity in Neurospora crassa and fungal human pathogens. Chapter

2.

Neurospora

crassa

transcriptomics

reveals 85

oxidative stress and plasma membrane homeostasis biology genes as key targets in response to chitosan. Chapter

3.

Chitosan

arrests

Magnaporthe

oryzae 117

appressorium differentiation affecting cytoskeletal remodelling. Chapter 4. Chitosan inhibits root growth altering hormone 153 homeostasis and repressing quiescent centre WOX5 gene expression. General Discussion

189

Concluding Remarks

196

Conclusions

198

Curriculum Vitae

207

RESUMEN GENERAL

Los hongos filamentosos y las levaduras son microorganismos eucariotas con modos de vida diversos. Éstos aparecen como microorganismos unicelulares o multicelulares. Hay descritas más de 70,000 especies de hongos, aunque se estima que existe más de un millón y medio de especies (Hawksworth, 1991; Hawksworth et al., 1995). Los hongos forman un grupo filogenético diferente al de los animales o plantas, el cual se incluye en organismos con una amplia variabilidad en modos de vida. Se incluyen microorganismos tales como hongos filamentosos y levaduras, sin embargo también existen especies que presentan estructuras macroscópicas (vulgarmente conocidos como “setas”). Así pues, se reconocen 5 grandes grupos taxonómicos en el reino de los hongos:

Ascomycota,

Basidiomycota,

Glomeromycota,

Zygomycota

y

Chytridiomycota (Lutzoni et al., 2004). El grupo taxonómico de los Ascomycota o Ascomicetos es el que presenta un mayor número de especies. Este grupo incluye hongos filamentosos y levaduras, además de algunas especies dimórficas que presentan ambos niveles de organización celular, dependiendo de las condiciones ambientales o del estadío en su ciclo biológico. Estos

1

Resumen General

microorganismos se caracterizan generalmente por presentar un micelio formado por hifas septadas, cuyas paredes contienen quitina y glucanos. Dichas hifas presentan una continuidad citoplasmática debido a la presencia de poros simples en la zona central de los septos que permiten el movimiento de orgánulos y del material citoplasmático a lo largo del micelio. Las levaduras no forman micelio, sólo estructuras unicelulares que se dividen por gemación. Los Ascomycota presentan reproducción sexual en la que se produce la fusión de núcleos de microorganismos con mating-type complementarios. Esta fusión deriva en el desarrollo de una fase meiótica seguida, en muchos de ellos, de una segunda división mitótica que finalmente da lugar a una estructura de 8 núcleos llamada asca. Estas estructuras maduran a través de acumulaciones de citoplasma, dando lugar a estructuras individualizadas conocidas como ascospora, las cuales maduran en el interior del asca. Dentro de este grupo de organismos destacan importantes hongos patógenos humanos (Aspergillus sp., Candida sp. o Fusarium sp.), así como importantes hongos patógenos de plantas (Botrytis spp., Alternaria spp., Magnaporthe spp.). Además, se incluyen organismos modelo utilizados en investigación como Neurospora crassa o Saccharomyces cerevisiae. Dichos organismos también han sido utilizados en aplicaciones biotecnológicas (desarrollo de nuevos compuestos antifúngicos), agricultura (control biológico) o en el desarrollo de productos alimenticios (fermentación de cebada). El segundo gran grupo de hongos son los Basidiomycota o Basidiomicetos. Se trata de un taxón muy diverso con más de 20,000 especies descritas. Se caracterizan por la formación de basidios en los cuales se forman las basidiósporas (generalmente cuatro). El micelio de estos hongos posee hifas septadas con poros complejos (doliporo-parentosoma) que limitan el movimiento de núcleos y otros orgánulos. La fase sexual de estos hongos implica fusión de hifas y la formación de dicarions como en los Ascomycota.

2

Resumen General

Sin embargo, a diferencia de aquellos, la dicariofase de los Basidiomicetos es larga. Muchos de estos organismos forman basidiocarpos o cuerpos fructíferos macroscópicos conocidos vulgarmente como setas. En este grupo de hongos se incluyen especies utilizadas (muchas cultivadas) para el consumo humano en alimentación como Boletus edulis, Agaricus bisporus. o Lactarius deliciosus. Por otro lado, existen otras especies con representantes unicelulares que se han descrito como patógenas para los seres humanos (Cryptoccocus spp.). Los Basidiomicetos y Ascomicetos forman el subreino Dikarya que engloba a los hongos más evolucionados y con mayor biodiversidad. Otros grupos de hongos filogenéticamente independientes son los Glomeromycota, Zygomycota y los Chytridiomycota (James et al., 2006; Maddison and Schulz, 2007; Schoch et al., 2012). Los hongos presentan gran variedad de ciclos biológicos, además de ser capaces de colonizar un amplio rango de nichos ecológicos. Estos organismos presentan una enorme plasticidad ecológica, lo que se refleja en su papel determinante durante el desarrollo de los diferentes ecosistemas terrestres; los hongos filamentosos jugaron un papel determinante en la colonización del medio terrestre por las plantas (Brundrett et al., 2002). Estos organismos cuentan con la capacidad de interaccionar con materia orgánica (saprófitos) o con organismos vivos como patógenos o parásitos (Lowe and Howlett, 2012). Los hongos saprófitos como N. crassa juegan un papel determinante en el reciclado de nutrientes. A su vez, tiene la capacidad de expresar una enorme batería de enzimas extracelulares que permiten la degradación y asimilación de la materia orgánica, que de otro modo se acumularía en los ecosistemas (Crowther et al., 2012). Por otra parte, los hongos patógenos infectan huéspedes de los que obtienen los recursos necesarios para realizar su ciclo biológico. Estos microorganismos pueden infectar a seres humanos y a muchos otros

3

Resumen General

animales, como a nematodos o insectos, así como a plantas (son los responsables de la mayoría de sus enfermedades) e incluso otros hongos. En este grupo de organismos, cabe destacar algunas especies que se han utilizado

históricamente

para

investigación

básica.

Estos

organismos

“modelo”, gracias a la facilidad con la que se cultivan, manejan y transforman genéticamente. Así pues, han sido empleados para el desarrollo de nuevos compuestos antimicrobianos o para el desarrollo de nuevos procesos biotecnológicos, entre otros estudios. En la actualidad, con el desarrollo de la biología sintética, estos organismos adquieren un papel primordial en las “cajas de herramientas” (toolboxes) que se utilizan para diseñar nuevas vías y procesos, por ejemplo, en el desarrollo de biocombustibles de nuevas generaciones. Uno de los hongos modelo por excelencia, utilizado en infinidad de estudios de investigación, es Neurospora crassa. Este hongo filamentoso se ha empleado en investigación desde los años cuarenta del siglo pasado en estudios de fisiología, genética, bioquímica o biología molecular (Lindergben and Rumann, 1938; McClintock, 1945; Beadle and Tatum, 1945; Westergaard and Mitchell, 1947). Esta especie de hongo presenta un ciclo biológico completo en el laboratorio con fases de reproducción sexual y asexual (Davis and Perkins, 2002). La reproducción sexual o fase teleomórfica de N. crassa permite la diferenciación de protoperitecios (cuerpo fructífero inmaduro). Esta estructura sexual se desarrolla tras la fusión de núcleos procedentes de hifas con matingtype complementarios. Durante este proceso se suceden, como ya se ha indicado, una meiosis completa y una mitosis. Finalmente, estos procesos regulados genéticamente dan lugar a la diferenciación del ascoma o estructura reproductora madura (peritecio) con las ascas que a su vez contienen las ascosporas.

4

Resumen General

La reproducción asexual o fase anamórfica tiene lugar cuando las ascosporas haploides germinan y generan el micelio del hongo. En dicho micelio se diferencian los conidióforos o estructuras reproductoras asexuales. Los conidioforos producen mitósporas (macro- o microconidios). Finalmente estas unidades reproductoras o propágulos se diseminan mediante acción del viento. Con la secuenciación del genoma de N. crassa (Galagan et al., 2003) y las nuevas técnicas de secuenciación masiva, se ha generado la colección de mutantes de pérdida de función para genes no esenciales del hongo (Colot et al., 2006; Dunlap et al., 2007). Estas herramientas, junto con el desarrollo de técnicas de análisis transcriptómico masivo, (RNAseq) han permitido la realización de estudios de genómica funcional. Estos recursos se han utilizado en esta Tesis doctoral para investigar el modo de acción del quitosano, un compuesto antifúngico de origen natural. La investigación básica en organismos modelo como N. crassa permite abordar estudios de organismos no modelos causantes, por ejemplo, de importantes infecciones en seres humanos. Los hongos patógenos de seres humanos se consideran el agente causal de importantes enfermedades infecciosas (Brown et al., 2012). Estos organismos se clasifican como patógenos primarios o patógenos oportunistas en función del grado de especialización necesario para causar las infecciones en tejidos humanos (mamíferos). Los patógenos primarios invaden y colonizan los tejidos del huésped evadiendo sus defensas. Por el contrario, los organismos oportunistas causan infecciones en huéspedes aprovechando deficiencias en el sistema inmune de los mismos. Dichas deficiencias se deben a la utilización de terapias que inhiben el sistema inmune (pacientes trasplantados o enfermos tratados con quimioterapia) o por enfermedades como el SIDA (Bodey et al., 1989; Dening 1998). Dichas infecciones resultan difíciles de controlar y en muchas ocasiones suelen resultar

5

Resumen General

fatales. Además de estas graves enfermedades fúngicas, se produce una elevadísima incidencia de infecciones menores causadas por hongos. Es el caso de infecciones fúngicas en el tracto vaginal y mucosas de mujeres, principalmente, así como infecciones cutáneas o en las cavidades oculares. Estas infecciones no suelen revestir una gran gravedad ya no comprometen la vida del huésped, y se suelen controlar mediante la aplicación de antifúngicos de uso convencional como azoles, polienos o equinocandinas. En esta Tesis se ha investigado el potencial del quitosano en el control de infecciones por hongos patógenos oportunistas humanos (hongos filamentosos y levaduras). Así mismo, se ha evaluado la capacidad antifúngica del quitosano in vitro e in vivo en huéspedes invertebrados modelo Galleria mellonella. Los hongos filamentosos utilizados en esta Tesis doctoral han sido Fusarium proliferatum (Matsush.) Nirenberg, Aspergillus fumigatus (Fresenius), Hamigera avellanea (Thom and Turesson) Stolk and Samson, Rhizopus stolonifera (Ehrenb) Vuill. El género de hongos filamentosos Fusarium sp. es causante de importantes micosis principalmente mediante la colonización de tejidos blandos. Al tratarse de un microorganismo patógeno oportunista, las infecciones causadas se suelen dar en pacientes inmunosuprimidos

que

muestran una elevada tasa de mortalidad (Alastruey-Izquierdo et al., 2008). En esta Tesis, se ha probado la efectividad del quitosano sobre un aislado de F. proliferatum obtenido de la retina infectada de un paciente operado de cataratas (Ferrer et al., 2005). Cabe destacar la gran relevancia de este estudio, puesto que dicho grupo de microorganismos es resistente a la mayoría de antifúngicos convencionales. Las infecciones causadas por Aspergillus fumigatus son la causa principal de infecciones pulmonares en humanos. Este hongo filamentoso es

un

saprófito oportunista con un metabolismo versátil capaz de desarrollar su ciclo

6

Resumen General

de vida en condiciones ambientales muy diversas (Gibbons et al., 2012). Las infecciones

de

este

microorganismo

en

pacientes

con

deficiencias

inmunológicas resultan mortales en numerosas ocasiones. Es necesario desarrollar nuevas estrategias para el control de infecciones por A. fumigatus, puesto que las mismas conllevan un elevado coste personal y económico. H. avellanea es un patógeno humano poco usual que se encuentra principalmente en el suelo, sin embargo se han descrito casos clínicos en los que se ha aislado de tejidos humanos (Houbraken et al. 2010). El aislado utilizado en este estudio fue obtenido a partir de una infección sanguínea (hemocultivo) de un neonato en el Hospital General de Alicante. R. stolonifera es un zigomiceto causante de infecciones en mucosas y tejidos blandos en pacientes inmunocomprometidos (Ribes et al., 2000). Las infecciones

sistémicas

y

del

tracto

respiratorio

causadas

por

este

microorganismo suelen resultar fatales. El aislado utilizado en esta Tesis doctoral se obtuvo a partir de una muestra de la fosa nasal periocular infectada de un paciente. En esta Tesis doctoral se ha estudiado la efectividad del quitosano sobre levaduras patógenas de humanos. En nuestra investigación se han incluido especies de los géneros Candida y Cryptococcus. Ambos grupos de levaduras son los causantes del mayor número de infecciones fúngicas diagnosticadas en humanos. En el género Candida cabe destacar la especie Candida albicans por su una elevada incidencia en las infecciones fúngicas. C. albicans se detecta habitualmente colonizando el tracto vaginal, las mucosas y los tejidos blandos. Las infecciones causadas por esta levadura suelen presentar buen pronóstico ya que son sensibles a los antifúngicos utilizados en micología clínica (azoles, equinocandinas o polienos; Moudgal and Sovel, 2010). Las infecciones causadas por esta especie en pacientes con déficit en el sistema inmunitario suelen presentar peores pronósticos debido a las condiciones particulares de

7

Resumen General

dichos pacientes. Las infecciones causadas por otras especies del género Candida requieren tratamientos más especializados debido a la aparición de resistencias a los antifúngicos convencionales. La especie C. glabrata ha aumentado su incidencia en infecciones de pacientes inmunodeprimidos y se considera la segunda especie más importante después de C. albicans (Fidel et al., 1999). Las infecciones causadas por esta especie suelen tratarse con fluconazol u otros derivados de azoles. Se conocen otras especies de este género causantes de sepsis en humanos. Las especies C. kruseii y C. parapsilosis también presentan una elevada incidencia en infecciones causadas por hongos. Su tratamiento requiere de estrategias sinérgicas con varios fármacos antifúngicos para optimizar el control de las infecciones causadas por dichos microorganismos. El otro grupo importante de levaduras causantes de infecciones en humanos son las especies del género Cryptococcus. C. neoformans es la especie con mayor incidencia en humanos. Las modificaciones estructurales de la pared célular y las adaptaciones fisiológicas son esenciales para la patogenicidad de C. neoformans (Del Poeta, 2004; Alspaugh, 2015). El control de infecciones causadas por esta especie se realiza mediante la aplicación de antifúngicos convencionales. C. gattii presenta una menor incidencia en infecciones humanas. La gran variabilidad de patógenos fúngicos y el uso abusivo de los antimicóticos convencionales generan la necesidad de desarrollar nuevas moléculas para el control infecciones causadas por hongos. En esta Tesis doctoral hemos estudiado el modo de acción del quitosano sobre las especies descritas anteriormente, para su desarrollo como una nueva herramienta para el control de enfermedades causadas por estos grupos de microorganismos. Además de la gran variabilidad existente dentro del grupo de organismos patógenos, hay un grupo que destaca de igual modo que los patógenos humanos. Estos son los hongos patógenos de plantas o

8

Resumen General

fitopatógenos. Los hongos son el agente causal de la mayoría de enfermedades vegetales (Talbot, 2003). Las pérdidas de cosechas causadas por estos microorganismos son de gran relevancia en nuestras sociedades. Los brotes epidémicos de hongos fitopatógenos generan enormes pérdidas económicas en cultivos que comprometen la seguridad alimentaria, privando de alimento a grandes núcleos de población. Por otro lado muchos de los fungicidas empleados masivamente resultan altamente tóxicos para organismos no diana y generan resistencias en las poblaciones de los patógenos. Por ello, es necesario estudiar y desarrollar nuevas moléculas para el control de las enfermedades vegetales por hongos. En esta Tesis doctoral hemos estudiado el efecto del quitosano sobre el hongo patógeno causante del quemado del arroz Magnaporthe oryzae. Este hongo causa entorno al 10-30% de pérdidas en las cosechas de arroz a nivel mundial (Skamnioti and Gurr, 2009), lo cual puede resultar devastador debido a que este cultivo constituye una parte de la dieta diaria de gran parte de la población del planeta, especialmente en amplias zonas de Asia (Talbot, 2003). Las infecciones causadas por este hongo se producen en la parte aérea de la planta del arroz. La infección inicia cuando una espora de M. oryzae se sitúa sobre la superficie de la hoja de una planta de arroz. El conidio se adhiere a la epidermis de la planta debido a las condiciones de hidrofobicidad presentes en la misma. La humedad elevada favorece la germinación del conidio y el desarrollo de un tubo germinativo que, tras una serie de modificaciones estructurales y fisiológicas, se diferencia en un apresorio. Esta estructura celular madura mediante la acumulación de presión osmótica que genera presión por turgencia. En este momento se produce la acumulación de melaninas en la pared del apresorio, lo que favorece de manera extraordinaria la acumulación de turgencia (de Jong et al., 1997). Tras una serie de

9

Resumen General

modificaciones celulares y fisiológicas altamente reguladas (Zhang et al., 2011) se produce la diferenciación de una hifa de penetración que permite la invasión y colonización de las células de las hojas de la planta de arroz. La actividad de las NADPH oxidasas genera especies reactivas de oxígeno (ERO) que con la expresión de genes que regulan la organización de citoesqueleto (septinas y actina) poseen un papel esencial en la patogenicidad de M. oryzae (Dagdas et al., 2012; Egan et al., 2006; Ryder et al., 2013; Samalova et al., 2014). En esta Tesis doctoral hemos abordado el efecto antifúngico del quitosano sobre el desarrollo de la infección causada por esta especie en el arroz. Hemos realizado un estudio celular y molecular para conocer la interacción del quitosano sobre los principales genes y estructuras celulares esenciales para la patogenicidad de M. oryzae. Hemos analizado cómo el quitosano afecta a la diferenciación de los apresorios de M. oryzae y a su importancia en la patogenicidad del hongo sobre el arroz. En vista del potencial del uso del quitosano para el control de enfermedades fúngicas vegetales, en esta Tesis doctoral se abordó un estudio para determinar la compatibilidad del uso del quitosano sobre importantes plantas cultivadas. Para ello se realizaron diferentes bioensayos, así como una amplia variedad de análisis fisiológicos, celulares y moleculares que permitieran caracterizar la respuesta de las plantas al quitosano. El quitosano es un polímero natural derivado de la quitina, el segundo polímero más abundante en la naturaleza después de la celulosa. La quitina es un componente estructural de la cutícula de crustáceos o insectos y de la pared celular de los hongos y de algunas algas (Kaur and Dhillon, 2014). La desacetilación de la quitina para obtener quitosano tiene lugar por procesos enzimáticos o químicos. El grado de desacetilación y el peso molecular del polímero son esenciales para caracterizar su actividad biológica. El quitosano es un policatión soluble en disoluciones ácidas. Por el contrario, los

10

Resumen General

quitoligosacáridos de pequeño peso molecular (< 5000 Da) son solubles en agua. Las características físico-químicas descritas dotan al quitosano de unas propiedades biológicas especiales. El quitosano se ha utilizado en numerosos procesos industriales para el desarrollo de nuevas formulaciones o productos. Como ejemplos, la industria farmacéutica utiliza quitosano en sistemas de liberación de medicamentos, y la industria alimentaria lo emplea para favorecer la absorción de grasas. Además se ha utilizado en otras industrias como cosmética, agricultura o en el diseño de nuevos biomateriales (fibras o nanoencapsulados; Kumar, 2000). El quitosano se describió como compuesto antimicrobiano a finales de los años 1970s (Allan and Hadwinger, 1979). Durante este tiempo se han desarrollado numerosos trabajos de investigación para dilucidar el modo de acción del quitosano sobre hongos (Kong et al., 2010; Park et al., 2008; Raafat et al., 2008). El quitosano inhibe la germinación y provoca cambios morfológicos en las hifas de importantes hongos patógenos post-cosecha como Rhizopus stolonifer y Botrytis cinerea (El Ghaouth et al., 1991). El quitosano inhibe, además, el crecimiento de otros hongos patógenos vegetales como Fusarium oxysporum f. sp. radicis-lycopersici (Palma-Guerrero et al., 2008). El modo de acción del quitosano se ha basado en la interacción del

polímero con la membrana

plasmática de los hongos que las desestructura y permeabiliza (PalmaGuerrero et al., 2009). La permeabilización de la membrana fúngica por quitosano depende de la energía celular. El bloqueo de la cadena de transporte de electrones mitocondrial, así como la disminución del metabolismo celular por descenso de temperatura, evita la acción antifúngica del quitosano (PalmaGuerrero et al., 2009). La actividad inhibidora del crecimiento por quitosano a través de la permeabilización de la membrana plasmática también tiene lugar en organismos procariotas (Je and Kim, 2006).

11

Resumen General

La compatibilidad del quitosano con los hongos nematófagos y entomopatógenos agentes de control biológico permite su uso en estrategias integradas para controlar enfermedades y plagas causadas por nematodos e insectos. El quitosano, además de favorecer la diferenciación de apresorios en el hongo nematófago Pochonia chlamydosporia, induce la expresión de proteasas extracelulares esenciales en la infección de huevos de nematodos (Escudero et al., 2016). Por otro lado, se está estudiando la aplicación en la rizosfera de quitosano en combinación con Pochonia chlamydosporia para el control sostenible de nematodos fitopatógenos. El principal objetivo de esta Tesis doctoral es el estudio del efecto inhibitorio del quitosano sobre el crecimiento y desarrollo de hongos y plantas. Se ha analizado la interacción del quitosano con importantes hongos patógenos de humanos y de plantas, así como sobre el hongo modelo Neurospora crassa. Este estudio trata de desarrollar el quitosano como un antifúngico efectivo para su aplicación clínica y en agricultura. Además se ha investigado la respuesta de plantas a quitosano, con el fin de implementar su uso en sistemas agrícolas. Para este estudio se ha empleado la planta modelo Arabidopsis thaliana, así como importantes cultivos como el tomate y la cebada. La respuesta a quitosano de plantas y hongos se ha estudiado a nivel fisiológico, celular y molecular. Este objetivo general se subdivide en los siguientes objetivos específicos: -

Evaluar el efecto de la limitación de nutrientes sobre el modo de acción del quitosano en hongos patógenos de humanos.

-

Identificar los principales genes diana del quitosano en el hongo modelo N. crassa mediante el uso de recursos transcriptómicos y colecciones de aislados de pérdida de función para genes no esenciales.

12

Resumen General

-

Estudiar el efecto del quitosano sobre la diferenciación de apresorios del hongo fitopatóegeno M. oryzae, así como el efecto sobre la organización del citoesqueleto durante el proceso de infección.

-

Caracterizar la respuesta fisiológica, celular y molecular de las raíces a quitosano, incluyendo los principales genes implicados.

A partir de estos objetivos específicos se han desarrollado 4 proyectos de investigación que han quedado definidos en los 4 capítulos de esta Tesis doctoral. Este trabajo de investigación se estructura de la siguiente manera: Chapter 1. Federico Lopez-Moya, Maria F. Colom-Valiente, Pascual MartinezPeinado, Jesus E. Martinez-Lopez, Eduardo Puelles, Jose M. Sempere-Ortells and Luis V. Lopez-Llorca. 2015. Carbon and nitrogen

limitation

increase

chitosan

antifungal

activity

in Neurospora crassa and fungal human pathogens. Fungal Biology. 119(2-3): 154-69.

Chapter 2. Federico Lopez-Moya, David Kowbel, Mª José Nueda, Javier PalmaGuerrero, N. Louise Glass and Luis Vicente Lopez-Llorca. Neurospora crassa transcriptomics reveals oxidative stress and plasma membrane homeostasis biology genes as key targets in response to chitosan. Molecular Biosystems. 12(2): 391-403.

Chapter 3. Federico Lopez-Moya, Mark D. Fricker, George Littlejohn, Luis V. Lopez-Llorca and Nicholas J. Talbot. Chitosan arrests Magnaporthe oryzae

appressorium

differentiation

affecting

cytoskeletal

remodelling. Manuscript in preparation.

13

Resumen General

Chapter 4. Federico Lopez-Moya, Nuria Escudero, Ernesto A. ZavalaGonzalez, David Esteve-Bruna, Alfonso Prieto, Miguel A. Blázquez, David Alabadí and Luis V. Lopez-Llorca. Chitosan inhibits root growth altering hormone homeostasis and repressing quiescent center WOX5 gene expression. Manuscript in preparation.

La versatilidad, aplicaciones y formulaciones del quitosano requiere que su estudio abarque diferentes aspectos. En esta Tesis doctoral, por ejemplo, se ha utilizado un amplio rango de técnicas y análisis para el estudio del efecto del quitosano sobre hongos y plantas. En el Capítulo 1 de esta Tesis se ha investigado el modo de acción del quitosano sobre N. crassa y hongos (filamentosos y levaduras) patógenos de humanos bajo diferentes regímenes nutricionales. La limitación de nutrientes (carbono; C y nitrógeno; N) potencia el efecto antifúngico del quitosano. La disminución en los niveles de nutrientes provoca alteraciones estructurales de la pared celular de hongos que a su vez está directamente relacionada con la integridad de la membrana plasmática (Nitsche et al., 2012; Szilágyi et al., 2013). Se ha demostrado recientemente que la composición (contenido de glucanos) y estructura de la pared celular están directamente relacionadas con la sensibilidad de los hongos a quitosano (Aranda-Martinez et al., 2016). En este capítulo hemos descubierto que existe una conexión directa entre la actividad antifúngica del quitosano y la acumulación de ERO en el interior celular. El quitosano induce estrés oxidativo en el interior celular, lo que se relaciona directamente con la permeabilización de la membrana y con su actividad antifúngica. Se sabe que la permeabilización de la membrana de los hongos por el quitosano depende de la fluidez de la misma (Palma-Guerrero et al., 2010). Los hongos (N. crassa) que presentan un alto contenido de ácidos grasos poliinsaturados (ácido linolenico) son sensibles a quitosano. Estos

14

Resumen General

ácidos grasos, debido a la presencia de dobles y triples enlaces en su cadena hidrocarbonada, son más susceptibles a oxidación. En este capítulo de la Tesis avanzamos que el estrés oxidativo (ERO) asociado a la presencia de quitosano es la principal causa por la cual se produce la permeabilización de la membrana, y la consiguiente muerte celular. En esta Tesis se ha analizado el uso del quitosano como antifúngico con aplicación clínica. Este polímero mostró actividad fungicida sobre Fusarium proliferatum y Hamigera avellanea, además de actividad fungistática sobre el desarrollo de Aspergillus fumigatus y Rhizophus stolonifer. Hemos determinado que el quitosano es efectivo sobre estos microorganismos en las condiciones de nutrientes (C y N) de la sangre humana. Por otro lado, , el quitosano presenta efectividad como fungicida sobre levaduras de los géneros Candida sp. y Cryptococcus sp., incluyendo especies resistentes (C. kruseii) a los antifúngicos clínicos usados convencionalmente (azoles). La efectividad fungicida del quitosano sobre las diferentes especies de levaduras patógenas en condiciones nutricionales similares a las encontradas en sangre (glucémia), hace del quitosano un compuesto natural con elevado potencial para ser desarrollado como antifúngico. Adicionalmente, en este estudio se ha probado la compatibilidad del quitosano (70 kDa) con cultivos celulares de mamíferos y humanos a concentraciones eficaces sobre hongos patógenos. Además, hemos probado que el quitosano reduce significativamente la virulencia de C. albicans sobre larvas de Galleria mellonella L. Estos resultados abren el camino al desarrollo del quitosano como antifúngico de uso clínico. En el Capítulo 2 hemos abordado el estudio transcriptómico masivo de la respuesta de un hongo filamentoso (N. crassa) a quitosano. Los genes del metabolismo oxidativo y relacionados con la homeostasis de la membrana plasmática son las principales dianas de la respuesta de este hongo a quitosano. Estos resultados transcriptómicos están en consonancia con los

15

Resumen General

resultados del Capítulo 1.

Las categorías Gene Ontology (GO), actividad

oxidorreductasa, membrana plasmática y transporte son las más significativas en este estudio transcriptómico. Estudios previos realizados con la levadura modelo Saccharomyces cerevisiae demuestran que el metabolismo oxidativo, la respiración y el transporte juegan un papel determinante en la sensibilidad de este microorganismo a quitosano (Jaime et al., 2012; Zakrzewska et al., 2005). En nuestro estudio transcriptómico se ha abordado un análisis de series temporales que ha permitido identificar la dinámica de expresión de los principales genes implicados en la respuesta a quitosano con el tiempo. Mediante el estudio de mutantes de pérdida de función, se ha confirmado que una Lipasa Clase III, un Transportador de Monosacáridos y una Glutatión Transferasa (NCU03639; NCU04537; NCU10521, respectivamente) son los principales genes diana del quitosano en N. crassa. Estos genes están directamente implicados en procesos de reparación/reorganización de membranas, asimilación de catabolitos y en la amortiguación del efecto de las ERO. En este capítulo, hemos demostrado además que la concentración del calcio (Ca2+), involucrada en los procesos de reorganización de la membrana plasmática y de regulación del metabolismo oxidativo (Fu et al., 2014; Muñoz et al., 2014, Yan et al., 2006), está directamente relacionada con la tolerancia de N. crassa a quitosano. En futuras investigaciones

se abordarán estudios

moleculares para identificar las bases genéticas relacionadas con la tolerancia de N. crassa a quitosano en presencia de calcio. En el Capítulo 3 se ha abordado un estudio para determinar el efecto del quitosano sobre la diferenciación de apresorios en el hongo fitopatógeno Magnaporthe oryzae. El quitosano retarda el proceso de diferenciación de apresorios además de afectar su estructura y morfología. Dichas alteraciones en el desarrollo de este hongo se traducen en una disminución de su patogenicidad sobre plantas de arroz. El proceso de diferenciación de apresorios está altamente regulado y requiere la organización del citoesqueleto

16

Resumen General

(septinas y actina) en una estructura en forma de anillo esencial para la patogenicidad (Dagdas et al., 2012). El quitosano desacopla el proceso de condensación de las septinas y actina en forma de anillo afectando a su organización. La inhibición causada por el quitosano en el proceso de organización del citoesqueleto impide la formación del poro, estructura necesaria para la patogenicidad, afectando a su vez al desarrollo de la hifa de penetración. La diferenciación del apresorio en M. oryzae requiere de modificaciones de la pared celular y de la membrana plasmática, además de la acumulación de ERO (metabolismo oxidativo). Todos estos procesos están altamente regulados durante la fase de diferenciación del apresorio (Egan et al., 2007; Ryder et al., 2013; Wilson and Talbot, 2009). En este trabajo se ha demostrado que el quitosano permeabiliza la membrana plasmática del apresorio afectando a la organización de las septinas en su interior. Por otro lado se ha probado que el quitosano altera los balances internos de ERO. Estas alteraciones fisiológicas estarían directamente relacionadas con el efecto inhibitorio de la patogenicidad causada por el quitosano sobre M. oryzae. En vista del potencial del quitosano para el control de hongos fitopatógenos, en el Capítulo 4, hemos realizado una investigación para caracterizar la respuesta de plantas (tomate y cebada) a dicho polímero. La aplicación de quitosano en la rizosfera genera alteraciones morfológicas en las raíces dando lugar a una reducción de la longitud radicular y a su engrosamiento. El quitosano altera la polaridad del ápice de las raíces deteniendo

la

elongación

radicular

y

modificando

drásticamente

su

arquitectura. Mediante la utilización de la planta modelo Arabidopsis thaliana se han estudiado los mecanismos celulares y moleculares implicados en la inhibición generada por el quitosano sobre el desarrollo radicular. De esta manera, se ha probado que el quitosano reprime la expresión de WOX5, un factor de transcripción esencial para la organización y división celular en el centro quiescente de la raíz, estructura que controla la división celular y

17

Resumen General

elongación de la raíz. Se ha encontrado que el quitosano modifica los balances hormonales en la raíz. En concreto, el quitosano genera una acumulación de auxinas (ácido indolacético), así como de hormonas implicadas en la respuesta estrés (ácido jasmónico y ácido salicílico) en la raíz. Estos cambios hormonales serían las principales causas de la reducción en la elongación y desarrollo radicular y por consiguiente del resto de la planta. En futuros estudios, con el fin de identificar dianas específicas en plantas, se evaluará el efecto del quitosano a partir de técnicas de secuenciación masiva. Por tanto, las conclusiones de esta Tesis doctoral son las siguientes: 1.

La limitación de carbono y nitrógeno aumenta la actividad antifúngica del quitosano sobre Neurospora crassa e importantes patógenos humanos mediante la permeabilización de la membrana plasmática.

2.

El quitosano genera la acumulación de especies reactivas de oxígeno que favorecen la permeabilización de la membrana plasmática de hongos y la consiguiente muerte celular.

3.

El quitosano muestra actividad antifúngica sobre importantes patógenos humanos incluyendo especies de Candida resistentes a antifúngicos convencionales.

4.

El quitosano resulta inocuo para células humanas y de otros mamíferos, incluyendo células del sistema inmune a concentraciones inhibitorias y letales para hongos patógenos humanos.

5.

El quitosano reduce la virulencia de Candida albicans sobre Galleria mellonella L. bajo condiciones nutricionales (carbono y nitrógeno) similares a las de la sangre humana.

18

Resumen General

6.

El quitosano induce la expresión de genes de Neurospora crassa relacionados con la homeostasis de la membrana plasmática, actividad oxidorreductasa y el transporte.

7.

Los genes que codifican una Lipasa Clase III, un transportador de monosacáridos y una glutatión transferasa, son las principales dianas del quitosano en Neurospora crassa.

8.

El quitosano disminuye la velocidad de diferenciación de apresorios mediante la inhibición de la organización del citoesqueleto (septinas y actina).

9.

El quitosano reduce la patogenicidad de Magnaporthe oryzae sobre arroz (CO-39) impidiendo la formación de la hifa de penetración y la infección celular.

10.

El riego con quitosano a altas dosis inhibe el crecimiento de plantas mediante la alteración morfológica de las células de la raíz.

11.

El quitosano reprime la expresión del factor de transcripción WOX5, necesario para la división celular en el centro quiescente de la raíz, afectando su desarrollo y elongación.

12.

El quitosano produce un desequilibrio hormonal en la raíz de Arabidospsis thaliana generando la acumulación de auxinas, ácido jasmónico y ácido salicílico, lo que afecta a la arquitectura radicular.

19

Resumen General

REFERENCIAS DEL RESUMEN GENERAL Alastruey-Izquierdo A, Cuenca-Estrella M, Monzón A, Mellado E, RodríguezTudela JL. 2008. Antifungal susceptibility profile of clinical Fusarium spp. isolates identified by molecular methods. J Antimicrob Chemother. 61(4): 805-809. Allan CR, Hadwiger LA. 1979. The fungicidal effect of chitosan on fungi of varying cell wall composition. Exp Mycol. 3 (3): 285-287. Aranda-Martinez A, Lopez-Moya L, Lopez-Llorca LV. 2016. Cell wall composition plays a key role on sensitivity of filamentous fungi to chitosan. J Basic Microbiol. doi:10.1002/jobm.201500775. Beadle GW and Tatum EL, 1945. Neurospora. II. Methods of Producing and Detecting Mutations Concerned with Nutritional Requirements. Am J Bot. 32(10): 678-686. Bodey GP, Vartivarian S. 1989. Aspergillosis. Eur J Clin Microbiol Infect Dis. 8: 413-37. Brown GD, Denning DW, Gow NA, Levitz SM, Netea MG, White TC. 2012. Hidden killers: human fungal infections. Sci Transl Med. 4(165): 165rv13. Brundrett MC. 2002. Coevolution of roots and mycorrhizas of land plants. New Phytol. 154(2): 275-304 Colot HV, Park G, Turner GE, Ringelberg C, Crew CM, Litvinkova L, Weiss RL, Borkovich KA, Dunlap JC. 2006. A high-throughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors. Proc Natl Acad Sci USA 103: 10352-10357.

20

Resumen General

Crowther TW, Boddy L, Hefin Jones T. 2012. Functional and ecological consequences of saprotrophic fungus-grazer interactions. ISME J. 6(11): 1992-2001. Dagdas YF, Yoshino K, Dagdas G, Ryder LS, Bielska E, Steinberg G, Talbot NJ. 2012. Septin-mediated plant cell invasion by the rice blast fungus, Magnaporthe oryzae. Science. 336(6088): 1590-1595. Egan MJ, Wang ZY, Jones MA, Smirnoff N, Talbot NJ 2007. Generation of reactive oxygen species by fungal NADPH oxidases is required for rice blast disease. Proc. Natl. Acad. Sci. USA. 104 (28): 11772-11777. Davis RH, Perkins DD. 2002. Neurospora: a model of model microbes. Nat Rev Genet. 3(5): 397-403. de Jong JC, McCormack BJ, Smirnoff N, Talbot NJ. 1997. Glycerol generates turgor in rice blast. Nature. 389: 244. Del Poeta M. 2004. Role of Phagocytosis in the Virulence of Cryptococcus neoformans. Eukaryot Cell. 3(5): 1067–1075. Denning DW. 1998. Invasive aspergillosis. Clin Infect Dis. 26: 781-803 Dunlap JC, Borkovich KA, Henn MR, Turner GE, Sachs MS, Glass NL, McCluskey K, Plamann M, Galagan JE, Birren BW, Weiss RL, Townsend JP, Loros JJ, Nelson MA, Lambreghts R, et al. 2007. Enabling a community to dissect an organism: overview of the Neurospora functional genomics project. Adv Genet. 57: 49-96. El Ghaouth A, Arul J, Grenier J, Asselin A. 1991. Antifungal activity of chitosan on two postharvest pathogens of strawberry fruits. Phytopathology. 82: 398-402.

21

Resumen General

Escudero N, Ferreira SR, Lopez-Moya F, Naranjo-Ortiz MA, Marin-Ortiz MI, Thorton CR, Lopez-Llorca LV. 2016. Chitosan enhances parasitism of Meloidogyne javanica eggs by the nematophagous fungus Pochonia chlamydosporia. Fun Biol. 120(4): 572-585. Ferrer C, Alio J, Rodriguez A, Andreu M, Colom F. 2005. Endophthalmitis caused by Fusarium proliferatum. J Clin Microbiol. 43(10): 5372-5375. Fidel PL Jr, Vazquez JA, Sobel JD. 1999. Candida glabrata: review of epidemiology, pathogenesis, and clinical disease with comparison to C. albicans. Clin Microbiol Rev. 12(1): 80-96. Fu C, Ao J, Dettmann A, Seiler S, Free SJ. 2014. Characterization of the Neurospora crassa cell fusion proteins, HAM-6, HAM-7, HAM-8, HAM-9, HAM-10, AMPH-1 and WHI-2. PLoS One. 9(10): e107773. Galagan JE, Calvo SE, Borkovich KA, Selker EU, Read ND, Jaffe D, FitzHugh W, Ma LJ, Smirnov S, Purcell S, Rehman B, Elkins T, Engels R, Wang S, Nielsen CB, et al. 2003. The genome sequence of the filamentous fungus Neurospora crassa. Nature. 422(6934): 859-868. Gibbons JG, Beauvais A, Beau R, McGary KL, Latgé J-P, et al. 2012. Global transcriptome changes underlying colony growth in the opportunistic human pathogen Aspergillus fumigatus. Eukaryot Cell. 11: 68–78 Hawksworth DL, Kirk PM, Sutton BC, Pegler DN. 1995. Ainsworth and Bisby's Dictionary of the Fungi (8th Ed.). CAB International, Wallingford, United Kingdom. 616p. Houbraken J, Verweij PE, Rijs AJ, Borman AM, Samson RA. 2010. Identification of Paecilomyces variotii in clinical samples and settings. J Clin Microbiol. 48(8): 2754-61.

22

Resumen General

Jaime MDLA, Lopez-Llorca LV, Conesa A, Lee AY, Proctor M, Heisler LE, Gebbia M, Giaever G, Westwood JT, Nislow C. 2012. Identification of yeast genes that confer resistance to chitosan oligosaccharide (COS) using chemogenomics. BMC Genomics. 13(1): 267. James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, Cox CJ, Celio G, Gueidan C, Fraker E, Miadlikowska J, Lumbsch HT, Rauhut A, Reeb V, Arnold AE,Amtoft A, Stajich JE, et al. 2006. Reconstructing the early evolution of Fungi using a six-gene phylogeny. Nature. 443(7113): 818822. Je JY, Kim SK. 2006. Chitosan derivatives killed bacteria by disrupting the outer and inner membrane. J Agric Food Chem. 54(18): 6629-33. Kaur S, Dhillon GS. 2014. The versatile biopolymer chitosan: potential sources, evaluation

of

extraction

methods

and

applications.

Crit

Rev

Microbiol. 40(2): 155-75. Kong M, Chen XG, Xing K, Park HJ.2010. Antimicrobial properties of chitosan and mode of action: a state of the art review. Int J Food Microbiol. 144(1): 51-63 Lindergben CC and Rumann S. 1938. The chromosomes of Neurospora crassa. J Genet. 36: 393- 404. Lowe RG, Howlett BJ. 2012. Indifferent, affectionate, or deceitful: lifestyles and secretomes of fungi. PLoS Pathog. 8(3): e1002515. Lutzoni F, Kauff F, Cox CJ, McLaughlin D, Celio G, Dentinger B, Padamsee M, Hibbett

D, James

TY, Baloch

E, Grube

M, Reeb

V, Hofstetter

V, Schoch C, Arnold AE, Miadlikowska J, et al. 2004. Assembling the fungal tree of life: progress, classification, and evolution of subcellular traits. Am J Bot. 91(10): 1446-80.

23

Resumen General

Maddison, D. R. and Schulz, K.-S. (eds.) 2007. The Tree of Life Web Project. Internet address: http://tolweb.org. McClintock

B.

1945.

Neurospora.

I.

Preliminary

observations

of

the

chromosomes of Neurospora crassa. Am J Bot. 32: 671–678. Moudgal V, Sobel J. 2010. Antifungals to treat Candida albicans. Expert Opin Pharmacother. 11(12): 2037-48. Muñoz A, Chu M, Marris PI, Sagaram US, Kaur J, Shah DM, Read ND. 2014. Specific domains of plant defensins differentially disrupt colony initiation, cell fusion and calcium homeostasis in Neurospora crassa. Mol Microbiol. 92(6): 1357-1374 Nitsche BM, Jørgensen TR, Akeroyd M, Meyer V, Ram AFJ. 2012. The carbon starvation response of Aspergillus niger during submerged cultivation: Insights from the transcriptome and secretome. BMC Genomics. 13(1): 380. Palma-Guerrero J, Jansson HB, Salinas J, Lopez-Llorca LV. 2008. Effect of chitosan on hyphal growth and spore germination of plant pathogenic and biocontrol fungi. J Appl Microbiol. 104(2): 541-53. Palma-Guerrero J, Huang I, Jansson HB, Salinas J, Lopez-Llorca LV, Read ND. 2009. Chitosan permeabilizes the plasma membrane and kills cells of Neurospora crassa in an energy dependent manner. Fun Genet Biol. 46(8): 585-594. Palma-Guerrero J, Lopez-Jimenez J, Pérez-Berná AJ, Huang IC, Jansson HB, Salinas J, Villalaín J, Read ND, Lopez-Llorca LV. 2010. Membrane fluidity determines sensitivity of filamentous fungi to chitosan. Mol Microbiol. 75(4): 1021-1032.

24

Resumen General

Park Y, Kim MH, Park SC, Cheong H, Jang MK, Nah JW, Hahm KS. 2008. Investigation of the antifungal activity and mechanism of action of LMWS-chitosan. J Microbiol Biotechnol. 18(10): 1729-1734. Raafat D, von Bargen K, Haas A, Sahl HG. 2008. Insights into the mode of action of chitosan as an antibacterial compound. Appl Environ Microbiol. 74(12): 3764-3773. Ribes JA, Vanover-Sams CL, Baker DJ. 2000. Zygomycetes in human disease. Clin Microbiol Rev. 13(2): 236-301. Ryder LS, Dagdas YF, Mentlak TA, Kershaw MJ, Thornton CR, Schuster M, Chen J, Wang Z, Talbot NJ. 2013. NADPH oxidases regulate septinmediated cytoskeletal remodelling during plant infection by the rice blast fungus. Proc Natl Acad Sci USA. 110(8): 3179-3184. Samalova M, Meyer AJ, Gurr SJ, Fricker MD. 2014. Robust anti-oxidant defences in the rice blast fungus Magnaporthe oryzae confer tolerance to the host oxidative burst. New Phytol. 201(2): 556-73. Skamnioti P, Gurr SJ. 2009. Against the grain: safeguarding rice from rice blast disease. Trends Biotechnol. 27(3): 141-50. Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W; Fungal

Barcoding

Consortium; Fungal

Barcoding

Consortium

Author List. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci USA. 109(16): 6241-6246. Talbot NJ. 2003. On the trial of a cereal killer: Exploring the biology of Magnaporthe grisea. Ann Rev Microbiol. 57: 177–202. Westergaard M and Mitchell HK, 1947. Neurospora V. A Synthetic Medium Favoring Sexual Reproduction. Am J Bot. 34, (10): 573-577.

25

Resumen General

Wilson RA, Talbot NJ. 2009. Under pressure: investigating the biology of plant infection by Magnaporthe oryzae. Nat Rev Microbiol. 7: 185-195. Yan Y, Wei C, Zhang W, Cheng H, Liu J. 2006. Cross-talk between calcium and reactive oxygen species signaling. Acta Pharmacol Sin. 27(7): 821-826. Zakrzewska

A, Boorsma

A, Brul

S, Hellingwerf

KJ, Klis

FM.

2005.

Transcriptional response of Saccharomyces cerevisiae to the plasma membrane-perturbing compound chitosan. Eukaryot Cell. 4(4): 703-715. Zhang H, Xue C, Kong L, Li G, Xu JR. 2011. A Pmk1-interacting gene is involved

in

appressorium

differentiation

and

in Magnaporthe oryzae. Eukaryot Cell. 10(8): 1062-1070.

26

plant

infection

GENERAL INTRODUCTION

1. Filamentous fungi and yeast Filamentous fungi and yeast are eukaryotic microorganisms which include unicellular

and

multicellular

species.

This

group

of

organisms

are

characterized by protophyta or tallophyta organization, without chlorophyll which indicates that they are heterotrophic organisms. Fungi also have capabilities to colonize a wide diversity of ecological niches or ecosystems. There are described more than 70,000 species of filamentous fungi but estimations predict that more than 1.5 million species still remain undiscovered (Hawksworth, 1991; Hawksworth et al., 1995). Fungi form a phylogenetic group independent of animals or plants, which include filamentous and yeast microbes besides mushrooms, rust, truffles or moulds. Evolutionary studies recognise five main taxa within the fungal kingdom (Lutzoni et al., 2004). Ascomycota is the fungal taxon with the largest number of species and several evolutionary lineages (Robbertse et al., 2006). Some of them originated at least as early as the Carboniferous, with successive radiations (Prieto and

27

General Introduction

Wedin, 2013). They include filamentous fungi, yeasts and dimorphic species which have both stages. These fungi form asci and ascospores for sexual reproduction. Neurospora crassa (model filamentous fungus used in this thesis), Saccharomyces cerevisiae (baker´s yeast) or important human and plant pathogens such as Aspergillus spp. or Fusarium spp., respectively are included in this group. Basidiomycota differentiate basidia and basidiospores for sexual reproduction. This group includes the mushrooms which form macroscopic fruiting bodies. Both, Ascomycota and Basidiomycota are also known as Dikarya or “higher fungi” because when they fuse their hypha form dikaryotic (n+n) cells. They are the largest subkingdom of fungi. Other phylogenetical fungal groups which include less species and various lifestyles are the Glomeromycota, Zygomycota or Chytridiomycota (James et al., 2006; Maddison and Schulz, 2007; Schoch et al., 2012). These groups of fungi display diverse lifestyles which allow them to colonize a wide variety of ecological niches. Fungal ecological plasticity perhaps reflects their key role as a major evolutionary drive in former Earth’s ecosystems. The key role of Fungi in the establishment of land plants is a well-established example (Brundrett et al., 2002). However, fungi are even put forward as cause for the extinction of dinosaurs (Zaragoza et al., 2009). Fungi also present capabilities to interact with organic matter (saprotrophs) or with living organisms as a pathogens or parasites (Lowe and Howlett, 2012). At the same time saprotrophic fungi such as N. crassa play a key role in nutrient recycling under natural conditions. These fungi secrete a wide array of enzymes directly involved in the degradation of organic matter (Crowther et al., 2012). Fungi are also an important group of pathogens which affects a broad spectrum of hosts including human and mammalians (Candida spp.), plant host (Verticillium spp.) or both (Fusarium spp.).

28

General Introduction

2. Neurospora crassa: a model fungus Model filamentous fungi are microorganisms with high capabilities to grow well in artificial media and are amenable to genetic transformation. They have been used to investigate drug discovery or as “biotechnological cell factories”. They are also being used to develop new antifungals or combinations of existing ones, in medical mycology. In addition, model fungi can be used to discover new drug gene targets or to study mechanisms of post-transcriptional protein modifications. The ascomycete N. crassa is a model filamentous fungus. This fungus has been studied since 1940s in biochemistry, genetics and molecular biology studies (Lindergben and Rumann, 1938; McClintock, 1945; Beadle and Tatum, 1945; Westergaard and Mitchell, 1947). N. crassa life cycle includes both sexual and asexual stages (Figure 1; Davis and Perkins, 2002). N. crassa sexual reproduction or teleomorphic stage involves the formation of protoperithecia (immature ascomata or fruiting bodies) after hyphal fusion of strains from complementary mating-types. Morphological changes and different phenomena of cell division occur during this process. Then perithecia (mature ascomata) are formed. Finally, maturation of asci happens by means of environmental changes and then ascospores are released (Mitchel, 1960). Asexual reproduction or anamorphic stage takes place when haploid ascospores (conidia) germinate and then a young mycelium develops. Mycelium differentiates reproductive structures called conidiophores where asexual mitospores (micro- and macroconidia) are generated. Conidia finally are disseminated.

29

General Introduction

Figure 1. Neurospora crassa life cycle (from Fungal Genetics Stock Centre; FGSC; http://www.fgsc.net/).

N. crassa genome sequencing (Galagan et al., 2003) and application of new generation sequencing (NGS) have provided the key tools to develop the N. crassa knock-out collection (Colot et al., 2006; Dunlap et al., 2007). This collection which is available at the Fungal Genetics Stock Centre (FGSC; McClusky, 2003) includes more than 10,000 null mutants of N. crassa nonessential genes. They can be used to undertake gene functional analyses in molecular genetics studies (Borkovich et al., 2004) and recently in massive transcriptomic analyses such as RNAseq (Gonçalves et al., 2015). These, in combination with the capability to generate crosses between different matingtypes allow the possibility of perform genetic and molecular studies. N crassa has therefore been used in this Thesis to investigate the mode of action of chitosan during germination (Chapter 2) and hyphal growth (Chapter 1).

30

General Introduction

3. Fungi and human diseases Human pathogenic fungi are the causal agents of important diseases (Brown et al., 2012). Primary pathogens cause infections and complete their lifecycles in healthy humans. Conversely, opportunistic pathogens cause infections mostly in immunocompromised (often due to HIV infections or surgery) patients. These infections could become systemic and be lethal. Infections caused by fungi in humans have a deep impact in our society. Superficial infections of skin and external organs (eyes or nostrils) affect approximately a quarter of the total population in the world (Havlickova et al., 2008). They are caused by dermatophytes and generally produce slight infections in wide variety of hosts. Some of them are associated with current changes in the lifestyle and ageing of the human population (Thomas et al., 2010). Mucous and genitals tracts of women are commonly affected by fungal infections (Naglik and Moyes, 2011). In fact, more than 50% of women worldwide suffer a fungal infection in their lifespan, generally by Candida spp. (Sobel, 2007). Infections caused by opportunistic fungi reach their maximum impact (high mortality rate) in poor countries with limited access to antifungal treatments and lack of sanitary services. In fact, more people die each year from the top fungal invasive diseases than from tuberculosis or malaria (Brown et al., 2012). This because, efficient diagnostic tests and safe and effective new drugs and vaccines, research into the pathophysiology of human fungal infections, lag behind that of diseases caused by other pathogens. 3.1. Filamentous fungi human pathogens Infections caused by filamentous fungi have increased dramatically in the first decade of the 21st century. Diagnoses of these infections are mainly form patients under chemotherapy or with a compromised immunological system (Bodey

et

al.,

1989;

Dening

1998).

Aspergillus spp.,

Fusarium spp.,

Paecilomyces spp., Scedosporium spp., Hamigera spp., Rhizopus spp. and Mucor spp. are amongst the main filamentous fungi isolated infecting humans 31

General Introduction

(Pfaller and Diekema, 2004). Some of these have been used in this work such as Fusarium proliferatum (Matsush.) Nirenberg, Aspergillus fumigatus (Fresenius), Hamigera avellanea (Thom and Turesson) Stolk and Samson, Rhizopus stolonifer (Ehrenb) Vuill. Fusarium spp. are well known plant pathogens and saprophytes. However, they are also human pathogens and are the second most frequent moulds causing invasive fungal infections in immunosuppressed patients associated with high morbidity and mortality rates (Alastruey-Izquierdo et al., 2008). Fusarium spp. cause important mycoses mainly in soft tissues. They are usually multiresistant to antifungals and their treatment requires combined application of several azoles and other drugs (Ferrer et al., 2005). The strain used in this Thesis was F. proliferatum. This was isolated form the retina of a patient with cataract surgery (Ferrer et al., 2005). A. fumigatus is the main cause of life-threatening invasive aspergillosis. It is an opportunistic saprotrophic fungus with a versatile metabolism that allows growth under various environmental conditions (Gibbons et al., 2012). This fungus infects human lungs causing pulmonary aspergillosis of a high mortality rate in immunocompromised patients (Singh and Paterson, 2005). Infections caused by A. fumigatus cost ca. 1 million of dollars per year in the USA (Tong et al., 2009). Invasive aspergillosis starts from conidia inhaled during respiration, which thus reach the bronchioles in the lung. There the fungus meets an adequate environment to develop and starts an invasive colonization of soft tissues (Dagenais and Keller, 2009). Early infections in healthy hosts are cleared by macrophages, unlike immunocompromised ones where the disease develops. H. avellanea is a common soil fungus phylogenetically close to Penicillium spp. and Aspergillus spp. (Peterson et al., 2010). H. avellanea produces antimicrobial secondary metabolites (Igarashi et al., 2014). Eventually, this

32

General Introduction

fungus has been detected in clinical infections (Houbraken et al. 2010). In fact, the H. avellanea strain used in this study was isolated form a blood sample (hemoculture) of a neonate. Rhizopus stolonifer is a zygomycete which infects mucous and soft tissues from immunocompromised patients (Ribes et al., 2000). The main source of infections by this fungus is via inhalation of spores from environmental sources. This fungus could cause systemic infections affecting the respiratory system and finally even the central nervous system (Reinhardt et al., 1984). The R. stolonifer strain used in this work is a from a periocular nasal fossa fat clinical sample. 3.2. Human pathogenic yeast Human massive infections (sepsis) are mainly caused by opportunistic Candida spp.

(mainly C. albicans). Infections caused by these microorganisms have

lately increased exponentially (Ruhnke, 2006). They are the main cause of infections in oral cavity and genitals, mainly in the vulva and in mucous membranes. Non-albicans Candida spp. account for 50% of Candida spp. infections in the USA (Miceli et al., 2011). Other opportunistic yeasts such as Cryptococcus

spp.

also

cause

important

infections

mainly

in

immunocompromised patients (Gibson and Johnstone, 2015).

33

General Introduction

Yeast human pathogens used in this work are: -

Candida spp. (Ascomycota): C. albicans (C.P. Robin) Berkhout, C. glabrata (H.W. Anderson) S.A. Mey. & Yarrow. C. krusei (Castell.) Berkhout, C. parapsilosis (Ashford) Langeron & Talice.

-

Cryptococcus spp. (Basidiomycota): C. neoformans (San Felice) Vuill, C. gattii (Vanbreus. & Takashio) Kwon-Chung & Boekhout.

3.2.1. Candida spp. C. albicans is a dimorphic diploid ascomycete, which forms yeast cells and hyphae. The incidence of candidiasis by this species increases with chemotherapy treatments, HIV infections or transplants. This yeast shows a high polymorphism allowing infection of tissues under a wide range of conditions (Mayer et al., 2013). C. albicans pathogenicity is determined by a wide range of virulence factors. Biofilm formation and secretion of hydrolases during infection are two examples (Mayer et al., 2013). Sepsis caused by this yeast has a good prognosis, since several antifungals (eg. azoles, echinocandins or polyenes) are successful controlling C. albicans infections (Moudgal and Sovel, 2010). C. glabrata is a haploid ascomycete. The frequency of infections caused by this yeast has increased in the last years and it is considered the second cause of candidiasis after C. albicans (Fidel et al., 1999). C. glabrata infections are difficult to control because the yeast is resistant to commonly used antifungals such as fluconazole or itraconazole (Moudgal and Sovel, 2010). C. krusei is an emerging yeast nosocomial pathogen. Infections caused by this microorganism affect mainly patients with immunological shortcomings and haematological malignancies. Infections by this species reach higher mortality rates than those by C. albicans (Hautala et al., 2007). This yeast is a

34

General Introduction

multidrug-resistant pathogen found in patients overexposed to commonly used antifungals (Pfaller et al., 2008). C. parapsilosis is an opportunistic yeast pathogen. Infections caused by this yeast show maximum impact in immunocompromised patients. This yeast has mechanisms of pathogenicity similar to those of C. albicans such as biofilm formation and secretion of hydrolytic enzymes (Trofa et al., 2008). C. parapsilosis infections can be treated with commonly used antifungals (Moudgal and Sobel, 2010). 3.2.2. Cryptococcus spp. C. neoformans is also an opportunistic yeast human pathogen. It is an obligated aerobic microorganism. C. neoformans capsule plays a determinant role during infections (Zaragoza et al., 2009). Modification of cell wall polysaccharides and secretion of hydrolytic enzymes are also indispensable for C. neoformans pathogenicity (Del Poeta, 2004; Alspaugh, 2015). Nevertheless, this species is susceptible to currently used antifungals and resistant strains are uncommon (Archibald et al., 2004). C. gattii causes important pulmonary infections by inhalation of yeast cells or spores. Capsule formation as well as production of laccases and other hydrolytic enzymes together with melanin synthesis is essential determinants of pathogenicity for this yeast (Chen et al., 2014). The use of currently used antifungals in a synergistic combination is the appropriate strategy to control infections caused by this yeast (Trilles et al., 2004). 3.3. Antifungal crisis The incidence of microbial infections in humans has been dramatically rising for the last decades. This is mainly due to the increasing number of patients suffering from immunosuppressive infections or diseases, such as AIDS or leukemia (Denning 1991; Denning 1998; Dupont et al., 2000; Marr et al., 2002)

35

General Introduction

or the immunosuppressive side effects of cancer chemotherapeutics (Zitvogel et al., 2008). Furthermore, advanced and sophisticated medical treatments that suppress the immune system of severely compromised patients prolong their lives at the costs of an elevated risk for microbial infections even with low virulence organisms (Hibberd and Rubin, 1994; Vanholder and Van Biesen, 2002; Walsh and Pizzo, 1988). Pathogenic microorganisms becoming resistant to conventional drugs are sharply increasing due to intrinsic primary resistance or the development of secondary resistance as a result of long term antimicrobial therapies (Sefton, 2002). The generation of new antifungal drugs encounters major obstacles because host and invading fungal organisms show high cellular, physiological and metabolic similarities. Therefore, new and cost effective strategies are needed to combat fungal attack, and novel antimycotics that target unique structures or functions of fungi but lack severe side effects for the infected host are urgently needed (Gupte et al., 2002; Steinbach and Perfect, 2003). This section (3.3) has been published as a part of Lopez-Moya F. and LopezLlorca LV. 2016. J. Fungi 2016, 2(1), 11.

4. Plant pathogenic fungi Fungi are the most important plant pathogens, causing significant economic crop losses worldwide (Talbot, 2003). The five main crops grown globally, based on their production and economic relevance are maize, rice, wheat, potatoes and sugar beet (FAO, 2014). All of them are affected by fungal infections which reduce both their yield and quality. The impacts of these infections are estimated as 26–29% losses for soybean, wheat and cotton, and 31, 37 and 40% for maize, rice and potatoes, respectively (Oerke, 2006). Plant pathogenic fungi belong to three main nutritional strategies (Agrios, 2005): biotrophs, hemibiotrophs and necrotrophs.

36

General Introduction

Biotrophic pathogens require living plant tissues for survival and completion of their lifecycles. Hemibiotrophs first act as biotrophs, then kill the plant tissues they colonize and finally complete their development in them. Both groups of fungi express specific proteins to block plant immunity by secreting specific proteins called effectors (Koeck et al., 2011). Necrotrophic fungi kill plant tissues (by means of toxins) and then use them as nutrient source. 4.1. Magnaporthe oryzae: The Rice blast fungus Rice is essential for food security in Asia where more than 80% of the crop is grown and consumed, and the overwhelming majority of mankind also lives (Talbot, 2003). This crop is part of the daily food of more than three billion people. The quick increase in the population generates the need to enhance agriculture of some crops such as rice. This development together with the abusive use of pesticides propitiates generation of resistance in fungal pathogens. Rice harvest (10% to 30% of the annual) is lost due to infection mainly caused by the rice blast fungus Magnaporthe oryzae (Skamnioti and Gurr, 2009). M. oryzae starts its infection process when conidia of the fungus lands on the surface of a rice leaf (Figure 2). Conida attachment to the hydrophobic cuticle is mediated by adhesins. Then M. oryzae germinates producing a germ tube, which after morphological and physiological modifications differentiates into

a

specialised

structure

called

appressorium.

The

single-celled

appressorium matures by accumulation of osmotic pressure and the threecelled spore collapses in a process of programmed cell death (Veneault-Fourrey et al., 2006). The appressorium becomes melanised and generates high turgor pressure by glycerol accumulation (de Jong et al., 1997). Appressorium differentiation and maturation is a tightly regulated developmental process (Zhang et al., 2011). NADPH oxidases (main source for reactive oxygen species)

37

General Introduction

causing an oxidative burst (Ryder et al., 2013; Samalova et al., 2014) and genes related with cytoskeleton organization (actin and septins) are essential for M. oryzae pathogenicity (Egan et al., 2006; Dagdas et al., 2012).

Figure 2. Magnapothe oryzae life cycle (Modified from http://www.exeter.ac.uk/nicktalbot/lifecycle/)

These physiological changes generate physical force and a penetration peg which finally penetrates the leaf epidermis. Plant tissue colonization occurs by means of bulbous, invasive hyphae, 8-10 h after appressorium differentiation. Disease lesions occur between 72 and 96 h after infection. From these conidiation occurs under humid conditions. Conidia are then disseminated and infect healthy rice plants (Figure 2). New disease control strategies are required for rice blast control. The incidence of infections caused by this fungus achieves enormous impact in Asia where this crop the main food source (Skamnioti and Gurr, 2009).

38

General Introduction

Excessive use of fungicides and genetic plasticity showed by this fungus has resulted in the emergence of M. oryzae strains resistant to chemical fungicides. There are evidences that a M. oryzae strain could be the cause of a recent outbreak of wheat blast in Bangladesh (Callaway, 2016). Research of this project will provide information on a potential new strategy for rice blast control based on the use of chitosan, a natural antifungal compound.

5. Chitosan Chitosan (Figure 3) is a linear polymer of beta-(1-4)-linked N-acetyl-2-amino-2deoxy-D-glucose

(acetylated,

A-unit)

and

2-amino-2-deoxy-D-glucose

(deacetylated, D-units; Kaur and Dhillon, 2014). It is generally obtained by partial deacetylation of chitin (Kumar, 2000). Chitin is the second most abundant polymer in nature after cellulose. Chitin is a key component of the cuticle of crustaceans and insects, the cell wall of true fungi and that of some algae (Kaur and Dhillon, 2014). Deacetylation of chitin by enzymatic or chemical processes generates chitosan (Kumar, 2000). The main sources of chitosan production for commercial applications are marine crustaceans (mainly shrimps). To obtain chitosan chemically, crustacean cuticles are treated with strong acids (HCl) for demineralization. These shells are treated with NaOH to remove proteins (deproteinization) and then chitin is obtained. Chitin is finally deacetylated by a strong base (NaOH) to yield chitosan (Younes and Rinaudo, 2015). Chitosan can also be produced using enzymatic methods. Chitin deacetylases generate chitosan from chitin. Patterns of deacetylation may be modified by activity of a combination of chitin oligosaccharides deacetylases (Hamer et al., 2015). Degree of deacetylation and molecular weight are crucial biophysical parameters for chitosan bioactivity. Chitosans usually have a degree of deacetylation of less than 90% (Kumar, 2000). Molecular weight is defined by the number of N-acetyl glucosamine subunits in the molecule (Kumar, 2000). Large-Mid (70-100 kDa) Mw chitosans are soluble in

39

General Introduction

weak acid solutions (hydrochloric acid, citric acid, acetic acid). Only chitosan oligosaccharides (5000 Da) are water soluble. Chitosan in solution displays positive charges for the protonation of its amino groups. Both positive charge and amenability to structural modifications confer chitosan numerous biological properties. A wide variety of industries use chitosan with different applications. During the last decades chitosan has been used in pharmacology for drug-delivery (Kumar, 2000) or as a source of biomaterials to generate nanofibers or nanoparticles (Acosta et al., 2015).

Figure 3. Chitosan, chitin and cellulose molecular structures (Ifuku, 2014). (Taken from Molecules).

5.1. Chitosan as antimicrobial agent Chitosan is a versatile compound with antimicrobial activity (Allan and Hadwinger, 1979). A wide number of studies have been developed to investigate the mode of action of chitosan (Kong et al., 2010; Park et al., 2008; Raafat et al., 2008). Chitosan affects germination and hyphal morphology of post-harvest fungal pathogens such as Rhizopus stolonifer and Botrytis cinerea (El Ghaouth et al., 1991). Chitosan also inhibits fungal growth of many other plant pathogenic fungi (Palma-Guerrero et al., 2008) and mycoparasitic fungi (Zavala-Gonzalez et al. 2016). Chitosan has also a great potential as antifungal agent to treat diseases caused by human pathogenic fungi (Calamari et al., 2011; Kulikov et al., 2014; Peña et al., 2013 and Younes et al., 2014). On the contrary, biocontrol fungi

40

General Introduction

(Nematophagous and Entomopathogenic fungi) are resistant to chitosan (Palma-Guerrero et al., 2008). Chitosan affects sensitive fungi permeabilizing their plasma membranes in an energy dependent manner (Palma-Guerrero et al., 2009).

These sensitive fungi have high-fluidity membranes (large

polyunsaturated free fatty acid content) with which chitosan can interact (Palma-Guerrero et al., 2010a; Zavala-Gonzalez et al. 2016). Chitosan also displays antibiotic activity against bacteria (Je and Kim, 2006; Raafat et al., 2008; Tang et al., 2010). Permeabilization of plasma and intracellular membranes of bacteria by chitosan has also been reported (Je and Kim, 2006). 5.2. Chitosan as a gene modulator of biocontrol fungi Chitosan can be combined with tolerant fungi such as Biocontrol fungi (BCF). BCF can degrade chitosan using it as a nutrient source (Palma-Guerrero et al., 2008). Nematophagous fungi such as Pochonia chlamydosporia are able to survive under high doses of chitosan. The genome of this fungus (Larriba et al., 2014) has revealed an expansion in the families of hydrolases reflecting its multitrophic (saprotrophic, endophytic, nematophagous) behaviour. This fungus encodes enzymes involved in its capacities to degrade chitosan such as chitosanases (Larriba et al., 2014). Proteomics reveals that chitosan alone induces expression of VCP1 serine protease, a putative pathogenic factor of P. chlamydosporia to infect nematode eggs (Palma-Guerrero et al., 2010b). Chitosan also induces expression of VCP1 and SCP1 (a serine carboxypeptidase) in appressoria of P. chlamydosporia infecting root-knot nematode eggs, enhancing infection (Escudero et al., 2016). Chitosan has also been found to increase sporulation of BCF (P. chlamydosporia and Beauveria bassiana; Palma-Guerrero et al., 2008). The potential use of chitosan in combination with BCF opens new environmental friendly possibilities to manage diseases caused by nematodes or insects.

41

General Introduction

This section (5.2) has been published as a part of Lopez-Moya F. and LopezLlorca LV. 2016. J. Fungi, 2016, 2(1), 11. 5.3. Agro-biotechnological applications of chitosan Chitosan is a polymer with wide use in agriculture on pre- and postharvest treatments of crops to control microbial infections (El Hadrami et al., 2010). Application of chitosan to plants protects them against infections caused by important plant pathogenic fungi such as Botrytis cinerea or Fusarium oxysporum f.

sp. radicis-lycopersici

(Lafontaine

and

Benhamou,

1996;

Muzzarelli et al., 2001; Rabea et al., 2005). This polymer also displays promising effects on plants as stimulating seed germination and growth of seedlings of ornamental plants (Kananont et al., 2010; Ohta et al., 1999). Chitosan has mainly been applied in agriculture as an elicitor of plant defences in crops with worldwide economical and agronomical importance such as tomato (ElTantawy, 2009; Iriti and Faoro 2009).

However, the mode of action of

chitosan as

compound

and

gene

modulator

has

not

Furthermore,

the

wide

capabilities

of

this

been

an

antifungal

fully investigated.

polymer to control fungal infection, as enhancer of biocontrol fungi and its capability to induce plants defences make chitosan an attractive subject of research. This PhD Thesis

opens

new

possibilities

agrobiotechnological applications of chitosan.

42

for

medical

and

General Introduction

GENERAL INTRODUCTION REFERENCES Acosta N, Sánchez E, Calderón L, Cordoba-Diaz M, Cordoba-Diaz D, Dom S, Heras Á. 2015. Physical Stability Studies of Semi-Solid Formulations from Natural Compounds Loaded with Chitosan Microspheres. Mar Drugs. 13(9): 5901-5919. Agrios GN, 2005. Plant Pathology, 5th edition. Elsevier Academic Press. Allan CR, Hadwiger LA. 1979. The fungicidal effect of chitosan on fungi of varying cell wall composition. Exp Mycol. 3 (3): 285-287. Alastruey-Izquierdo A, Cuenca-Estrella M, Monzón A, Mellado E, RodríguezTudela JL. 2008. Antifungal susceptibility profile of clinical Fusarium spp. isolates identified by molecular methods. J Antimicrob Chemother. 61(4): 805-809. Alspaugh JA. 2015. Virulence mechanisms and Cryptococcus neoformans pathogenesis. Fun Gen Biol. 78: 55-58. Archibald LK, Tuohy MJ, Wilson DA, et al. 2004. Antifungal Susceptibilities ofCryptococcus neoformans. Emerging Infectious Diseases. 10(1):143145. Beadle GW and Tatum EL, 1945. Neurospora. II. Methods of Producing and Detecting Mutations Concerned with Nutritional Requirements. Am J Bot. 32(10): 678-686. Bodey GP, Vartivarian S. 1989. Aspergillosis. Eur J Clin Microbiol Infect Dis. 8: 413-37. Borkovich KA, Alex LA, Yarden O, Freitag M, Turner GE, Read ND, Seiler S, Bell-Pedersen

D, Paietta

J, Plesofsky

N, Plamann

M, Goodrich-

Tanrikulu M,Schulte U, Mannhaupt G, Nargang FE, et al. 2004. Lessons from the genome sequence of Neurospora crassa: tracing the path from

43

General Introduction

genomic blueprint to multicellular organism. Microbiol Mol Biol Rev. 68(1): 1-108. Brown GD, Denning DW, Gow NA, Levitz SM, Netea MG, White TC. 2012. Hidden killers: human fungal infections. Sci Transl Med. 4(165): 165rv13. Brundrett MC. 2002. Coevolution of roots and mycorrhizas of land plants. New Phytol. 154(2): 275-304. Calamari S, Bojanich M, Barembaum S, Berdicevski N, Azcurra A. 2011. Antifungal and post-antifungal effects of chlorhexidine, fluconazole, chitosan and its combinations on Candida albicans. Med Oral Patol Oral Cir Bucal. 16(1): e2-e28. Callaway E. 2016. Devastating wheat fungus appears in Asia for first time. Nature. 532: 421-422. Chen SC-A, Meyer W, Sorrell TC. 2014. Cryptococcus gattii Infections. Clin Microb Rev. 27(4): 980-1024. Colot HV, Park G, Turner GE, Ringelberg C, Crew CM, Litvinkova L, Weiss RL, Borkovich KA, Dunlap JC. 2006. A high-throughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors. Proc Natl Acad Sci USA 103: 10352-10357. Crowther TW, Boddy L, Hefin Jones T. 2012. Functional and ecological consequences of saprotrophic fungus-grazer interactions. ISME J. 6(11): 1992-2001. Dagenais TRT, Keller NP. 2009. Pathogenesis of Aspergillus fumigatus in Invasive Aspergillosis. Clin Microbiol Rev. 22(3): 447–465.

44

General Introduction

Dagdas YF, Yoshino K, Dagdas G, Ryder LS, Bielska E, Steinberg G, Talbot NJ. 2012. Septin-mediated plant cell invasion by the rice blast fungus, Magnaporthe oryzae. Science. 336(6088): 1590-1595. Davis RH, Perkins DD. 2002. Neurospora: a model of model microbes. Nat Rev Genet. 3(5): 397-403. de Jong JC, McCormack BJ, Smirnoff N, Talbot NJ. 1997. Glycerol generates turgor in rice blast. Nature. 389: 244. Del Poeta M. 2004. Role of Phagocytosis in the Virulence of Cryptococcus neoformans. Eukaryot Cell. 3(5): 1067–1075. Denning DW. 1991. Epidemiology and pathogenesis of systemic fungal infections in the immunocompromised host. J. Antimicrob. Chemother. 28: 1–16. Denning DW. 1998. Invasive aspergillosis. Clin Infect Dis. 26: 781-803 Dunlap JC, Borkovich KA, Henn MR, Turner GE, Sachs MS, Glass NL, McCluskey K, Plamann M, Galagan JE, Birren BW, Weiss RL, Townsend JP, Loros JJ, Nelson MA, Lambreghts R, et al. 2007. Enabling a community to dissect an organism: overview of the Neurospora functional genomics project. Adv Genet. 57: 49-96. Dupont B, Crewe Brown HH, Westermann K., Martins MD, Rex JH, Lortholary O, Kauffmann CA. 2000. Mycoses in AIDS. Med Mycol. 38: 259–267. Egan MJ, Wang ZY, Jones MA, Smirnoff N, Talbot NJ 2007. Generation of reactive oxygen species by fungal NADPH oxidases is required for rice blast disease. Proc. Natl. Acad. Sci. USA. 104(28): 11772-11777.

45

General Introduction

El Ghaouth A, Arul J, Grenier J, Asselin A. 1991. Antifungal activity of chitosan on two postharvest pathogens of strawberry fruits. Phytopathology. 82: 398-402. El Hadrami A., Adam, L. R., Hadrami, El, I., and Daayf, F. (2010). Chitosan in Plant Protection. Marine Drugs. 8(4): 968–987. El-Tantawy EM. 2009. Behavior of tomato plants as affected by spraying with chitosan and aminofort as natural stimulator substances under application of soil organic amendments. Pak J Biol Sci. 12(17): 1164-1173. Escudero N, Ferreira SR, Lopez-Moya F, Naranjo-Ortiz MA, Marin-Ortiz MI, Thorton CR, Lopez-Llorca LV. 2016. Chitosan enhances parasitism of Meloidogyne javanica eggs by the nematophagous fungus Pochonia chlamydosporia. Fun Biol. 120(4): 572-585. Ferrer C, Alio J, Rodriguez A, Andreu M, Colom F. 2005. Endophthalmitis caused by Fusarium proliferatum. J Clin Microbiol. 43(10): 5372-5375. Fidel PL Jr, Vazquez JA, Sobel JD. 1999. Candida glabrata: review of epidemiology, pathogenesis, and clinical disease with comparison to C. albicans. Clin Microbiol Rev. 12(1): 80-96. Food and agricultural organization of the United Nations (FAO). 2014. http://faostat3.fao.org/home/E Galagan JE, Calvo SE, Borkovich KA, Selker EU, Read ND, Jaffe D, FitzHugh W, Ma LJ, Smirnov S, Purcell S, Rehman B, Elkins T, Engels R, Wang S, Nielsen CB, et al. 2003. The genome sequence of the filamentous fungus Neurospora crassa. Nature. 422(6934): 859-868. Gibbons JG, Beauvais A, Beau R, McGary KL, Latgé J-P, et al. 2012. Global transcriptome changes underlying colony growth in the opportunistic human pathogen Aspergillus fumigatus. Eukaryot Cell. 11: 68–78

46

General Introduction

Gibson JF, Johnston SA. 2015. Immunity to Cryptococcus neoformans and C. gattii during cryptococcosis. Fungal Genet Biol. 78: 76-86. Gonçalves AP, Silva N, Oliveira C, Kowbel DJ, Glass NL, Kijjoe A, Pameira A, Sousa e, Pinto M, Videira A. 2015. Transcription profiling of the Neurospora crassa response to a group of synthetic (thio)xanthones and a natural acetophenone. Genomics Data. 4: 26-32. Gupte M, Kulkarni P, Ganguli BN. 2002. Antifungal antibiotics. Appl. Microbiol Biotechnol. 58: 46–57. Hamer

SN, Cord-Landwehr

S, Biarnés

X, Planas

A, Waegeman

H, Moerschbacher BM, Kolkenbrock S. 2015. Enzymatic production of defined chitosan oligomers with a specific pattern of acetylation using a combination of chitin oligosaccharide deacetylases. Sci Rep. 3(5): 8716. Hautala T, Ikäheimo I, Husu H, Säily M, Siitonen T, Koistinen P, VuopioVarkila J, Koskela M, Kujala P. 2007. A cluster of Candida krusei infections in a haematological unit. BMC Infect Dis. 22(7): 97. Havlickova B, Czaika VA, Friedrich M. 2008. Epidemiological trends in skin mycoses worldwide. Mycoses. 51 Suppl 4: 2-15. Hawksworth DL. 1991. The fungal dimension of biodiversity: magnitude, significance, and conservation. Mycol Res. 95: 641-655. Hawksworth DL, Kirk PM, Sutton BC, Pegler DN. 1995. Ainsworth and Bisby's Dictionary of the Fungi (8th Ed.). CAB International, Wallingford, United Kingdom. 616p. Hibberd P, Rubin RH. 1994. Clinical aspects of fungal infection in organ transplant recipients. Clin Infect Dis. 19: S33–S40.

47

General Introduction

Houbraken J, Verweij PE, Rijs AJ, Borman AM, Samson RA. 2010. Identification of Paecilomyces variotii in clinical samples and settings. J Clin Microbiol. 48(8): 2754-61. Ifuku S. 2014. Chitin and chitosan nanofibers: preparation and chemical modifications. Molecules 19(11): 18367-80. Igarashi Y, Hanafusa T, Gohda F, Peterson S, Bills G. 2014. Species-level assessment of secondary metabolite diversity among Hamigera species and a taxonomic note on the genus. Mycology 5(3): 102–109. Iriti M, Faoro F. 2009. Bioactivity of grape chemicals for human health. Nat Prod Commun. 4(5): 611-34. James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, Cox CJ, Celio G, Gueidan C, Fraker E, Miadlikowska J, Lumbsch HT, Rauhut A, Reeb V, Arnold AE,Amtoft A, Stajich JE, et al. 2006. Reconstructing the early evolution of Fungi using a six-gene phylogeny. Nature. 443(7113): 818822. Je JY, Kim SK. 2006. Chitosan derivatives killed bacteria by disrupting the outer and inner membrane. J Agric Food Chem. 54(18): 6629-33. Kananont N, Pichvangkura R, Chanprame S, Chadchawan S, Limpanavech P. 2010. Chitosan specificity for the in vitro seed germination of two Dendrobium orchids (Asparagales: Orchidaceae). Sci Hortic. 124(2): 239247. Kaur S, Dhillon GS. 2014. The versatile biopolymer chitosan: potential sources, evaluation

of

extraction

methods

and

applications.

Crit

Rev

Microbiol. 40(2): 155-75. Koeck M, Hardham AR, Dodds PN. 2011. The role of effectors of biotrophic and hemibiotrophic fungi in infection. Cell Microbiol. 13(12): 1849-57.

48

General Introduction

Kulikov SN, Lisovskaya SA, Zelenikhin PV, Bezrodnykh EA, Shakirova DR, Blagodatskikh

IV,

Tikhonov

VE.

2014.

Antifungal

activity

of

oligochitosans (short chain chitosans) against some candida species and clinical

isolates

of

Candida

albicans:

Molecular

weight-activity

relationship. Europ J Med Chem. 74: 169-178. Kumar RMNV, 2000. A review of chitin and chitosan applications. React Funct Polym. 46 (1): 1-27. Kong M, Chen XG, Xing K, Park HJ.2010. Antimicrobial properties of chitosan and mode of action: a state of the art review. Int J Food Microbiol. 144(1): 51-63. Lafontaine JP, Benhamou N. 1996. Chitosan treatment: an emerging strategy for enhancing resistance of greenhouse tomato plants to infection by Fusarium oxysporum f. sp. radicis-lycopersici. Biocontrol Sci Technol. 6: 111–124. Larriba E, Jaime MDLA, Carbonell-Caballero J, Conesa A, Dopazo J, Nislow C, Martín-Nieto J, Lopez-Llorca LV. 2014. Sequencing and functional analysis of the genome of a nematode egg-parasitic fungus, Pochonia chlamydosporia. Fungal Genet Biol., 65: 69-80 Lindergben CC and Rumann S. 1938. The chromosomes of Neurospora crassa. J Genet. 36: 393- 404. Lopez-Moya F, Lopez-Llorca LV. 2016. Omics for Investigating Chitosan as an Antifungal

and

Gene

Modulator.

J

Fungi. 2(1):

11.

doi:10.3390/jof2010011 Lowe RG, Howlett BJ. 2012. Indifferent, affectionate, or deceitful: lifestyles and secretomes of fungi. PLoS Pathog. 8(3): e1002515.

49

General Introduction

Lutzoni F, Kauff F, Cox CJ, McLaughlin D, Celio G, Dentinger B, Padamsee M, Hibbett

D, James

TY, Baloch

E, Grube

M, Reeb

V, Hofstetter

V, Schoch C, Arnold AE, Miadlikowska J, et al. 2004. Assembling the fungal tree of life: progress, classification, and evolution of subcellular traits. Am J Bot. 91(10): 1446-80. Maddison, D. R. and Schulz, K.-S. (eds.) 2007. The Tree of Life Web Project. Internet address: http://tolweb.org. Marr KA, Carter RA, Crippa F, Wald A, Corey L. 2002. Epidemiology and outcome of mold infections in hematopoietic stem cell transplant recipients. Clin Infect Dis. 34: 909–917. Mayer FL, Wilson D, Hube B. 2013. Candida albicans pathogenicity mechanisms. Virulence. 15; 4(2): 119-128. Miceli MH, Díaz JA, Lee SA. 2011. Emerging opportunistic yeast infections. Lancet Infect Dis. 11(2): 142-151. Mitchel MB. 1960. Ascus formation and recombinant frequencies in Neurospora crassa. Genetics. 45(5): 507-517 McClintock

B.

1945.

Neurospora.

I.

Preliminary

observations

of

the

chromosomes of Neurospora crassa. Am J Bot. 32: 671–678. McCluskey K. 2003. The Fungal Genetics Stock Center: from molds to molecules. Adv Appl Microbiol. 52: 245–262. Moudgal V, Sobel J. 2010. Antifungals to treat Candida albicans. Expert Opin Pharmacother. 11(12): 2037-48. Naglik J, Moyes DL. 2011. Mucosal immunity and Candida albicans infection. Clin Dev Immunol. doi:10.1155/2011/346307. Oerke EC. 2006. Crop losses to pest. J Agr Sci. 144: 31-43.

50

General Introduction

Ohta K, Taniguchi A, Konishi N, Hosoki T. 1999. Chitosan treatment affects plant growth and flower quality in Eustoma grandiflorum. HortScience. 34(2): 233–234. Palma-Guerrero J, Jansson HB, Salinas J, Lopez-Llorca LV. 2008. Effect of chitosan on hyphal growth and spore germination of plant pathogenic and biocontrol fungi. J Appl Microbiol. 104(2): 541-53. Palma-Guerrero J, Huang I, Jansson HB, Salinas J, Lopez-Llorca LV, Read ND. 2009. Chitosan permeabilizes the plasma membrane and kills cells of Neurospora crassa in an energy dependent manner. Fun Genet Biol. 46(8): 585-594. Palma-Guerrero J, Lopez-Jimenez J, Pérez-Berná AJ, Huang IC, Jansson HB, Salinas J, Villalaín J, Read ND, Lopez-Llorca LV. 2010a. Membrane fluidity determines sensitivity of filamentous fungi to chitosan. Mol Microbiol. 75(4): 1021-1032. Palma-Guerrero J, Gómez-Vidal S, Tikhonov VE, Salinas, J, Jansson HB, LopezLlorca LV. 2010b. Comparative analysis of extracellular proteins from Pochonia chlamydosporia grown with chitosan or chitin as main carbon and nitrogen sources. Enzyme Microb Tech. 46: 568–574. Park Y, Kim MH, Park SC, Cheong H, Jang MK, Nah JW, Hahm KS. 2008. Investigation of the antifungal activity and mechanism of action of LMWS-chitosan. J Microbiol Biotechnol. 18(10): 1729-1734. Peña A, Sánchez NS, Calahorra M. 2013. Effects of chitosan on Candida albicans: Conditions for its antifungal activity. BioMed Research International. doi.org/10.1155/2013/527549.

51

General Introduction

Peterson SW, Jurjevic Z, Bills GF, Stchigel AM, Guarro J, Vega FE. 2010. Genus Hamigera, six new species and multilocus DNA sequence based phylogeny. Mycologia. 102(4): 847-864. Pfaller MA, Diekema DJ. 2004. Rare and emerging opportunistic fungal pathogens: concern for resistance beyond Candida albicans and Aspergillus fumigatus. J Clin Microbiol. 42(10): 4419-4431. Pfaller MA, Diekema DJ, Gibbs DL, Newell VA, Nagy E, Dobiasova S, Rinaldi M, Barton R, Veselov A; Global Antifungal Surveillance Group. 2008. Candida krusei, a multidrug-resistant opportunistic fungal pathogen: geographic and temporal trends from the ARTEMIS DISK Antifungal Surveillance Program, 2001 to 2005. J Clin Microbiol. 46(2): 515-521. Prieto M, Wedin M. 2013. Dating the diversification of the major lineages of Ascomycota (Fungi). PLoS One. 8(6): e65576. Raafat D, von Bargen K, Haas A, Sahl HG. 2008. Insights into the mode of action of chitosan as an antibacterial compound. Appl Environ Microbiol. 74(12): 3764-3773. Rabea EI, El Badawy MT, Rogge TM, Stevens CV, Höfte M, Steurbaut W, Smagghe G. 2005. Insecticidal and fungicidal activity of new synthesized chitosan derivatives. Pest Manag Sci. 61: 951–960. Reinhardt DJ, Licata I, Kaplan W, Ajello L, Chandler FW, Ellis JJ.

1981.

Experimental cerebral zygomycosis in alloxan-diabetic rabbits: variation in virulence among zygomycetes. Sabouraudia 19: 245–255. Ribes JA, Vanover-Sams CL, Baker DJ. 2000. Zygomycetes in human disease. Clin Microbiol Rev. 13(2): 236-301. Robbertse B, Reeves J, Schoch C, Spatafora JW. 2006. A phylogenomic analysis of the Ascomycota. Fun Genet Biol. 43: 715-725.

52

General Introduction

Ruhnke M. 2006. Epidemiology of Candida albicans infections and role of nonCandida-albicans yeasts. Curr Drug Targets. 7(4): 495-504. Ryder LS, Dagdas YF, Mentlak TA, Kershaw MJ, Thornton CR, Schuster M, Chen J, Wang Z, Talbot NJ. 2013. NADPH oxidases regulate septinmediated cytoskeletal remodelling during plant infection by the rice blast fungus. Proc Natl Acad Sci U S A. 110(8): 3179-84. Samalova M, Meyer AJ, Gurr SJ, Fricker MD. 2014. Robust anti-oxidant defences in the rice blast fungus Magnaporthe oryzae confer tolerance to the host oxidative burst. New Phytol. 201(2): 556-73. Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W; Fungal

Barcoding

Consortium; Fungal

Barcoding

Consortium

Author List. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci USA. 109(16): 6241-6246. Sefton AM. 2002. Mechanisms of antimicrobial resistance: Their clinical relevance in the new millennium. Drugs. 62: 557–566. Singh N, Paterson DL. 2005. Aspergillus Infections in Transplant Recipients. Clin Microbiol Rev. 18(1): 44–69. Skamnioti P, Gurr SJ. 2009. Against the grain: safeguarding rice from rice blast disease. Trends Biotechnol. 27(3): 141-50. Sobel JD. 2007. Vulvovaginal candidosis. Lancet. 369(9577): 1961-1971. Steinbach WJ, Perfect JR. 2003. Newer antifungal therapy for emerging fungal pathogens. Int J Infect Dis. 7: 5–20. Talbot NJ. 2003. On the trial of a cereal killer: Exploring the biology of Magnaporthe grisea. Ann Rev Microbiol. 57: 177–202.

53

General Introduction

Thomas J, Jacobson GA, Narkowicz CK, Peterson GM, Burnet H, Sharpe C. 2010. Toenail onychomycosis: an important global disease burden. J Clin Pharm Ther. 35(5): 497-519. Tong KB, Lau CJ, Murtagh K, Layton AJ, Seifeldin R. 2009. The economic impact of aspergillosis: analysis of hospital expenditures across patient subgroups. Int J Infect Dis. 13(1): 24-36. Trilles L, Fernández-Torres B, dos Santos Lazéra M, Wanke B, Guarro J. 2004. In Vitro Antifungal Susceptibility of Cryptococcus gattii. J Clin Microb. 42(10): 4815-4817. Trofa D, Gácser A, Nosanchuk JD. 2008. Candida parapsilosis, an emerging fungal pathogen. Clin Microbiol Rev. 21(4): 606-625. Vanholder R; Van Biesen W. 2002. Incidence of infectious morbidity and mortality in dialysis patients. Blood Purif. 20: 477–480. Veneault-Fourrey

C, Barooah

M, Egan

M, Wakley

G, Talbot

NJ.

2006.

Autophagic fungal cell death is necessary for infection by the rice blast fungus. Science. 312(5773): 580-583. Walsh TJ, Pizzo A. 1988. Treatment of systemic fungal infections: Recent progress and current problems. Eur J Clin Microbiol Infect. Dis. 7: 460– 475. Westergaard M and Mitchell HK, 1947. Neurospora V. A Synthetic Medium Favoring Sexual Reproduction. Am J Bot. 34, (10): 573-577. Younes I, Sellimi S, Rinaudo M, Jellouli K, Nasri M. 2014. Influence of acetylation degree and molecular weight of homogeneous chitosans on antibacterial and antifungal activities. Int J Food Microbiol. 185: 57-63.

54

General Introduction

Younes I, Rinaudo M. 2015. Chitin and Chitosan Preparation from Marine Sources. Structure, Properties and Applications. Mar Drugs. 13(3): 1133– 1174. Zaragoza O, Rodrigues ML, De Jesus M, Frases S, Dadachova E, Casadevall A. 2009. The capsule of the fungal pathogen Cryptococcus neoformans. Adv Appl Microbiol. 68:133-216. Zavala-Gonzalez EA, Lopez-Moya F, Aranda-Martinez A, Cruz-Valerio M, Lopez-Llorca

LV,

Ramırez-Lepe

M.

2016. Tolerance

to

chitosan

by Trichoderma species is associated with low membrane fluidity. J Basic Microbiol. 56(7). doi:10.1002/jobm.201500758. Zhang H, Xue C, Kong L, Li G, Xu JR. 2011. A Pmk1-interacting gene is involved

in

appressorium

differentiation

and

plant

infection

in Magnaporthe oryzae. Eukaryot Cell. 10(8): 1062-1070. Zitvogel L, Apetoh L, Ghiringhelli F, Kroemer G. 2008. Immunological aspects of cancer chemotherapy. Nat Rev Immunol. 8: 59–73.

55

Objectives and Thesis Structure

OBJECTIVES AND STRUCTURE OF THIS PhD THESIS

The main objective of this PhD thesis is to study the inhibition of growth and development of fungi and plants by chitosan. We have analysed chitosan interactions with human and plant pathogenic fungi and the model fungus Neurospora crassa. This study is focused to develop chitosan as antifungal for clinical and agricultural use. We have also investigated the response of plants to chitosan with the aim of implementing its use in agricultural systems. For this study we have used the model plant Arabidopsis thaliana and crops of economic importance such as tomato. Both fungi and plant responses to chitosan have been analysed at physiological, cellular and molecular levels. This main objective can be sub-divided into the following specific objectives:  To evaluate the effect of nutrient limitation on the antifungal action of chitosan to important human fungal pathogens.  To

identify

chitosan

gene

targets

in

N.

crassa

using

transcriptomics and the deletion strain collection.  To study the effect of chitosan on M. oryzae appressorium differentiation and the role of the cytoskeleton during its pathogenicity.  To characterize the physiological and cellular responses of roots to chitosan and the key genes involved.

57

Objectives and Thesis Structure

PhD Thesis Structure This PhD Thesis is organized in 4 chapters. Chapters 1 and 2 have been published in indexed journals. Chapters 3 and 4 are manuscripts in preparation. Chapter 1. Federico Lopez-Moya, Maria F. Colom-Valiente, Pascual Martinez-Peinado, Jesus E. Martinez-Lopez, Eduardo Puelles, Jose M. Sempere-Ortells and Luis V. Lopez-Llorca. 2015. Carbon and nitrogen limitation increase chitosan antifungal activity in Neurospora crassa and fungal human pathogens. Fungal Biology. 119(2-3): 154-69.

Chapter 2. Federico Lopez-Moya, David Kowbel, Mª José Nueda, Javier Palma-Guerrero, N. Louise Glass and Luis Vicente Lopez-Llorca. Neurospora crassa transcriptomics reveals oxidative stress and plasma membrane homeostasis biology genes as key targets in response to chitosan. Molecular Biosystems. 12(2): 391-403.

Chapter 3. Federico Lopez-Moya, Mark D. Fricker, George Littlejohn, Luis V. Lopez-Llorca

and

Nicholas

J.

Talbot.

Chitosan

arrests

Magnaporthe oryzae appressorium differentiation affecting cytoskeletal remodelling. Manuscript in preparation. Chapter 4. Federico Lopez-Moya, Nuria Escudero, Ernesto A. ZavalaGonzalez, David Esteve-Bruna, Alfonso Prieto, Miguel A. Blázquez, David Alabadí and Luis V. Lopez-Llorca. Chitosan inhibits root growth altering hormone homeostasis and repressing quiescent center WOX5 gene expression. Manuscript in preparation.

58

PUBLISHED PAPERS

CHAPTER 1

Carbon and nitrogen limitation increase chitosan antifungal activity in Neurospora crassa and fungal human pathogens Federico Lopez-Moya1, Maria F. Colom-Valiente2, Pascual MartinezPeinado3, Jesus E. Martinez-Lopez4, Eduardo Puelles4, Jose M. Sempere-Ortells3 and Luis V. Lopez-Llorca1. 1Laboratory

of

Plant

Pathology,

Multidisciplinary

Institute

for

Environmental Studies (MIES) Ramon Margalef, Department of Marine Sciences and Applied Biology, University of Alicante, E-03080 Alicante, Spain.

2Laboratory

of Medical Mycology, Faculty of Medicine, Miguel

Hernández University, Sant Joan d’Alacant, Alicante, Spain. 3Department of Biotechnology, Immunology Division, University of Alicante, Alicante, Spain. 4Institute of Neurosciences, UMH-CSIC, Campus de San Juan, Av. Ramon y Cajal S/N, Sant Joan d´Alacant, 03550, Alicante, Spain.

Fungal Biology, 2015, 119 (2–3): 154–169

61

f u n g a l b i o l o g y 1 1 9 ( 2 0 1 5 ) 1 5 4 e1 6 9

journal homepage: www.elsevier.com/locate/funbio

Carbon and nitrogen limitation increase chitosan antifungal activity in Neurospora crassa and fungal human pathogens Federico LOPEZ-MOYAa,*, Maria F. COLOM-VALIENTEb, Pascual MARTINEZ-PEINADOc, Jesus E. MARTINEZ-LOPEZd, Eduardo PUELLESd, Jose M. SEMPERE-ORTELLSc, Luis V. LOPEZ-LLORCAa a Laboratory of Plant Pathology, Multidisciplinary Institute for Environmental Studies (MIES) Ramon Margalef, Department of Marine Sciences and Applied Biology, University of Alicante, E-03080 Alicante, Spain b Laboratory of Medical Mycology, Faculty of Medicine, Miguel Hernandez University, Sant Joan d’Alacant, Alicante, E-03550, Spain c Department of Biotechnology, Immunology Division, University of Alicante, Alicante, E-03080, Spain d Institute of Neurosciences, UMH-CSIC, Campus de San Juan, Avd. Ramon y Cajal s/n, Sant Joan d’Alacant, E-03550, Alicante, Spain

article info

abstract

Article history:

Chitosan permeabilizes plasma membrane and kills sensitive filamentous fungi and yeast.

Received 23 July 2014

Membrane fluidity and cell energy determine chitosan sensitivity in fungi. A five-fold re-

Received in revised form

duction of both glucose (main carbon (C) source) and nitrogen (N) increased 2-fold Neuros-

4 December 2014

pora crassa sensitivity to chitosan. We linked this increase with production of intracellular

Accepted 8 December 2014

reactive oxygen species (ROS) and plasma membrane permeabilization. Releasing N. crassa

Available online 24 December 2014

from nutrient limitation reduced chitosan antifungal activity in spite of high ROS intracel-

Corresponding Editor:

lular levels. With lactate instead of glucose, C and N limitation increased N. crassa sensitiv-

Michael C. Lorenz, Ph.D.

ity to chitosan further (4-fold) than what glucose did. Nutrient limitation also increased sensitivity of filamentous fungi and yeast human pathogens to chitosan. For Fusarium pro-

Keywords:

liferatum, lowering 100-fold C and N content in the growth medium, increased 16-fold chi-

Candida spp.

tosan sensitivity. Similar results were found for Candida spp. (including fluconazole

Fusarium proliferatum

resistant strains) and Cryptococcus spp. Severe C and N limitation increased chitosan anti-

Mammalian cell lines

fungal activity for all pathogens tested. Chitosan at 100 mg ml-1 was lethal for most fungal

Membrane permeabilization

human pathogens tested but non-toxic to HEK293 and COS7 mammalian cell lines. Besides,

Nutrient limitation

chitosan increased 90% survival of Galleria mellonella larvae infected with C. albicans. These

ROS

results are of paramount for developing chitosan as antifungal. ª 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

* Corresponding author. Tel.: þ34 965903400x3280; fax þ34 965909897. E-mail addresses: [email protected] (F. Lopez-Moya), [email protected] (M. F. Colom-Valiente), [email protected] (P. Martinez-Peinado), [email protected] (J. E. Martinez-Lopez), [email protected] (E. Puelles), [email protected] (J. M. Sempere-Ortells), [email protected] (L. V. Lopez-Llorca). http://dx.doi.org/10.1016/j.funbio.2014.12.003 1878-6146/ª 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

63

Carbon and nitrogen limitation enhances chitosan antifungal activity

Introduction Chitosan is a polymer obtained by partial chitin N-deacetylation (Kumar, 2000) with antifungal action (Allan & Hadwiger 1979). Many filamentous fungi (including Neurospora crassa) and yeast are sensitive to chitosan (Palma-Guerrero et al. 2009; Jaime et al. 2012). However, chitosan antifungal activity differs within fungal groups (Palma-Guerrero et al. 2008). Filamentous fungi and yeast human infections are a highly rele€ rl vant health issue in our society (Richardson & Lass-Flo 2008; Miceli et al. 2011). These fungal infections have become a leading cause of human mortality due to their increasing frequency in immunocompromised populations and the low number of antifungals available (Shapiro et al. 2011). Chitosan has a great potential to be developed as an antifungal agent to treat diseases caused by human pathogenic fungi (Calamari ~ a et al. 2013; Kulikov et al. 2014 and Younes et al. 2011; Pen et al. 2014). Therefore, it is of vital importance to fully understand its mode of action. Chitosan causes plasma membrane permeabilization in N. crassa (Palma-Guerrero et al. 2009) and yeast (Jaime et al. 2012). Membrane fluidity is a key factor determining chitosan sensitivity in fungi (Palma-Guerrero et al. 2010). Cell energy and mitochondrial activity have also an important role in antifungal activity of chitosan (Zakrzewska et al. 2005; Palma-Guerrero et al. 2009). These processes are known to increase reactive oxygen species (ROS) as the main by-products (Kawaltowski et al. 2009). A hyperoxidant unstable state is reached when ROS generation surpasses the antioxidant capacity of the cell. This ability could be associated with the presence of nutrients (a source of reducing power), which would help N. crassa to return from a hyperoxidant to a normal, less-oxidative state (Aguirre et al. 2005). In this study, we have analysed the effect of the nutrient levels (carbon and nitrogen limitation) and the effect of the carbon source on sensitivity to chitosan of N. crassa and clinically important filamentous fungi and yeast human pathogens (Aspergillus fumigatus, Candida albicans, Cryptococcus spp.), besides pathogenic Candida spp. (Candida krusei, Candida glabrata and Candida parapsilosis) resistant to currently used antifungals such as fluconazole or echinocandins. With this purpose, we have used a high-throughput spectrophotometrical methodology adapted from techniques standardized in the Clinical and Laboratory Standards Institute (NCCLS) of the USA (Clinical and Laboratory Standards Institute 2008). Besides, we have determined in this work the production of intracellular ROS by N. crassa and its relation to cell membrane permeabilization by chitosan under various carbon and nitrogen regimes. We have also evaluated the impact in chitosan sensitivity of N. crassa of replacing glucose for lactate as the main carbon source, since the latter is less energetically efficient. Nutrient status has a substantial effect on the susceptibility of fungal pathogens (e.g. C. albicans) to others antifungals (e.g. miconazole) (Ene et al. 2012a). Besides, C. albicans encounters carbon-poor conditions during host infection (Ramirez & Lorenz 2007). As a consequence, C. albicans displays an elaborated response in the host which includes activation of pathways needed to enable the use of alternative carbon sources.

64

155

For this reason, gluconeogenesis, the glyoxylate cycle, and boxidation of fatty acids, have been shown to be required for full virulence in several pathogenic organisms (Lorenz & Fink 2001; Prigneau et al. 2003). We have therefore determined the role of carbon and nitrogen status in C. albicans infecting an invertebrate model Galleria mellonella (Fuchs et al. 2010) treated with chitosan and artificially inoculated with the pathogen. Finally, the compatibility of chitosan with mammalian (including human) cell lines was investigated. These studies are a key step to develop chitosan as an antifungal agent in the future.

Materials and methods Filamentous fungi and culture conditions Fusarium proliferatum used in this study (CECT 20546) was obtained from the Spanish Type Culture Collection (CECT, Spain). Aspergillus fumigatus used in this study (ATCC16907) was obtained from the American Type Culture Collection (ATCC, USA). Hamigera avellanea (CECT 20819) was obtained from the Laboratory of Microbiology of the General University Hospital of Alicante (Spain) from a blood sample (hemoculture) of a neonate. Rhizopus stolonifer was a clinical strain from a periocular nasal fossa fat isolated by Dr. Arena (General " lez, Mexico DF, Mexico). All Hospital Dr. Manuel Gea-Gonza pathogenic filamentous fungi were grown on potato dextrose agar (PDA) (Becton Dickinson and Company, USA) in 9 cm Petri dishes at 25 C. Neurospora crassa used in this study, was the wild-type strain 74-OR23-IVA (FGSC #2489) kindly provided by the Fungal Genetics Stock Center (FGSC, USA). Neurospora crassa was grown on Vogel’s solid medium (MM) (1! Vogel’s salts, 2 % sucrose and 1.5 % technical agar) in 9 cm Petri dishes at 25 C under continuous light for 5e7 d.

Pathogenic yeasts Candida albicans (SN87) was kindly provided by Dr. Nislow (University of Toronto, Canada). Reference strains for antifungal susceptibility testing were: Candida krusei (ATCC6258), Candida glabrata (ATCC2001) and Candida parapsilosis (ATCC22019). Cryptococcus neoformans (ATCC3501) and Cryptococcus gattii (CBS11728) were also used. Yeast were grown in 0.5! YPD broth medium pH 5 (0.5 % bacto yeast extract, 1 % bacto peptone and 1 % dextrose) for culture proliferation and 0.5! YPD agar (1.5 % bacteriological agar) was used for stock cultures.

Chitosan A medium-size molecular weight chitosan (70 kDa) with 82.5 % deacetylation degree (T8s) was from Marine Bio Products GmbH (Bremerhaven, Germany). Chitosan was dissolved in 0.25 M HCl under continuous stirring and the pH of the solution was adjusted to 5.6 with 1 M NaOH as described by Palma-Guerrero et al. (2008). The resulting solution was dialysed against distilled water for salt removal, then autoclaved at 121 C for 20 min and finally it was stored at 4 C until used.

156

Effect of nutrient limitation on growth kinetics of filamentous fungi and yeast Experiments in liquid media were set up to evaluate growth kinetics of Neurospora crassa, other filamentous fungi and yeast human pathogens. Conidia of filamentous fungi were obtained by adding 2 ml of 0.05 % Tween-20 per Petri dish, from 8-to-10 day-old sporulated cultures. The resulting conidial suspensions were then filtered through Miracloth paper (Calbiochem) to remove hyphae fragments and adjusted to a final concentration of 106 conidia ml 1 with potato dextrose broth (PDB) (Becton Dickinson). PDB (pH 5.6) was supplemented to include 0.1, 0.5, 1, 2, 5.8 and 10 g of glucose per liter (carbon (C): 0.04; 0.2; 0.4; 0.8; 2.32; 4 g l 1, respectively and nitrogen (N) contents: 1.6 ! 10 3; 7.8 ! 10 3; 15.5 ! 10 3; 0.03; 0.09 and 0.15 g l 1, respectively). Chitosan (0.5e1000 mg ml 1) was added to these media and 200 ml per well were dispensed into 96-well microtiter plates (Sterilin Ltd., Newport, UK). Plates were inoculated with N. crassa conidia (2 ! 105 conidia per well) and incubated at 25 " C under continuous light, without shaking. The effect of chitosan on growth of filamentous fungi was evaluated by measuring daily for 5 d the optical density at 490 nm (OD490) (Clinical and Laboratory Standards Institute 2008) in a GEN€ nnedorf, iosTM multiwell spectrophotometer (Tecan, Ma Switzerland). Regarding pathogenic yeast, overnight cultures grown at 30 " C in 0.5! YPD broth were used for experiments. Two micro liters of these cultures adjusted to a final OD595 of 0.0625 (Burke 2000) were added to each well of microtiter plates, containing 0e240 mg ml 1 of chitosan. Yeast were either grown at 30 " C (Cryptococcus spp.) or 37 " C (Candida spp.) and incubated as above and growth was spectrophotometrically monitored for 24 h. YPD was prepared by including increasing concentrations of glucose (0.1, 0.5, 1, 2, 5 and 10 g l 1) as the main C source. YPD prepared with these glucose concentrations respectively included the following C (0.04; 0.2; 0.4; 0.8; 2; 4 g l 1) and N (0.015; 0.074; 0.15; 0.3; 0.74 and 1.47 g l 1) contents. The N content of YPD was higher than that of media for filamentous fungi (e.g. PDB), since yeast require more N for their growth than the latter. YPD was then amended with 0e240 mg ml 1 of chitosan. In order to evaluate the fungicidal effect of chitosan, we performed a spot assay by adding 2 ml of liquid cultures to plates with 0.5! YPD agar (1.5 % bacteriological agar) and these were incubated 48 h at 30 " C. All assays were carried out in triplicate. For the determination of carbon and nitrogen contents of PDB and YPD, aliquots of these nutrient media were processed in a TruSpec CN (Leco) elemental analyzer at the Common Research Facilities of the University of Alicante.

F. Lopez-Moya et al.

Fluorescence emission was evaluated in a Flow Cytometer (EPICS XL, Beckman Coulter) using 488 nm and 520 nm as an excitation and emission wavelengths, respectively. Untreated controls to determine conidia auto-fluorescence were also included. Fifteen thousand events per sample were recorded and the data analysed using EXPO! 32 MultiCOMP software (Beckman Coulter). All experiments were repeated twice.

Intracellular ROS production Intracellular ROS production was estimated fluorimetrically using 20 -70 dichlorofluorescein diacetate (DCF) (Sigma, St. Louis, MO, USA). Neurospora crassa conidia (106 conidia ml 1) were inoculated in media with increasing concentrations of glucose, as previously described and amended with chitosan (1e50 mg ml 1). Conidia were then incubated at 25 " C under shaking (150 rpm) for 30 min. Afterwards, conidia were stained with 50 mg ml 1 DCF in DMSO (final concentration) and incubated for 2 h under shaking in the dark. Samples were placed in black microtiter plates (Sigma) and fluorescence was recorded with a GENiosTM multiwell reader, using a 490 nm excitation filter and a 535 nm emission filter (in triplicate). Untreated controls were incorporated to evaluate autofluorescence of conidia. Experiments were carried out in triplicate and all data sets obtained were checked using the Shapiro-Wilcoxon test. Data following a normal distribution were compared using ANOVA tests. The level of significance in all cases was 95 %. All statistical analyses were performed with R version 2.15.1 (R Development Core Team).

Time-course of ROS production and lethality in Neurospora crassa treated with chitosan Time-course experiments to evaluate ROS production in presence of chitosan were carried out under two nutritional regimes. Neurospora crassa conidia (107 conidia ml 1) were inoculated in either 2.5 g l 1 PDB (0.8 g l 1 C; 0.03 g l 1 N) or 12 g l 1 PDB (4 g l 1 C; 0.15 g l 1 N). Conidia suspensions were amended with increasing concentrations of chitosan (2.5e100 mg ml 1) and then stained with DCF (see 2.6). Controls for auto-florescence of PDB and conidia were included. In addition, a positive ROS control (3 % H2O2) was also included. All samples were dispensed into black microtiter plates and incubated (25 " C) in the multiwell plate reader. Fluorescence of samples (see above) was recorded every 10 min for 20 h to characterize ROS induction. Lethality of chitosan treatments was estimated with the spot assay as described, using GFS agar plates (1! MM salts, 2 % sorbose, 0.05 % glucose, 0.05 % fructose and 1.5 % bacteriological agar) (Carneiro et al. 2012).

Fungal membrane permeabilization

Effect of nutrient limitation with different carbon sources on Neurospora crassa sensitivity to chitosan

Neurospora crassa conidia (106 conidia ml 1) were added to media containing several concentrations of C and N (see above), and supplemented with chitosan (1e50 mg ml 1). The mixture was then incubated at 25 " C for 45 min under continuous shaking. Conidia were then stained with 30 nM SYTOX Green (Life Tech., USA) for 30 min in the dark to determine membrane permeabilization as in Thevissen et al. (1999).

Vogel’s minimal medium (MM) salts solution diluted 100 times (Vogel 1956) was amended with 2, 5.8 and 10 g of either lactate or glucose per liter. To these media chitosan (1e50 mg ml 1) was added and Neurospora crassa conidia inoculated as described (see 2.4). N. crassa growth kinetics was evaluated spectrophotometrically as previously described. Each experiment was repeated three times.

65

Carbon and nitrogen limitation enhances chitosan antifungal activity

Chitosan cytotoxicity assay on mammalian cell lines To evaluate chitosan cytotoxicity, we performed a methylthiazolyldiphenyl-tetrazolium bromide (MTT) (Sigma) colorimetric assay with human embryonic kidney HEK293 and the monkey fibroblast-like COS7 cell lines. Cells were seeded into 96-well plates, pre-coated with 10 mg ml 1 of poly-L-lysine for HEK293, to obtain a cellular lawn, with three replicates at 5 ! 103 and 20 ! 103 cells/well each one. Cells were grown at 37 " C and 5 % CO2 for 24 h in Dulbecco’s Modified Eagle’s medium (DMEM; pH 7.5; Sigma) supplemented with 5 % foetal bovine serum (FBS; Biobest), 1 % L-glutamine, 1 % penicillin/streptomycin (P/S; Thermo Scientific), 1 % sodium pyruvate, 1 % non-essential amino acids for HEK293 cells and with 10 % FBS, 1 % L-glutamine, 1 % P/S and 1 % sodium pyruvate for COS7. After incubation, cells were treated with 100 mL of DMEM supplemented with different concentrations of chitosan (1, 5, 10, 25, 50, 100 and 150 mg ml 1) in each well. Cells treated with DMSO and cells in wells with no growth medium were used as positive controls for cell death. We tested the toxicity after 24 h and proliferative activity after 24 h, 48 h and 72 h of treatments at 37 " C and 5 % CO2. With this purpose, the medium was removed from wells and 100 mL of 1 mg ml 1 MTT was added to each well. Plates were then incubated for 4 h at 37 " C and 5 % CO2 in the dark. The Formazan originated from MTT by the mitochondrial activity of living cells was solubilized in 100 ml of DMSO, and the absorbance at 570 nm was measured in a Benchmark Microplate Reader (Bio-Rad) (Kaushik et al. 2012; Yaris et al. 2013). All datasets obtained were analysed using the ShapiroWilcoxon test. Data following a normal distribution were compared using ANOVA tests. The level of significance in all cases was 95 %. All statistical analyses were performed with R version 2.15.1 (R Development Core Team). Cytotoxicity index (CI) was calculated as: CI ¼ (1 OD570 treated/OD570 control) ! 100 (Hongo et al. 1990). These experiments were carried out in triplicate.

Inhibition and cytotoxicity evaluation of chitosan in mammalian peripheral blood lymphocyte cultures Peripheral blood lymphocytes from five healthy donors were isolated by Ficoll-Hypaque (HE Healthcare) density gradient and labelled with 5 mM carboxyfluorescein diacetate succinimidyl ester (CFSE, Sigma) in 1 ml of DMEM culture medium supplemented with 10 % FBS and 1 % P/S for 5 min, by using a standard protocol (Lyons 2000). Cells (105 per replicate) were cultured for 5 d with and without 10 mg ml 1 phytohemagglutinin (PHA; Sigma), it necessary to stimulate lymphocyte proliferation, under different chitosan concentrations (0, 1, 5, 7.5, 25, 50, 75, 100, 200 and 400 mg ml 1). Cell proliferation was then measured by flow cytometry (as above). Prior to flow cytometry analysis, cells were also labelled with 2 mg ml 1 propidium iodide (PI) (Sigma) to evaluate cell death, using 488 nm and 560 nm as excitation and detection wavelengths respectively. Five thousand lymphocytes per sample (chitosan dose) were acquired to measure cell proliferation and 10 000 events were recorded to measure cell death. Data were analysed statistically, using One-way Anova and Tukey post-hoc tests. All statistical analyses were performed with R version

66

157

2.15.1 (R Development Core Team). Experiments were carried out in triplicate.

Effect of chitosan on Galleria mellonella larvae infection by Candida albicans Candida albicans was grown in 0.5! YPD (broth) overnight at 30 " C with shaking. Forty eight micro liters of overnight cultures were diluted in either 0.25! or 0.5! YPD to obtain an inoculum with 3.1 ! 106 cells ml 1. Chitosan was added to the media to reach final concentrations of 20e150 mg ml 1. Twenty larvae of Galleria mellonella (provided by Animal-center S.C., Valencia, Spain) per treatment were injected (22 ml per larvae) using a 26G syringe (Terumo) as described in Fuchs et al. (2010). Larvae injected without chitosan or C. albicans were included as controls. Injected larvae were incubated at 30 " C in the dark and their survival recorded daily. Mortality data were analysed using the KaplaneMeier survival test (Martin-Bland & Altman 1998). All data were analysed statistically using SPSS statistics 17.0. This experiment was carried out in triplicate.

Results Carbon and nitrogen limitation increase growth inhibition and membrane permeabilization caused by chitosan in Neurospora crassa The effect of chitosan on growth of Neurospora crassa depended directly on the C and N content of the medium used (Fig 1A, C, E). Nutrient limitation increased growth inhibition and membrane permeabilization caused by chitosan in N. crassa (Fig 1B, D and F). Under low C (0.8 g l 1) and N (0.03 g l 1) content, chitosan minimal inhibitory concentration (MIC) was 5 mg ml 1 (Fig 1A). Under this nutrient level, a very low chitosan concentration (2.5 mg ml 1), caused partial membrane permeabilization and a 25 % growth reduction of N. crassa. This chitosan dose caused a slight shift in the peak of fluorescence in cells not stained towards Sytox emission wavelength, perhaps indicating subtle membrane damage. A higher chitosan dose (3.75 mg ml 1) resulted in the emission of Sytox fluorescence by all cells (Fig 1B), a fact that was associated with the disappearance of Sytoxunstained cells, indicative of massive plasma membrane permeabilization of all N. crassa conidia evaluated. This effect was more evident (sharper peaks) at higher concentrations of chitosan. When C (2.32 g l 1) and N (0.09 g l 1) levels in the medium were raised, N. crassa became more tolerant to chitosan, with a MIC of 10 mg ml 1 (Fig 1C). Under these conditions, plasma membrane permeabilization occurred at 10 mg ml 1 chitosan (Fig 1D), indicating that plasma membrane was more resistant to chitosan permeabilization than at lower C and N levels. When we further increased nutrient (4 g l 1 of C and 0.15 g l 1 of N) contents, N. crassa stepped up its tolerance to chitosan to a MIC of 50 mg ml 1 (Fig 1E). Under these nutrient levels, permeabilization of N. crassa conidia membrane was attained at an even higher chitosan dose of 30 mg ml 1 (Fig 1F). The flow cytometry profile suggested that

158

F. Lopez-Moya et al.

Fig 1 e Effect of nutrient (C and N) content on chitosan antifungal activity on growth and membrane permeabilization in N. crassa. (A, C and E) show the effect of chitosan on growth kinetics and (B, D and F), the evaluation of cell membrane permeabilization by Sytox Greenª in N. crassa, under increasing nutrient (C and N) content of the culture medium: 0.8 C; 0.03 N g lL1 (A, B), 2.32 C; 0.09 N g lL1 (C, D) and 4 C; 0.15 N g lL1 (E, F), respectively. Chitosan concentrations used are shown in each graph. (A, C and E) graph values are the average of 4 estimations with their standard error (SE). (B, D and F) graphs represent the accumulated values from 15 000 events per each single curve.

under these conditions plasma membrane permeabilization was an ‘all or none’ process. Thus, nutrient (C and N) limitation enhances the chitosan antifungal effects and has a determinant role in chitosaninduced plasma membrane permeabilization in N. crassa. Under all nutritional statuses studied, membrane permeabilization occurred at chitosan concentrations when fungal growth was inhibited (Fig 1).

Chitosan increases intracellular ROS production in Neurospora crassa Neurospora crassa intracellular ROS levels increased with chitosan concentration under various nutritional regimes (Fig 2). At low levels of C (0.8 g l 1) and N (0.03 g l 1), a chitosan concentration of 2.5 mg ml 1, elicited a significant rise in ROS levels (Fig 2A), which was coincident with the start of plasma

67

Carbon and nitrogen limitation enhances chitosan antifungal activity

159

content (2.32 and 0.09 g l 1, respectively) could be observed (Fig 2C). Membrane was permeabilized with 30 mg ml 1 of chitosan (see Fig 1F), after maximum ROS production was achieved (10 mg ml 1). Therefore, intracellular oxidative stress seems to be an important response of N. crassa to chitosan.

Chitosan fungicidal activity is associated with intracellular ROS induction in Neurospora crassa A time-course study of ROS induction and mortality was carried out on Neurospora crassa conidia treated with chitosan (Fig 3). We found that under low nutrient conditions (see 3.2) chitosan at 10 mg ml 1 elicited a steady ROS induction (1.5-fold compared to control) which caused full mortality of N. crassa conidia (Fig 3A and B). When nutrients were raised (4 g l 1 C and 0.15 g l 1 N) chitosan above 30 mg ml 1 caused ROS induction (2-fold compared to control) and N. crassa full mortality (Fig 3C and D). In contrast, low chitosan concentrations had low (small spots formation) or no effect on N. crassa mortality at the two nutrient regimes tested. Control conidia displayed a ROS induction similar to that found at low chitosan doses.

Chitosan exhibits greater antifungal activity to Neurospora crassa with lactate instead of glucose as main carbon source

Fig 2 e Intracellular reactive oxygen species (ROS) production by N. crassa conidia treated with chitosan under different nutrient (C and N) statuses. ROS production was determined by DCF fluorescence with increasing chitosan concentrations (0e50 mg mlL1) under 3 nutritional (C and N) regimes: (A) 0.8 C; 0.03 N g lL1 (B), 2.32 C; 0.09 N g lL1 and (C) 4 C; 0.15 N g lL1. Different letters indicate significant differences (P < 0.05). Values are the average of 4 estimations with their standard error (SE). membrane permeabilization (Fig 1B). In contrast, at 5 mg ml 1, ROS production did not show significant differences compared to that elicited by 2.5 mg ml 1 chitosan (p-value < 0.05). At intermediate C and N concentrations (2.32 and 0.09 g l 1, respectively) in the medium, ROS levels raised steadily with chitosan dose, up to 5 mg ml 1 (Fig 2B). Then, they remained stable up to 10 mg ml 1 (MIC; Fig 1C). This concentration coincided with the start of plasma membrane permeabilization (see Fig 1D). At high nutrient (C: 4 g l 1 and N: 0.15 g l 1) levels, a trend in ROS release similar to that found at intermediate C and N

68

A nutrient (C and N) reduction when lactate replaced glucose as the main carbon source enhanced chitosan antifungal activity in Neurospora crassa (Fig 4). At low concentrations of C and N when 2 g l 1 glucose was used as the main C source (C, 0.8 g l 1; N, 0.0014 g l 1), N. crassa was less sensitive to chitosan (MIC 10 mg ml 1, Fig 4A), than when an equivalent concentration of lactate was used instead of glucose (MIC, 2.5 mg ml 1, Fig 4B). On the other hand, intermediate concentrations of C and N (5.8 g l 1glucose) (C, 2.32 g l 1; N, 0.004 g l 1) elicited no changes in N. crassa sensitivity to chitosan (MIC 10 mg ml 1, Fig 4C). Replacing glucose by lactate resulted in an increase of N. crassa sensitivity to chitosan (MIC 2.5 mg ml 1, Fig 4D). Although increasing nutrient content when lactate was used as the main C source did not change N. crassa sensitivity to chitosan (MIC 2.5 mg ml 1), growth of this fungus increased by ca. two-fold with respect to that at 2 g l 1 of lactate (Fig 4B and D). An increase in C and N levels (C, 4 g l 1; N, 0.007 g l 1) in the medium (10 g l 1 glucose) diminished N. crassa sensitivity to chitosan (MIC 17.5 mg ml 1) (Fig 4E) and under these conditions, glucose replacement by lactate increased chitosan sensitivity of the fungus (MIC 5 mg ml 1) (Fig 4F). These results indicate that when lactate was used instead of glucose as the main carbon source, chitosan antifungal activity on N. crassa was enhanced by ca. 4 times.

Carbon and nitrogen limitation increase chitosan susceptibility in filamentous fungi and yeast human pathogens In view of our previous results on the enhancement of chitosan antifungal effect by nutrient (C and N) limitation on Neurospora crassa, we performed similar tests on a wide variety of clinically important human fungal pathogens (Fig 5). Carbon (0.4 g l 1) and nitrogen (0.016 g l 1) concentrations in the growth medium were set to normal value of human blood

160

F. Lopez-Moya et al.

Fig 3 e Chitosan elicitation of ROS production and fungicidal activity in N. crassa conidia under two nutrient (C and N) statuses. (A, B) C and N low content (0.8 C; 0.03 N g lL1) and (C, D) C and N high content (4 C; 0.15 N g lL1) media. (A, C) ROS induction. (B, D) Serial dilutions (from left to right) of conidial suspensions of N. crassa wild-type strain were spotted and incubated on GFS agar plates at 25 C for 48 h. Values are the average of 4 estimations as above.

glucose content (glycemia). At these nutrient contents, chitosan (2.5 mg ml 1) caused a moderate (ca. 25 %) growth inhibition in Fusarium proliferatum with MIC and minimal fungicidal concentration (MFC) of 5 mg ml 1 (Fig 5A, Table 1). Under the same C and N contents, chitosan (above 40 mg ml 1) caused growth inhibition on Aspergillus fumigatus during the first 48 h, but later on (after 72 h) the fungus resumed growth (Table 1 and Suppl. Fig 1L). At the same C level and with 0.15 g l 1 of N, chitosan MIC was 10 mg ml 1 for Candida albicans (Fig 5D) and 20 mg ml 1 for Candida krusei (fluconazole resistant strain, Suppl. Fig 2F) and Cryptococcus neoformans (Suppl. Fig 2P). MFC for C. albicans and C. krusei was 20 mg ml 1 (Table 1).

A reduction of carbon (0.2 g l 1) (similar to low levels of glucose in blood, hypoglycemia) and nitrogen (0.074 g l 1) in the culture medium increased the chitosan antifungal effects (Table 1). For instance, for C. albicans chitosan MIC was again 10 mg ml 1, but MFC became reduced (10 mg ml 1) with respect to the value found at higher nutrient content. At severe C (0.04 g l 1) and N (0.015 g l 1) limitation chitosan MIC was further reduced to 5 mg ml 1 (Table 1). An increase in sensitivity to chitosan with nutrient limitation was also found for the rest of fungal human pathogens tested (Table 1). Conversely, high levels of C and N reduced chitosan antifungal activity on the fungi (Fig 5, Table 1 and Suppl. Figs 1 and 2). For instance, C. albicans growing from 0.8 g l 1 of C

69

Carbon and nitrogen limitation enhances chitosan antifungal activity

161

Fig 4 e Effect of carbon source (lactate vs. glucose) on sensitivity of N. crassa to chitosan under various nutrient (C and N) regimes. (A, C, E) 2, 5.8 and 10 g lL1 glucose, respectively, in 1/100 Vogel’s salts solution. (B, D, F) 2, 5.8 and 10 g lL1 lactate, respectively, in 1/100 Vogel’s salts solution. Nutrient (C and N) content of culture media: (A, B) 0.8 C; 0.0014 N g lL1, (C, D) 2.32 C; 0.004 N g lL1 and (E, F) 4 C; 0.007 N g lL1. Values are the average of 4 estimations as above. and 0.3 of N to 4 g l 1 of C and 1.5 g l 1 of N, increased chitosan MIC from 20 to 80 mg ml 1 (Table 1). The fungicidal activity of chitosan at low levels of nutrients increased respect to that at high nutrient content in Candida spp. (Table 1, Fig 6).

70

Furthermore, other Candida spp. (Candida krusei, Candida glabrata and Candida parapsilosis) also proved to be sensitive to chitosan (Table 1, Suppl. Fig 2). This pattern was also found in C. neoformans and Cryptococcus gattii (Table 1, Suppl.

162

F. Lopez-Moya et al.

Fig 5 e Effect of chitosan on growth kinetics of relevant filamentous fungi and yeast pathogens under different nutritional regimes. (A, B, C) Fusarium proliferatum, (D, E, F) and Candida albicans. Nutrient (C and N) contents of medium for F. proliferatum were: (A) 0.4 C; 0.016 N g lL1, (B) 0.8 C; 0.03 N g lL1 and (C) 4 C; 0.15 N g lL1. For C. albicans: (D) 0.4 C; 0.15 N g lL1, (E) 0.8 C; 0.3 N g lL1 and (F) 4 C; 1.5 N g lL1. Values are the average of 4 estimations with their standard error (SE).

Fig 2), both yeasts showed less chitosan antifungal sensitivity at high than at low nutritional (C and N) levels. Regarding filamentous fungal pathogens, F. proliferatum (Table 1) and H. avellanea (Suppl. Fig 1) were sensitive to chitosan and their

MICs increased from 7.5 to 5 mg ml 1, from 0.8 g l 1 C and 0.03 g l 1 N to 40 and 30 mg ml 1 at 4 g l 1 C and 0.15 g l 1 N, respectively (Table 1). On the contrary, A. fumigatus and Rhizopus stolonifer were chitosan insensitive at all these high

71

[C and N] (g l 1) Filamentous fungi Fusarium proliferatum Hamigera avellanea Aspergillus fumigatus Rhizopus stolonifer

0.04/0.0015b 24h 2.5 e 1 e

[C and N] (g l 1) Yeast Candida albicans Candida parapsilosis Candida krusei Candida glabrata Cryptococcus neoformans Cryptococcus gatti

48h 2.5 e 1 e

0.2/0.007b 72h a

2.5 e 1000 e

24h 2.5 e 1 e

0.04/0.015c 6h 5 e 5 e 5 e

12h 5 e 5 e 5 e

48h 2.5 e 5 e

0.4/0.016b 72h a

2.5 e 1000 e

24h 2.5 e 1 e

0.2/0.074c 24h 5 (10) e 10a e 5 e

6h 5 e 5 e 5 e

12h 10 e 10 e 5 e

48h 5 e 40 e

0.8/0.031b 72h a

5 e 1000 e

24h 5 2.5 100 100

0.4/0.15c 24h 10 e a

e 5 e

a

48h 7.5 5 1000 ni

2.32/0.087b 72h a

7.5 5a 1000 ni

24h

48h

10 10 100 ni

0.8/0.3c

20 20 ni ni

4/0.15b 72h a

20 20a ni ni

24h

48h

72h

20 10 1000 ni

30 20 ni ni

40a 30a ni ni

2/0.74c

4/1.5c

6h

12h

24h

6h

12h

24h

6h

12h

24h

6h

12h

24h

10 e 10 e 10 e

10 e 20 e 20 e

10 (20) e 20a e 20 e

20 e 20 e 20 e

20 e 20 e 40 e

20 (40) e 20 (40) e 40 e

20 40 40 20 40 10

40 40 40 80 40 20

40 (80) 40a 80a 80a 40 80

40 40 40 100 40 2.5

80 110 80 110 80 110

80 (100) 110a 80 240 100 160

Carbon and nitrogen limitation enhances chitosan antifungal activity

Table 1 e Antifungal effect of chitosan on important species of filamentous fungi and yeast human pathogens under different nutrient (C and N) conditions. Minimal inhibitory concentration (MIC; mg mlL1) and minimal fungicidal concentration (MFC; mg mlL1) for chitosan on the fungal pathogens species are given.

Figures in brackets (eg. (40)) indicate that these chitosan concentrations were fungicidal. ni: non-inhibitory. e not tested. a Indicates that chitosan MIC and MFC were coincided. b Nutrients (C and N) were included in PDB medium at 0.04C 0.0015N g l 1, 0.2C 0.007N g l 1, 0.4C 0.015N g l 1, 0.8C 0.031N g l 1, 2.32C 0.087N g l 1, 4C 0.15N g l 1. c Nutrients (C and N) were included in YPD medium at 0.04C 0.015N g l 1, 0.2C 0.074N g l 1, 0.4C 0.15N g l 1, 0.8C 0.3N g l 1, 2C 0.74N g l 1, 4C 1.5N g l 1.

163

164

F. Lopez-Moya et al.

Fig 6 e Chitosan susceptibility profiles of C. albicans determined by spot assay. C. albicans cells were cultured on YPD agar plates. (A) YPD 0.253 (0.8e0.3 g lL1 C and N content), (B) YPD 0.53 (4 C; 1.5 N g lL1, C and N contents). Aliquots of 2 ml from 24 h cell cultures supplemented with chitosan were diluted serially (10-fold) and spotted on the YPD plates with chitosan (0e150 mg mlL1). Growth differences were detected after 48 h incubation at 30 ! C.

C and N levels. These fungi reduced its growth at high concentration of chitosan, but this compound never was fungicide for both species.

Chitosan does not affect growth of HEK293 and COS7 cell lines Chitosan was tested on two mammalian cell lines (HEK293 and COS7; Fig 7). No effect on cell viability was found after 24 h (Fig 7A and B). At the two cell densities tested, chitosan at 1e150 mg ml 1 displayed no differences on cell viability (P < 0.05) with respect to untreated controls. On the contrary, virtually full mortality was found when cells were either dried (physical disturbance) or treated with DMSO (chemical disturbance). The CI of chitosan did not exceed 50 % of inhibitory concentration (IC50) (Suppl. Table 1). Chitosan cytotoxicity was evaluated over time in order to determine its effect on cell proliferation. Chitosan showed no effect on cell proliferation at 48 h (Fig 7C and D) for all concentrations tested, except at 150 mg ml 1. At this concentration, COS7 (CI value 88 at 72 h) but especially HEK293 cells, were sensitive to chitosan (CI value, 61 at 48 h) (Suppl. Table 2).

Nutrient limitation promotes chitosan reduction of Candida albicans virulence to Galleria mellonella Chitosan significantly reduced Candida albicans virulence on larvae of the moth Galleria mellonella measured as cumulative survival (Fig 9). Candida albicans caused high larvae mortality at 2 g l 1 C and 0.74 g l 1 N in the medium, since all infected larvae without chitosan (positive controls) died within 24 h (Fig 9B). Interestingly, chitosan increased G. mellonella larvae survival in a concentration-dependent fashion under these conditions. After 48 h, ca. 20 % of the larvae treated with 20 mg ml 1 of chitosan survived and at higher concentrations of chitosan (100 mg ml 1) larval survival was close to 100 %, the mortality confidence interval (152e262 h) showed significant differences (p < 0.05) compared to that of controls. When nutrient content was increased (C, 4 g l 1 and N, 0.15 g l 1) C. albicans virulence on G. mellonella was reduced (Fig 9D). Therefore, the effect of chitosan on C. albicans virulence was less evident than that at low concentrations of nutrients. After 48 h, a 65 % survival was achieved at 100 mg ml 1 compared to 40 % survival at 40 mg ml 1 chitosan. Under different nutrient regimes, non-injected larvae exhibited mortalities similar to those of controls when they were injected with chitosan only and no C. albicans (Fig 9A and C).

Chitosan has a low effect on human lymphocytes The effect of chitosan on mortality and proliferation of human lymphocytes was evaluated (Fig 8). Chitosan cytotoxicity on human lymphocytes never reached values higher than 20 % (7.5 mg ml 1) of that found in untreated control cells (Fig 8A). No clear correlation between chitosan concentrations and cytotoxicity was observed. For instance, with the high range of chitosan concentration tested (25e400 mg ml 1), only 50 and 400 mg ml 1 had an effect on cell death, but cells treated with chitosan at 75e200 mg ml 1 showed no significantly differences in their viability compared to controls (Fig 8A). A slight reduction in lymphocyte proliferation (IC30, 28 %) was found when chitosan was added at 25 mg ml 1 (Fig 8B). However, differences in lymphocyte proliferation in cells treated with chitosan were found not statistically different respect to controls (without chitosan).

Discussion We here demonstrated that nutrient (C and N) limitation increased Neurospora crassa sensitivity to chitosan. Some features associated with fungal nutrient deprivation (hyphal fragmentation, ammonium release and increase in extracellular hydrolytic activities) (Nitsche et al. 2012; Szilagyi et al. 2013) could modify N. crassa cell wall architecture making it more permeable to chitosan. Under these conditions chitosan could then reach more easily the plasma membrane, facilitating its permeabilization. Alternatively, C and N limitation could result in lack of energy necessary for the cell wall and for plasma membrane repair after chitosan damage. We have been able to link the increase in chitosan sensitivity due to C and N limitation to plasma membrane

73

Carbon and nitrogen limitation enhances chitosan antifungal activity

165

Fig 7 e Chitosan effects on viability and proliferation of mammalian cell lines. (A, C) HEK293 and (B, D) COS7 human and monkey cell lines, respectively. (A, B) Cytotoxic effect of chitosan determined at 24 h. (C, D) Effect of chitosan on cell proliferation at 24, 48 and 72 h. Both parameters were measured using the MTT assay (OD570). Different letters (aed) indicate significant differences (P < 0.05). Statistical analyses were carried out independently for each experiment (eg. number of cells for cell viability or time for cell proliferation).

permeabilization and intracellular ROS production. This finding, reported for the first time, would explain why sodium azide, which uncouples oxidative metabolism and prevents ROS production, protects N. crassa from chitosan by preventing membrane permeabilization (Palma-Guerrero et al. 2009; Carneiro et al. 2012). In the present work, we also demonstrate that chitosan fungicidal activity to which N. crassa is sensitive is associated with the induction of intracellular ROS by this fungus (a chitosan-sensitive fungus). ROS could cause membrane permeabilization by means of lipid peroxidation, mostly to polyunsaturated fatty acids (Howlett & Avery 1997), which are very abundant in N. crassa and other chitosan-sensitive fungi (Palma-Guerrero et al. 2010). At chitosan concentrations where complete membrane permeabilization took place, ROS production decreased. Mitochondrial membrane permeabilization would cause uncoupling of the electron transport chain, the main source of intracellular ROS (Kowaltowski et al. 2009; Carneiro et al. 2012), this explaining our

74

experimental results. ROS production is a by-product from processes such as programmed cell death, abiotic stress and systemic signalling in filamentous fungi and plants (Mittler 2002; Aguirre et al. 2005; Mittler et al. 2011). ROS have also been associated with the mode of action of currently used antifungals such as miconazole (Ene et al. 2012a). We have found in this work that when N. crassa was released from C and N limitation, chitosan antifungal activity was reduced. High nutrient supply would increase metabolic rate and generate ROS as by-product. However, at the same time a high amount of antioxidant enzymes could be synthesized in order to scavenge ROS excess and prevent cell damage (Yan et al. 2006). An alternative way to reduce the hyperoxidant state in fungi treated with chitosan would be to increase reducing power by supplying a higher C and N content to the growth medium. In this regard, when lactate was used as a main carbon source instead of glucose, C and N limitation increased N. crassa sensitivity to chitosan to a larger extent (ca. 4-fold) compared to

166

F. Lopez-Moya et al.

Fig 8 e Effect of chitosan on human lymphocytes. (A) Lymphocyte mortality estimated by propidium iodide staining after flow cytometry. (B) Lymphocyte proliferation determined with the CFSE cell proliferation kit after flow cytometry. Asterisks indicate significant differences (P < 0.05) in lymphocyte mortality. Line indicates the half maximal inhibitory concentration (IC50) for chitosan. Values are the average ±SE from 6 estimations made on independent lymphocyte populations.

glucose. Since chitosan antifungal activity depends directly on the energetic status of the cell, our result could be explained because lactate is able to provide less reducing power and it is less efficient energetically than glucose. The nutritional status also affected the sensitivity of filamentous fungi and yeast pathogens to chitosan. This increase in sensitivity with nutrient limitation has also been found in Candida albicans for other antifungals (Ene et al. 2012a; Ene et al. 2012b). Candida spp. have shown a high sensitivity to chi~ a et al. 2013; Kulikov et al. 2014). tosan in previous studies (Pen Fusarium proliferatum is an important human pathogen which causes mycoses in immunosuppressed patients (Summerbell et al. 1988) which was found in our study even more sensitive to chitosan than Candida spp. The plant pathogen F. oxysporum f. sp. radicis-lycopersici was previously found to be highly sensitive to chitosan (Palma-Guerrero et al. 2008). We have also found Cryptococcus spp. to be sensitive to chitosan. This polymer has been found to be a cell wall component of Cryptococcus neoformans and a requirement for virulence and persistence in mammalian hosts of the fungus (Baker et al. 2007; Baker et al. 2011). Chitosan added exogenously to the growth medium could generate a chitosan excess which would determine its antifungal effect to Cryptococcus spp. found in our work. As for the other human pathogens, the C and N status influence in the same direction chitosan antifungal activity on C. neoformans and Cryptococcus gattii. Most chitosan concentrations tested in our study were non-toxic for mammalian cells (Qi et al. 2005). We found a low cytotoxicity of chitosan on lymphocytes, but no effect on their proliferation as found in other studies (Borges et al. 2007). In our study, we have shown that chitosan reduced C. albicans virulence on Galleria mellonella. This experimental insect host has been previously used to evaluate the effect of other antimicrobials on Candida spp. virulence (Cowen et al. 2009; Mesa-Arango et al. 2013). Besides, we have also reported that lowering nutrients increased this inhibitory effect of chitosan on C. albicans virulence. Future studies should aim to investigate the basis of the reduction of virulence and the increase of antifungal effect of chitosan associated with C and N limitation, because C. albicans encounters carbon-poor

conditions during infection and growth in its hosts (Lorenz & Fink 2001). To this respect, alternative carbon sources are known to strongly influence C. albicans virulence and its susceptibility to antifungal drugs (Ene et al. 2012a). In conclusion, we have shown that nutrient (C and N) status and ROS are key factors of chitosan antifungal mode of action. The mechanisms by which both factors cause fungal membrane permeabilization and death should be further investigated. To this respect, N. crassa, high levels of ROS are known to activate the mechanisms which trigger programmed cell death (Castro et al. 2008). The liaison between ROS production, membrane permeabilization and its implication in membrane lipid peroxidation should be established by evaluating this process under diverse nutrient (C and N) conditions and chitosan doses. Other alternative mechanisms by which chitosan permeabilizes membranes and kills fungal cells cannot be excluded. Perhaps a balance between ROS detoxification and antioxidant mechanisms could be the key to understand the differential sensitivity of fungi to chitosan. Future studies should also contemplate the effect of ROS scavenging nutrients (Chen & Dickman 2005) and the expression of ROS detoxification enzymes on chitosan antifungal activity. Our results illustrate that chitosan is a promising antifungal agent towards relevant human fungal pathogens whose potency can be enhanced by modifying the nutritional status in its environment. The low toxicity on mammalian cells opens new opportunities for the clinical use of chitosan as an antifungal alone or in combination with conventional antifungals.

Acknowledgements This work was supported by Grants from the Spanish Ministries of Economy and Competitiveness (AGL 2011-29297/AGR) and (BFU 2010-16548). We thank Dr Wilhem Hansberg (UNAM, Mexico), Dr Hans€ rje Jansson (Lund University, Sweden and University of AliBo " cante, Spain) and Drs Jose Martin-Nieto and Fernando Marva (University of Alicante, Spain) for their critical comments

75

Carbon and nitrogen limitation enhances chitosan antifungal activity

167

Fig 9 e Effect of chitosan on virulence of Candida albicans on Galleria mellonella under different nutrient (C and N) regimes in YPD medium. (A) and (C) YPD 0.253 (0.8 C; 0.3 N g lL1) and YPD 0.53 (4 C; 1.5 N g lL1) respectively without C. albicans (mortality by chitosan). (B) and (D) YPD 0.253 (0.8 C; 0.3 N g lL1) and YPD 0.53 (4 C; 1.5 N g lL1) respectively, inoculated with C. albicans. Mortality confidence interval 152e262 h for 100 mg mlL1 of chitosan (p < 0.05). Treatments: Controls [ no chitosan; chi [ chitosan concentrations. N/P [ Galleria mellonella larvae non-injected (no treatment) at all.

and English revisions of the manuscript. We also thank Ms Almudena Aranda-Martinez and Ms Aurora AlagueroCordovilla (University of Alicante) for their experimental support. We also wish to thank help to elaborate the manuscript from Ms Nuria Escudero (University of Alicante).

Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.funbio.2014.12.003.

references

Aguirre J, Rıos-Momberg M, Hewitt D, Hansberg W, 2005. Reactive oxygen species and development in microbial eukaryotes. Trends in Microbiology 13 (3): 111e118.

76

Allan CR, Hadwiger LA, 1979. The fungicidal effect of chitosan on fungi of varying cell wall composition. Experimental Mycology 3: 285e287. Baker LG, Specht CA, Donlin MJ, Lodge JK, 2007. Chitosan, the deacetylated for of the chitin, is necessary for cell wall integrity in Cryptococcus neoformans. Eukaryotic Cell 6 (5): 855e867. Baker LG, Specht CA, Lodge JK, 2011. Cell wall chitosan is necessary for virulence in the opportunistic pathogen Cryptococcus neoformans. Eukaryotic Cell 10 (9): 1264e1268. Borges O, Borchard G, de Sousa A, Junginger HE, Cordeiro-daSilva A, 2007. Induction of lymphocytes activated marker CD69 following exposure to chitosan and alginate biopolymers. International Journal of Pharmaceutics 337 (1e2): 254e264. Burke D, 2000. Methods in Yeast Genetics: a Cold Spring Harbor Laboratory course manual. Cold Spring Harbor Laboratory, Plainview, N.Y. Calamari S, Bojanich M, Barembaum S, Berdicevski N, Azcurra A, 2011. Antifungal and post-antifungal effects of chlorhexidine, fluconazole, chitosan and its combinations on Candida albicans. Medicina Oral Patologia Oral Cirugia Bucal 16 (1): e23ee28.

168

Carneiro P, Duarte M, Videira A, 2012. Disruption of alternative NAD(P)H dehydrogenases leads to decreased mitochondrial ROS in Neurospora crassa. Free Radical Biology & Medicine 52 (2): 402e409. ~ o A, Glass NL, Videira A, 2008. Increased Castro A, Lemos C, Falca resistance of complex I mutants to phytosphingosine-induced programmed cell death. Journal of Biological Chemistry 283 (28): 19314e19321. Chen C, Dickman MB, 2005. Proline suppresses apoptosis in the fungal pathogen Colletotrichum trifolii. Proceedings of the National Academy of Sciences of the United States of America 102 (9): 3459e3464. Clinical and Laboratory Standards Institute, 2008. Reference method for broth dilution antifungals susceptibility testing of filamentous fungi; approved standards CLSI Document M38eA2. Clinical and Laboratory Standards Institute, 2nd edn. Clinical and Laboratory Standards Institute, Wayne, Pa. € hler JR, Collins C, Zaas AK, Schell WA, Cowen LE, Singh SD, Ko Aziz H, Mylonakis E, Perfect JR, Whitesell L, Lindquist S, 2009. Harnessing Hsp90 function as a powerful, broadly effective therapeutic strategy for fungal infectious disease. Proceedings of the National Academy of Sciences of the United States of America 106 (8): 2818e2823. Ene IV, Adya AK, Wehmeier S, Brand AC, Maccallum DM, Gow NAR, Brown AJP, 2012a. Host carbon sources modulate cell wall architecture, drug resistance and virulence in a fungal pathogen. Cellular Microbiology 14 (9): 1319e1335. Ene IV, Heilmann CJ, Sorgo AG, Walker LA, De Koster CG, Munro CA, Klis FM, Brown AJP, 2012b. Carbon source-induced reprogramming of the cell wall proteome and secretome modulates the adherence and drug resistance of the fungal pathogen Candida albicans. Proteomics 12 (21): 3164e3179. Fuchs BB, O’Brien E, Khoury JBE, Mylonakis E, 2010. Methods for using Galleria mellonella as a model host to study fungal pathogenesis. Virulence 1 (6): 475e482. Hongo T, Fujii Y, Igarashi Y, 1990. An in vitro chemosensitivity test for the screening of anti-cancer drugs in childhood leukemia. Cancer 65 (6): 1263e1272. Howlett NG, Avery SV, 1997. Induction of lipid peroxidation during heavy metal stress in Saccharomyces cerevisiae and influence on plasma membrane fatty acid unsaturation. Applied and Environmental Microbiology 63 (8): 2971e2976. Jaime MDLA, Lopez-Llorca LV, Conesa A, Lee AY, Proctor M, Heisler LE, Gebbia M, Giaever G, Westwood JT, Nislow C, 2012. Identification of yeast genes that confer resistance to chitosan oligosaccharide (COS) using chemogenomics. BMC Genomics 13 (1): 267. Kaushik NK, Kim HS, Chae YJ, Lee YN, Kwon G, Choi EH, Kim IT, 2012. Synthesis and anticancer activity of di (3-thienyl) methanol and di (3-thienyl) methane. Molecules 17 (10): 11456e11468. Kowaltowski AJ, de Souza-Pinto NC, Castilho RF, Vercesi AE, 2009. Mitochondria and reactive oxygen species. Free Radical Biology & Medicine 47: 333e343. Kulikov SN, Lisovskaya SA, Zelenikhin PV, Bezrodnykh EA, Shakirova DR, Blagodatskikh IV, Tikhonov VE, 2014. Antifungal activity of oligochitosans (short chain chitosans) against some candida species and clinical isolates of Candida albicans: molecular weight-activity relationship. European Journal of Medicinal Chemistry 74: 169e178. Kumar RMNV, 2000. A review of chitin and chitosan applications. Reactive and Functional Polymers 46 (1): 1e27. Lorenz MC, Fink GR, 2001. The glyoxylate cycle is required for fungal virulence. Nature 412 (6842): 83e86. Lyons AB, 2000. Analysing cell division in vivo and in vitro using flow cytometric measurement of CFSE dye dilution. Journal of Immunological Methods 243 (1e2): 147e154. Martin-Bland J, Altman DG, 1998. Survival probabilities (the Kaplan-Meier method). British Medical Journal 317 (7172): 1572.

F. Lopez-Moya et al.

Mesa-Arango AC, Forastiero A, Bernal-Mart"ınez L, CuencaEstrella M, Mellado E, Zaragoza O, 2013. The non-mammalian host Galleria mellonella can be used to study the virulence of the fungal pathogen Candida tropicalis and the efficacy of antifungal drugs during infection by this pathogenic yeast. Medical Mycology 51 (5): 461e472. Miceli MH, D"ıaz JA, Lee SA, 2011. Emerging opportunistic yeast infections. Lancet Infectious Diseases 11 (2): 142e151. Mittler R, 2002. Oxidative stress, antioxidants and stress tolerance. Trends in Plant Science 7 (9): 405e410. Mittler R, Vanderauwera S, Suzuki N, Miller G, Tognetti VB, Vandepoele K, Gollery M, Shulaev V, Van Breusegem F, 2011. ROS signaling: the new wave? Trends in Plant Science 16 (6): 300e309. Nitsche BM, Jørgensen TR, Akeroyd M, Meyer V, Ram AFJ, 2012. The carbon starvation response of Aspergillus niger during submerged cultivation: insights from the transcriptome and secretome. BMC Genomics 13 (1): 380. Palma-Guerrero J, Jansson H-B, Salinas J, Lopez-Llorca LV, 2008. Effect of chitosan on hyphal growth and spore germination of plant pathogenic and biocontrol fungi. Journal of Applied Microbiology 104 (2): 541e553. Palma-Guerrero J, Huang IC, Jansson H-B, Salinas J, LopezLlorca LV, Read ND, 2009. Chitosan permeabilizes the plasma membrane and kills cells of Neurospora crassa in an energy dependent manner. Fungal Genetics and Biology 46: 585e594. "rez-Berna " AJ, Huang I, Palma-Guerrero J, Lopez-Jimenez JA, Pe Jansson H, Salinas J, Lopez-Llorca LV, 2010. Membrane fluidity determines sensitivity of filamentous fungi to chitosan. Molecular Microbiology 75 (4): 1021e1032. ~ a A, Sa " nchez NS, Calahorra M, 2013. Effects of chitosan on Pen Candida albicans: conditions for its antifungal activity. BioMed Research International 2013 (2013) Article ID 527549, 15. http: //dx.doi.org/10.1155/2013/527549. € l T, Prigneau O, Porta A, Poudrier JA, Colonna-Romano S, Noe Maresca B, 2003. Genes involve in b-oxidation, energy metabolism and glyoxylate cycle are induced by Candida albicans during macrophage infection. Yeast 20 (8): 723e730. Qi L, Xu Z, Jiang X, Li Y, Wang M, 2005. Cytotoxic activities of chitosan nanoparticles and copper-loaded nanoparticles. Bioorganic & Medicinal Chemistry Letters 15 (5): 1397e1399. Ram"ırez MA, Lorenz MC, 2007. Mutations in alternative carbon utilization pathways in Candida albicans attenuate virulence and confer pleiotropic phenotypes. Eukaryotic Cell 6 (2): 280e290. € rl C, 2008. Changing epidemiology of sysRichardson M, Lass-Flo temic fungal infections. Clinical Microbiology and Infection 14 (4): 5e24. Shapiro RS, Robbins N, Cowen LE, 2011. Regulatory circuitry governing fungal development, drug resistance, and disease. Microbiology and Molecular Biology Reviews 75 (2): 213e267. Summerbell RC, Richardson SE, Kane J, 1988. Fusarium proliferatum as an agent of disseminated infection in an immunosuppressed patient. Journal of Clinical Microbiology 26 (1): 82e87. " gyi M, Miskei M, Kara " nyi Z, Lenkey B, Po " csi I, Emri T, 2013. Szila Transcriptome changes initiated by carbon starvation in Aspergillus nidulans. Microbiology (UK) 159 (1): 176e190. Thevissen K, Terras FR, Broekaert WF, 1999. Permeabilization of fungal membranes by plant defensins inhibits fungal growth. Applied and Environmental Microbiology 65: 5451e5458. Vogel HJ, 1956. A convenient growth medium for Neurospora. Microbial Genetics Bulletin 13: 42e46. Yan Y, Wei C, Zhang W, Cheng H, Liu J, 2006. Cross-talk between calcium and reactive oxygen species signaling. Acta Pharmacologica Sinica 27 (7): 821e826.

77

Carbon and nitrogen limitation enhances chitosan antifungal activity

Yari S, Parivar K, Nabiuni M, Keramatipour M, 2013. Effect of embryonic cerebrospinal fluid on proliferation and differentiation of neuroprogenitor cells. Cell Journal 15 (1): 29e36. Younes I, Sellimi S, Rinaudo M, Jellouli K, Nasri M, 2014. Influence of acetylation degree and molecular weight of homogeneous

78

169

chitosans on antibacterial and antifungal activities. International Journal of Food Microbiology 185: 57e63. Zakrzewska A, Boorsma A, Brul S, Hellingwerf KJ, Klis FM, 2005. Transcriptional response of Saccharomyces cerevisiae to the plasma membrane-perturbing compound chitosan. Eukaryotic Cell 4: 703e715.

Supplementary materials

Supplementary Figure 1a.

79

Supplementary figure 1. Effect of chitosan (0.5- 1000 µg ml-1) on growth of filamentous fungi pathogens under different nutrient (C and N) conditions. (A, B, C) Hamigera avellanea and (D, E, F) Rhizopus stolonifer with a C and N content of the medium: (A, D) 0.8/0.031 g L-1, (B, E) 2.32/0.087 g L-1, (C, F) 4/0.15 g L-1, respectively. (G, H, I) Fusarium proliferatum, with a C and N content of medium: (G) 0.04/0.0015 g L-1, (H) 0.2/0.007 g L-1, (I) 4/0.15 g L-1 and (J-O) Aspergillus fumigatus with a C and N content of medium: (J) 0.04/0.0015 g L-1, (K) 0.2/0.007 g L-1, (L) 0.4/0.015 g L-1,(M) 0.8/0.031 g L-1, (N) 2.32/0.087 g L-1, (O) 4/0.15g L-1, respectively.

80

Supplementary Figure 2a.

81

Supplementary figure 2. Chitosan effect (1-240 µg mL-1) on growth of yeast pathogens under different nutrient (C and N) conditions. (A, B, C) Candida albicans, (D, E, F) Candida krusei, with a C and N content of medium: (A, D) 0.04/0.015 g L-1, (B, E) 0.2/0.074 g L-1, (C, F) 2/0.74 g L-1, respectively. (G, H) Candida glabrata and (I, J) Candida parapsilosis, with a C and N content of medium: (G, I) 2/0.74 g L-1 and (H, J) 4/1.5 g L-1. (K-R) Cryptococcus spp.: Cryptococcus neoformans with a C and N content of medium: (K) 0.04/0.015 g L-1, (L) 0.2/0.074 g L-1, (M) 0.4/0.15 g L-1, (N) 0.8/0.3 g L-1, (O) 2/0.74 g L-1, (P) 4/1.5g L-1 and Cryptococcus gattii with a C and N content of medium: (Q) 2/0.74 g L-1, (R) 4/1.5g L-1.

82

Supplementary table 1. Chitosan effect (as cytotoxic index) on two mammalian cell lines: human cells (HEK293) and monkey cells (COS7). Cytotoxic index: (1-ODtreated-ODcontrols)x100.

Chitosan concentrations (µg/ml)

1 5 10 25 50 100 150 DMSO Dried cells

Cell line COS7

Cell line HEK293

Cells per well

Cells per well

5 000

20 000

5 000

20 000

-4.05 -26.86 -24.38 -23.06 -25.45 -9.59 -13.47 68.51 61.16

-5.40 -5.87 0.53 1.45 -1.76 -3.50 -8.74 91.60 87.47

-4.15 -9.41 -1.42 -3.54 -4.66 -25.71 -26.82 70.34 65.69

26.86 20.78 17.76 9.22 17.49 9.82 14.39 94.49 90.39

Dashed line indicates cytotoxic index values >IC50

83

Supplementary table 2. Effect of chitosan on cell proliferation (72 h time course of cytotoxic index) on two mammalian cell lines (HEK293 and COS7). Cytotoxic index: (1-ODtreated-ODcontrols)x100

1 5 Chitosan 10 25 concentrations 50 (µg/ml) 100 150 DMSO Dried cells

Cell line COS7

Cell line HEK293

Time (hours)

Time (hours)

24h -1.43 8.20 5.79 2.41 -10.60 1.05 1.05 78.35 63.61

48h -13.23 12.17 -2.65 -9.07 -23.36 -3.19 21.77 87.21 76.15

Dashed line indicates cytotoxic index values >IC50

84

72h -8.57 19.31 25.49 2.72 -11.75 -8.05 87.66 92.30 84.04

24h 5.32 1.03 10.38 7.63 16.21 13.72 24.96 58.40 63.72

48h -24.32 -37.84 -35.37 -42.97 -22.44 -32.36 61.07 89.77 84.19

72h -6.65 -15.29 2.47 -5.56 -6.84 -1.12 96.36 96.02 93.59

CHAPTER 2

Neurospora crassa transcriptomics reveals oxidative stress and plasma membrane homeostasis biology genes as key targets in response to chitosan. Federico Lopez-Moya1, David Kowbel2, Mª José Nueda3, Javier Palma-Guerrero2, 4, N. Louise Glass2 and Luis Vicente Lopez-Llorca1. 1Laboratory

of

Plant

Pathology,

Multidisciplinary

Institute

for

Environmental Studies (MIES) Ramon Margalef, Department of Marine Sciences and Applied Biology, University of Alicante, E-03080 Alicante, Spain. 2Department of Plant and Microbial Biology, University of California, Berkeley CA, 94720-3120 USA. 3Statistics and Operation Research Department, University of Alicante, E-03080 Alicante, Spain. 4Current address: Department of Environmental Systems Science, ETH Zurich, Zurich, Switzerland.

Molecular Biosystems, 2016, 12(2): 391-403

85

Molecular BioSystems PAPER

Cite this: DOI: 10.1039/c5mb00649j

Neurospora crassa transcriptomics reveals oxidative stress and plasma membrane homeostasis biology genes as key targets in response to chitosan† c b Federico Lopez-Moya,*a David Kowbel,b Ma Jose ´ Nueda, Javier Palma-Guerrero,‡ b a N. Louise Glass and Luis Vicente Lopez-Llorca

Chitosan is a natural polymer with antimicrobial activity. Chitosan causes plasma membrane permeabilization and induction of intracellular reactive oxygen species (ROS) in Neurospora crassa. We have determined the transcriptional profile of N. crassa to chitosan and identified the main gene targets involved in the cellular response to this compound. Global network analyses showed membrane, transport and oxidoreductase activity as key nodes affected by chitosan. Activation of oxidative metabolism indicates the importance of ROS and cell energy together with plasma membrane homeostasis in N. crassa response to chitosan. Deletion strain analysis of chitosan susceptibility pointed NCU03639 encoding a class 3 lipase, involved in plasma membrane repair by lipid replacement, and NCU04537 a MFS monosaccharide transporter related to assimilation of simple sugars, as main gene targets of chitosan. NCU10521, a glutathione S-transferase-4 Received 29th September 2015, Accepted 1st December 2015 DOI: 10.1039/c5mb00649j

involved in the generation of reducing power for scavenging intracellular ROS is also a determinant chitosan gene target. Ca2+ increased tolerance to chitosan in N. crassa. Growth of NCU10610 (fig 1 domain) and SYT1 (a synaptotagmin) deletion strains was significantly increased by Ca2+ in the presence of chitosan. Both genes play a determinant role in N. crassa membrane homeostasis. Our results are of paramount

www.rsc.org/molecularbiosystems

importance for developing chitosan as an antifungal.

Introduction Chitosan is a polymer obtained by partial chitin N-deacetylation1 which has antifungal activity.2 Chitosan inhibits the growth of filamentous fungi and yeast human pathogens.3,4 To develop chitosan as an antifungal, a full understanding of its mode of action is necessary. In Saccharomyces cerevisiae, the response to chitooligosaccharides is mediated by proteins associated with plasma membrane, respiration, ATP production and mitochondrial organization.5 Five genes (arl1, bck2, erg24, msg5 and rba50) were characterized that provided chitosan resistance when

a

Laboratory of Plant Pathology, Multidisciplinary Institute for Environmental Studies (MIES) Ramon Margalef, Department of Marine Sciences and Applied Biology, University of Alicante, E-03080 Alicante, Spain. E-mail: [email protected], [email protected] b Department of Plant and Microbial Biology, University of California, Berkeley CA, 94720-3120 USA. E-mail: [email protected], [email protected] c Statistics and Operation Research Department, University of Alicante, E-03080 Alicante, Spain. E-mail: [email protected] † Electronic supplementary information (ESI) available. See DOI: 10.1039/ c5mb00649j ‡ Current address: Department of Environmental Systems Science, ETH Zurich, Zurich, Switzerland. E-mail: [email protected]

This journal is © The Royal Society of Chemistry 2015

overexpressed or increased sensitivity as a deletion strain. These genes have important roles in signaling pathways, cell membrane integrity and transcription regulation.5 Other transcriptional studies in S. cerevisiae revealed the relevance of oxidative respiration, mitochondrial biogenesis and transport in the response to chitosan.6 Previous physiological studies in N. crassa demonstrated that chitosan causes plasma membrane permeabilization.7 Membrane fluidity is a key factor determining chitosan sensitivity in fungi.8 Cell energy and mitochondrial activity also have an important role in moderating the antifungal activity of chitosan.7 The transcriptional response of filamentous fungi to this antifungal remains unknown. Membrane damage caused by currently used antifungals (e.g. azoles) is associated with the induction of intracellular reactive oxygen species (ROS).9,10 We have recently shown that low chitosan concentration increased intracellular ROS levels in N. crassa leading to partial membrane permeabilization.4 Increasing chitosan dose dramatically induced the ROS levels causing full membrane permeabilization and subsequent cell death. Oxidative stress by chitosan is mediated by the energetic status of the cell. A reduction in cell energy by blocking the electron transport chain protected N. crassa from chitosan damage.7 The plasma membrane of N. crassa contains high

Mol. BioSyst.

87

Paper

levels of polyunsaturated free fatty acids (FFA), this fact is directly associated with its susceptibility to chitosan.8 Fungal plasma membrane lipids could be easily oxidized by an induction of intracellular oxidative stress generated by chitosan as found for other antifungals.10,11 This fact would link ROS and membrane homeostasis biology in the mode of action of chitosan. Ca2+ is known to be involved in plasma membrane repair.12 Previous molecular studies revealed that SYT1, a synaptotagmin, involved in membrane repair in several organisms13 including N. crassa.14 Moreover, Ca2+ plays a role in the response to oxidative stress and programmed cell death in N. crassa.15 PRM1 and FIG1 are key proteins in a calcium-dependent plasma membrane remodeling during membrane fusion in S. cerevisiae and N. crassa.16–19 In N. crassa, two additional proteins, LFD1 and LFD2, are also involved in Ca2+-dependent plasma membrane repair during cell fusion.14,20 It is currently unknown, however, how fungi repair membrane damage caused by chitosan. In this work, we analyzed the transcriptional response of N. crassa germinating conidia and determined the main gene functions related to the exposure to chitosan. We applied temporal series analysis (Next-maSigPro21 and ASCA-genes22) and a network analysis approach (Cytoscape)23 to understand the dynamics of functions and gene targets involved in N. crassa response to chitosan. This study has pointed mitochondrion (ROS) and membrane homeostasis as the main functions in the response of N. crassa to chitosan and has identified key gene targets. Deletion strains of these key genes were evaluated for fitness and growth. We further demonstrated that extracellular calcium protects fungal cells from damage caused by chitosan. These studies are a key step for improving the knowledge on the mode of action of chitosan, which is essential for its future development as an antifungal.

Results and discussion Chitosan causes an early activation and late repression of N. crassa genes The experimental conditions for analyzing the effect of chitosan on N. crassa germination and development are shown in Fig. 1. Time-course of N. crassa conidia germination is presented in Fig. 1A. Germination defects were quantified after 8 h exposure of N. crassa conidia to 0.5 mg mlÿ1 chitosan (Fig. 1B; IC50) which showed an approximately 50% reduction in germination. This chitosan concentration was used for a high throughput transcriptomic study. To identify transcriptional changes caused by exposure of N. crassa to chitosan a 3-stage time-course (4, 8 and 16 h postinoculation) was performed. A total of 523 N. crassa genes were considered differentially expressed ( p-value o0.05), with a fold change Z2 (lower fold change values were considered nonsignificant), in response to chitosan (Fig. 2A). Of these, 55.6% (291 genes) were down-regulated and 45.3% (237 genes) were up-regulated. Our time-course experiment showed a progressive reduction in the number of genes whose expression increased upon exposure to chitosan (142 induced genes at 4 h, 119 at 8 h

Mol. BioSyst.

88

Molecular BioSystems

Fig. 1 Time-course effect of chitosan on N. crassa conidia germination. (A) N. crassa germination started prior to 4 h then conidia develop a germ tube (6–8 h) and established a young mycelium before 16 h. (B) Effect of chitosan on conidia germination at 8 h, IC50 (50% germination) was found at 0.5 mg mlÿ1 chitosan. IC50: half maximal inhibitory concentration.

and 45 at 16 h; Fig. 2B). In contrast, exposure to chitosan resulted in an increase in the number of genes whose expression levels decreased over time (79, 93 and 207 genes down-regulated at 4, 8 and 16 h, respectively; Fig. 2C). A subset of 22 genes was differentially expressed consistently ( p-value o0.05; log2 foldchange Z2) throughout the whole time-course (Fig. 2A). Most of these genes (19) were down-regulated, two genes were up-regulated and only one gene of this set (NCU05018) had an early (4 and 8 h) induction and a late (16 h) gene repression (Fig. 2D). The expression of 10 N. crassa genes which are representative of functional categories that were differentially expressed by exposure to chitosan was selected to validate our RNA-seq analysis. Gene expression was evaluated by qRT-PCR following an 8 h exposure to chitosan (Fig. S1, ESI†). These genes were NCU05134, NCU06123, NCU07610, NCU01382 and NCU05712 (involved in response to oxidative stress), NCU02363 (involved in response to chemical compounds), NCU05018, NCU3494 pin-c (related to heterokaryon incompatibility and membrane biology), NCU05764 (a samdependent methyltransferase) and a transcription factor with a zinc-finger domain (NCU05767). All genes analyzed by qRTPCR showed an expression pattern consistent with that derived from RNA-seq data analysis (Fig. S1, ESI†). N. crassa main gene functions differentially expressed with chitosan are oxidoreductase activity, membrane homeostasis and microtubule organization A gene ontology (GO) functional annotation of N. crassa genes differentially expressed in response to chitosan was carried out

This journal is © The Royal Society of Chemistry 2015

Molecular BioSystems

Paper

Fig. 2 Venn diagram of differential gene expression of N. crassa in response to chitosan. (A) Complete differential gene expression (DGE) including induced and repressed genes in the 4–16 h time-course. (B) Increased DGE, up-regulated genes. (C) Decreased DGE, down-regulated genes. (D) Foldchange of 22 genes significantly differentially expressed in response to chitosan during the whole time-course experiment.

using Blast2GO (Fig. 3 and Fig. S2, S3, ESI†). All GO-domains (molecular function, MF; biological process, BP; cell component, CC) and times were considered together for a complete functional gene expression analysis (Fig. 3A). Oxidoreductase activity (70 genes), membrane (57 genes) and transport (44 genes) were the most enriched GO-terms. Using maSigFun software for RNA-seq data time series analysis combined with GO annotation, we generated the time-course of functional gene expression for the most significantly enriched GO-terms representing N. crassa response to chitosan (Fig. 3B). The analysis identified 12 significant GO-terms using FDR = 0.05 and R2 = 0.4 levels, as suggested in previous studies.24 Chitosan modified patterns of expression of ROS-related GO terms mitochondrion and peroxisome organization (Fig. 3B). Mitochondrion genes increased expression through time reaching maximum values of expression at 16 h, suggesting that chitosan enhances the synthesis/turnover of mitochondrion components (respiration). Genes associated with the peroxisome organization, involved in ROS degradation and catabolism of free fatty acids, were first highly expressed (4 h) then completely repressed (16 h). Likewise, chitosan modified patterns of expression of GO categories related to membrane structure and biology. Exposure to chitosan was associated with repression at 16 h of genes involved in the cell cortex, vesicle organization and conjugation (Fig. 3B). Moreover, G-protein coupled receptor signaling was compromised by chitosan during all the time-course study (Fig. 3B). These features indicate that chitosan significantly compromised both structure and signaling associated with cell membrane homeostasis. Genes associated with GO-terms related to cell growth

This journal is © The Royal Society of Chemistry 2015

such as the microtubule organizing center and motor activity had decreased expression values by chitosan through time (Fig. 3B). This behavior suggests the importance of cytoskeletons in the antifungal action of chitosan. Conversely, chitosan increased expression of genes associated with GO terms involved in protein synthesis (ribosome and ribosome biogenesis, Fig. 3B). This would support the increasing expression of genes and synthesis of proteins related to oxidoreductase activity by chitosan (Fig. 3A). In a similar way, nucleolus and structural molecule activity (Fig. 3B) genes were also late activated by chitosan. Potential gene targets of N. crassa to chitosan and their dynamics of expression Initial time-course analysis showed 5% of N. crassa genes significantly expressed in response of N. crassa to chitosan. A subset of 33 genes with a relevant change ( p-value o0.05; log2 fold-change 4 4.5) of expression is shown in Table S1 (ESI†). A restrictive cut-off was applied with the aim of detecting the genes with large change in expression in response to chitosan. This subset included the 22 genes found in the differential gene expression analysis (Fig. 2) and also the highly expressed genes (at early or late steps) associated with enriched GO-terms after chitosan exposure. When applying an ASCA-genes method we focused on a submodel (b + ab) that represents 67.18% of total variation. Two components were selected, explaining 93% of this variability (52.38% and 40.62%, respectively; Fig. S4, ESI†). They, therefore, represented the main gene expression in response to chitosan. First component identified a gene expression difference between

Mol. BioSyst.

89

Paper

Molecular BioSystems

Fig. 4 (A–D) Time-series analysis of well-modelled (M) genes associated with the response of N. crassa to chitosan by ASCA-genes. Graphs represent gene expression average trend of four clusters of genes that follow the discovered general patterns of the ASCA model. Genes that are well represented by the PC obtained using the ASCA model.

Fig. 3 Gene ontology (GO) functional annotation of N. crassa genes differentially expressed in response to chitosan. (A) Global GO annotation of significantly expressed genes. (B) Selected GO-term time-series with maSigFun represented as the average expression profile of the associated genes with each GO.

chitosan and control constant through time (Fig. S4A, ESI†). Second component identified an expression pattern characterized by a clear interaction through time (Fig. S4B, ESI†). The analysis of the squared prediction error (SPE) and leverage, determining a cut-off using a gamma method, revealed 410 genes which followed the selected components (which explained 93% of variation) and 474 genes with a behaviour not identified in these (Fig. S5, ESI†). Comparisons between ASCA and the fold-change gene selection methods (523 genes in total) revealed 447 genes in common (Fig. S4C, ESI†). Summarizes, in this comparison is observed a high overlap between fold-change gene selection and genes with high leverage (also scores can be observed). Moreover 33 genes with a relevant change (listed in Table S1, ESI†) were also identified showing high scores for the two components identified after PCA (Fig. S4C, ESI†).

Mol. BioSyst.

90

To inspect ASCA gene selection time series two cluster analyses were applied: one to the well-modelled genes (M) and another to the bad-modelled genes (NM) obtaining 4 and 6 clusters respectively (Fig. S4 and S6, ESI†). Both analyses were performed using the hierarchical method. Cluster 1M (Fig. 4A) contained genes associated with an early response to chitosan including two dioxygenases: NCU01849, the most highly expressed gene in response to chitosan (11.16 fold-induction) and NCU01071 a predicted 2OG-Fe dioxygenase, both involved in response to oxidative stress. We also found a set of genes mainly associated with the plasma membrane, signaling and response to chemical compounds (NCU02363; RTA1-like protein). In addition, a plasma membrane protein (het domain) associated with intracellular oxidative stress (NCU07840), hypothetical protein with a C-terminal homeodomain (NCU00733) and hypothetical protein with a peroxisome membrane anchored the protein conserved region (NCU04555) which strongly decreased in expression levels in N. crassa conidia treated with chitosan. Cluster 4M showed a steady increase of gene expression (Fig. 4D). Genes in this cluster were involved in cell response to oxidative stress (NCU05134 and NCU08907) and a monosaccharide transporter perhaps involved in chitosan assimilation or detoxification (NCU04537, fold-induction 9.27 after 16 h growing with chitosan). Besides, other genes related to sugars assimilation were also induced in the presence of chitosan such as NCU01633 (hxt13; Table S2, ESI†). Clusters 2M and 3M had gene expression changes in the control but not in the chitosan treatment (Fig. 4B and C). Genes in these clusters were mainly related to fungal reproduction

This journal is © The Royal Society of Chemistry 2015

Molecular BioSystems

and development and response to oxidative stress. Cluster 2M included two genes associated with membrane homeostasis: NCU03494 ( pin-c) essential for non-self-recognition and NCU10610, a protein with a FIG1 domain (Ca2+ regulator and membrane fusion) related to cell fusion. Genes which did not fit the model (NM), with high SPE and leverage in the ASCA analysis, were grouped in 6 clusters including 474 genes (Fig. S6, ESI†). Cluster 5NM which showed a late activation in the presence of chitosan, included genes such as NCU10521 (fold-induction 8.16 at 16 h) a glutathione S-transferase-4 possibly involved in the generation of reducing power for scavenging intracellular ROS. Other genes involved in ROS assimilation were also induced at 16 h such as NCU05780 ( gst-1; Table S2, ESI†). Cluster 3NM included the expression of genes such as NCU08770 a hypothetical protein with a histone chaperone domain with slight changes in expression in the presence of chitosan (Fig. S6, ESI†). Cluster 4NM included genes with an early induction (4–8 h) and then a reduction of gene expression such as NCU03639, a lipase class 3 involved in

Paper

lipids, fatty acids and isoprenoid metabolism. The overexpression of this gene suggests its role in plasma membrane homeostasis during chitosan damage. Other significantly expressed (more than 6 fold-change expression, Table S2, ESI†) genes in response to chitosan, related to the main functions described previously, included NCU03213 encoding a predicted mannosyl-phosphorylation protein related to phosphocholine metabolism (lipid modification). Early induction of other genes related to predicted roles in lipid metabolism such as NCU16960 (geranyl reductase) putative involved in the biosynthesis of plasma membrane lipids was also detected. N. crassa deletion strains involved in membrane homeostasis and ROS detoxification showed increased sensitivity to chitosan Fifteen deletion strains of genes highly expressed and associated with enriched GO-terms in response to chitosan were evaluated to identify gene targets in N. crassa. Five deletion strains showed

Fig. 5 Effect of chitosan on growth of N. crassa WT and selected deletion strains from RNAseq data. (A) Chitosan minimal inhibitory concentration (MIC) of selected deletion strains and WT. (B–E) Fungal growth kinetics of (B) WT, (C) DNCU03639, (D) DNCU04537 and (E) DNCU08770 in response to increasing concentrations of chitosan (n = 4; mean  SE).

This journal is © The Royal Society of Chemistry 2015

Mol. BioSyst.

91

Paper

increased sensitivity to chitosan (Fig. 5 and Fig. S7, ESI†). DNCU03639 (lipase) and DNCU04537 (monosaccharide transporter) were the most sensitive. These deletion strains exhibited a minimal inhibitory concentration (MIC, 3 mg mlÿ1) lower than the WT (MIC 6 mg mlÿ1; Fig. 5A). They also showed a 6–8 h delay in the start of the exponential growth phase at 2 mg mlÿ1 of chitosan in comparison to the WT (Fig. 5B–D). Furthermore, DNCU10521 (glutathione S-transferase), DNCU08907 Clock controller gene 13 (ccg-13) and DNCU07840 (plasma membrane protein with a het domain) were moderately (MIC at 4 mg mlÿ1) sensitive to chitosan (Fig. 5A). These strains showed a 6–12 h delay in the start of the exponential growth phase with respect to the WT at 3 mg mlÿ1 of chitosan (Fig. S7, ESI†). DNCU10610 (Ca2+ regulator with FIG1 domain) showed the same MIC as WT (6 mg mlÿ1), but had a delay (8 h) in the start of the exponential growth phase at 4 mg mlÿ1 chitosan (Fig. S7 and Table S3, ESI†). Conversely, DNCU02363 (RTA1 like-protein) and DNCU05134 (hypothetical protein) with the same MIC as the WT started their exponential phases 7 and 16 h earlier than the WT (Fig. S7 and Table S3, ESI†) indicating moderate tolerance of chitosan with respect to WT. DNCU08770 (hypothetical protein with a histone chaperone domain CHZ) had increased resistance to chitosan (MIC 46 mg mlÿ1; Fig. 5E). The start of the exponential growth phase in this deletion strain was 15 h earlier than the WT at 4 mg mlÿ1 of chitosan (Table S3, ESI†). Thirteen deletion strains (mating type a) were crossed to WT (mating type A) to assess meiotic segregation of the chitosan sensitivity phenotype with the hygromycin marker. Segregants of each mutant showed similar chitosan sensitivity to the

Molecular BioSystems

original deletion strain. In four chitosan gene targets (DNCU03639, DNCU04537, DNCU07840 and DNCU10521), segregants showed the same chitosan antifungal phenotype (MIC) and hygromycin resistance as the original deletion strains. Ca2+ protects N. crassa conidia from chitosan damage Ca2+ increased tolerance to chitosan in N. crassa (Fig. 6). The WT strain at 0.68 mM CaCl2 with 0.5 mg mlÿ1 chitosan resumed growth 4 h earlier than without Ca2+ (Fig. 6A). A higher level of CaCl2 (2.72 mM) in the presence of 0.5 mg mlÿ1 chitosan further improved fungal growth with 7 h advance in the start of the exponential phase with respect to N. crassa with chitosan and no calcium (Fig. 6A). Increasing CaCl2 concentrations with no chitosan did not affect fungal growth (data are not shown). Conidia in the calcium-free medium treated with chitosan (0.5 mg mlÿ1) were stained (Fig. 6B) with the vital dye propidium iodide (PI) indicating cell mortality. On the contrary, conidia treated with both chitosan (0.5 mg mlÿ1) and calcium chloride (0.68 mM) showed no staining remaining alive (Fig. 6C). Similar results were found when chitosan concentration was increased (Fig. S8, ESI†). In particular, 0.5, 2.5 and 5 mg mlÿ1 chitosan and CaCl2 treated cells had significantly ( p-value o0.05) lower mortality than conidia treated with chitosan but no calcium. Treatment with Ca2+ also reduced chitosan damage in deletion strain in the locus DNCU10610 with a FIG1 domain and DNCU03263 (syt-1), both associated with plasma membrane remodeling (Fig. 6D and E). Increasing CaCl2 concentration (10 mM to 20 mM) significantly improved the growth of WT, DNCU10610 and DNCU03263 strains in a medium amended with a high amount of chitosan

Fig. 6 Effect of Ca2+ on chitosan antifungal activity to N. crassa WT and deletion strains from membrane remodeling genes (DNCU10610 and DNCU03263-D syt 1). (A) N. crassa WT growth in response to chitosan (0.5 mg mlÿ1) with several Ca2+ concentrations. (B) Nuclear damage after the treatment of conidia of a strain in which PI has been targeted to the nuclei. Conidia treated with chitosan and stained with 2 mg mlÿ1 propidium iodide (PI). Fluorescence images right and DIC images of same conidia on the left. Bar = 5 mm. (C) Evaluation of conidia viability treated with chitosan and Ca2+ stained with PI.

Mol. BioSyst.

92

This journal is © The Royal Society of Chemistry 2015

Molecular BioSystems

(4 mg mlÿ1; Fig. 6D and E). With less concentration of Ca2+ in the medium (0.68 mM), chitosan completely inhibited fungal growth. DNCU10610 showed more tolerance to chitosan with respect to WT, this strain started the exponential phase at 27 h, whereas WT strain did so 3 h later under the same conditions. DNCU03263 was most sensitive to chitosan with a high amount of calcium, starting the exponential phase after 35 h, with slower growth than WT and DNCU10610. When [CaCl2] was increased (20 mM) all strains tested showed higher resistance to chitosan (Fig. 6E). This was especially relevant for DNCU03263 which showed a ca. 2 fold growth increase under these conditions (Fig. 6E). In this work we found that chitosan significantly induced the changes in expression of 5% of N. crassa genes in the genome. A global Cytoscape network showed membrane and transport as key nodes grouping genes affected by chitosan (Fig. 7). Plasma membrane was connected with cell vesicles and cell wall suggesting the importance of these outer structures and their dynamics in the presence of chitosan. The oxidoreductase enhanced node indicated the importance of ROS and cell energy in N. crassa response to chitosan.4,7 Several nodes related to cytoskeleton dynamics indicate that chitosan also affects cell growth (Fig. 7). Other transcriptional studies using S. cerevisiae mutant collections determined genes associated with plasma membrane, respiration, ATP production and mitochondrial organization as main targets of chitooligosaccharides.5,6 In this study, we demonstrated that exposure to chitosan increased the expression of genes involved in plasma membrane dynamics such as lipases. Imidazoles and triazoles (e.g. fluconazole, voriconazol and others) mode of action is based on the ergosterol biosynthesis inhibition,25,26 thereby altering plasma

Paper

membrane fluidity. Chitosan is also an antifungal affecting plasma membrane. Fungi with enriched unsaturated free fatty acids in their plasma membrane (increased fluidity) are sensitive to chitosan (e.g. N. crassa). In contrast, fungi with less unsaturated free fatty acids in their membranes (low fluidity), such as the nematophagus fungus Pochonia chlamydosporia, are resistant to chitosan.8,27 In our work, we show that chitosan activates genes related to plasma membrane homeostasis such as the class 3 lipase NCU03639 (Fig. 8). The increase in chitosan sensitivity of NCU03639 deletion strain and the induction of genes related to free fatty acid plasma membrane remodeling such as NCU16960 (geranyl reductase), suggest their role in lipid replacement. This group of genes is mainly associated with plasma membrane stabilization by changes in the free fatty acid composition caused by other abiotic stresses.28 Furthermore, chitosan also activated genes related to vesicular transport, which is associated with lipid transfer.29 Moreover, chitosan also induced expression of N. crassa genes related to the movement of molecules through the plasma membrane such as MFS transporters. The activation of a monosaccharide transporter and other genes related to exchange of molecules is one of the general responses of N. crassa to chitosan. Transport activation is a widely described response of several filamentous fungi and yeast in response to antifungals.30 Candida albicans activates genes involved in transport and molecule trafficking in the presence of ketoconazole.31 Susceptibility to azoles has been likely found due to a reduced efflux activity of pumps.32 Likewise, amphotericin B induces expression of high-affinity glucose transporters (MFS transporters) and permeases encoding genes in S. cerevisiae.30 In our study, N. crassa NCU04537 deletion strain, encoding a

Fig. 7 Cytoscape network of functional gene annotation of N. crassa gene response to chitosan. Large font tittles represent a summary of GO-terms found enriched in clusters. Node size correlates to the number of genes annotated to that functional category. Each node represents a gene function significantly enriched (FDR r 0.1).

This journal is © The Royal Society of Chemistry 2015

Mol. BioSyst.

93

Paper

Molecular BioSystems

Fig. 8 Key genes associated with N. crassa response to chitosan. In this model, NCU03639 would increase membrane permeability by altering mechanisms of plasma membrane remodeling and fluidity. NCU10610 (Ca2+ regulator with FIG1 domain) would be associated with the mechanisms of plasma membrane remodeling mediated by Ca2+. NCU04534 (MFS transporter) could be involved in mechanisms of assimilation or detoxification monosaccharaides (e.g. monomers of N-acetyl glucosamine). NCU10521 (glutathione transferase), NCU01849 and NCU01071 (dioxygenases) would be related to the response of the fungus to the oxidative stress, the key response of N. crassa to chitosan. Genes involved in mechanisms associated with protein synthesis (NCU04555) and resistance to chemical compounds (NCU02363) are also differentially expressed in response to chitosan.

monosaccharide transporter, showed an increase in chitosan sensitivity, suggesting a determinant role of this protein in the assimilation of glucosamine and N-acetyl glucosamine monomers.33 Currently used antifungals, as well as chitosan, induce intracellular oxidative stress affecting plasma membrane permeability. This may be associated with an imbalance of the intracellular redox state.4,10 An increase in the intracellular ROS is a general response to several antifungals and antimicrobial peptides which target the plasma membrane.9,34 We have also recently demonstrated that chitosan elicited a rise in ROS coincident with the start of plasma membrane permeabilization.4

Mol. BioSyst.

94

In this paper we have demonstrated that chitosan induced the expression of genes encoding mono- and dioxygenases and other proteins related to ROS homeostasis. Other antifungals (e.g. rotenone and staurosporine) also increase the levels of intracellular oxidative stress associated with subsequent cellular death.35,36 Increase in associated ROS by chitosan could induce plasma membrane free fatty acid oxidation and formation of oxylipins.37 These would damage the plasma membrane and cause its subsequent permeabilization.38 In our study, when NCU10521, encoding a glutathione S-transferase (GST), was eliminated sensitivity of N. crassa to chitosan increased. GST is known to deaden ROS by-products such as peroxidized lipids.39

This journal is © The Royal Society of Chemistry 2015

Molecular BioSystems

This suggests a link between ROS and membrane damage in the mode of action of chitosan (Fig. 8). Other antifungals also induce glutathione enzymes to reduce intracellular ROS levels in N. crassa.40 We have discovered that chitosan inhibits gene functions related to cytoskeleton dynamics such as microtubule organization and motor activity. The increased levels of intracellular ROS in Magnaporthe oryzae caused F-actin depolymerization affecting hyphal polar growth.41 In N. crassa deletion of a NOX gene encoding a NADPH oxidase results in reduction of hyphal growth.42 These observations support the hypothesis that an increase in intracellular ROS causes an abnormal distribution of F-actin. Cytoskeleton disorganization could then be one of the mechanisms by which chitosan inhibits fungal growth. The oxidative stress and associated phenomena such as free fatty acid peroxidation or F-actin polymerization could be directly involved in chitosan antifungal activity. It is known that the balance between Ca2+ and ROS affects intracellular signaling and cell homeostasis.43 We have demonstrated that Ca2+ is involved in N. crassa tolerance to chitosan. Ca2+ is also involved in the increasing threshold of N. crassa to antifungals such as staurosporine.44 Calcium plays a role in the mechanisms of plasma membrane remodeling in S. cerevisiae budding45 and during cell fusion in N. crassa.14,17 In this work, we report NCU10610 (Ca2+ regulator with FIG1 domain) significantly repressed by chitosan. The presence of a FIG1 domain suggests its role as a Ca2+ regulator in cell fusion. In view of the relevance of this phenomenon in plasma membrane remodeling, we have also evaluated the role of SYT1 in the mechanisms of plasma membrane remodeling mediated by Ca2+. SYT1 may be involved in membrane damage restored during fusion of germlings in N. crassa.14 In our study Dsyt1 had increased sensitivity to chitosan. When Dsyt1 was exposed to chitosan together with Ca2+ (10 mM) we found increased sensitivity of this deletion strain to chitosan with respect to WT. This would be associated with the capability of this gene to trigger mechanisms of plasma membrane damage repair mediated by Ca2+. Besides, high levels of extracellular Ca2+ (20 mM) highly reduced chitosan damage in Dsyt1. This deletion strain grows with the same fitness as the WT under these conditions. This would be associated with the activation of other N. crassa genes involved in plasma membrane remodeling mediated by Ca2+. Our results would suggest the importance of Ca2+ on the mechanisms of plasma membrane remodeling after chitosan damages.

Conclusion and outlook This work provides the first study of the gene expression response of a filamentous fungus (N. crassa) to chitosan. Transcriptomics revealed oxidoreductase activity, membrane homeostasis and microtubule organization as the main gene functions differentially expressed. We identified a class 3 lipase, a MFS monosaccharide transporter and a glutathione transferase as main gene targets of chitosan in N. crassa. Our study opens new possibilities to study gene pathways involved in membrane

This journal is © The Royal Society of Chemistry 2015

Paper

remodeling after chitosan damage with a relevant role of Ca2+. These studies are a key step to develop chitosan as an antifungal drug in the future. Our results could help to identify the main gene targets of chitosan in medical important fungi.

Methods Growth conditions Neurospora crassa wild-type strain was 74-OR23-IVA (FGSC2489) and the deletion strains were generated by the Neurospora Genome Project46,47 and kindly provided by the Fungal Genetics Stock Center (FGSC, Kansas, USA)48 which are shown in Table S1 (ESI†). Strains were grown on a Vogel’s minimal medium agar (VMMA) (1 Vogel’s salts, 2% sucrose and 1.5% technical agar). Chitosan A medium molecular weight chitosan (70 kDa) with an 82.5% deacetylation degree (T8s; Marine BioProducts GmbH; Bremerhaven, Germany) was used. Chitosan was prepared as described in Palma-Guerrero et al., 2008.27 Germinating conditions and time-course of N. crassa sensitivity to chitosan To determine the optimal medium to assess the behavior of N. crassa exposed to chitosan, three variants of the Vogel’s minimal medium (VMM) were evaluated. These media were standard VMM (1 salts, 2% sucrose), VMM salts diluted 100 times with 2% sucrose and VMM salts diluted 100 times with 0.02% sucrose. We finally adopted the second one because chitosan precipitated with some salts included in standard VMM. Time-course experiments of germination were assessed every 2 h for 24 h under continuous light, shaking at 200 rpm and 25 1C. N. crassa conidia sensitivity to chitosan was evaluated using selected media, with sub-lethal concentrations of chitosan (0.1–1 mg mlÿ1). The percentage of N. crassa conidial germination with chitosan for 2, 4, 6, 8, 10, 12 and 16 h after inoculation was measured. We selected a chitosan dose that resulted in a 50% inhibition of germination with respect to the control (IC50). RNA extraction and cDNA synthesis From N. crassa cultures in contact with chitosan and controls (without chitosan) for 4, 8 and 16 h total RNA was isolated using a TRIzol reagent (Life Tech) according to the manufacturer’s instructions. RNA was then treated with DNase (Turbo DNA-free, Ambion) to eliminate DNA remains. For poly(A+) RNA purification, 10 mg of total RNA was bound to dynal oligo (dT) magnetic beads (Invitrogen) twice, using the manufacturer’s instructions. Purified poly (A+) RNA was fragmented by metal-ion catalysis (Ambion) followed by precipitation with 1/10 vol 3M sodium acetate and 3 vol 100% ethanol. Precipitated RNA was washed with 70% ethanol and then resuspended into 10.5 mL nuclease free water. For first strand cDNA synthesis, the fragmented poly (A+) RNA was incubated with 3 mg of random hexamers (Invitrogen), incubated at 65 1C for 5 min and then transferred to ice. First strand buffer (4 mL; Invitrogen),

Mol. BioSyst.

95

Paper

dithiothreitol (DTT), dNTPs and RNAseOUT (Invitrogen) were added to a final concentration of 1, 10 mM, 200 mM and 1 U mLÿ1, respectively, in a final volume of 20 mL and the samples were incubated at 25 1C for 2 minutes. Superscript II (200 U; Invitrogen) was added and the samples were incubated at 25 1C for 10 min, 42 1C for 50 min and 70 1C for 15 min. For second strand synthesis, 51 mL of H2O, 20 mL of 5 second strand buffer (Invitrogen), and dNTPs (10 mM) were added to the first cDNA strand synthesis mix and incubated on ice for 5 min. RNaseH (2 U; Invitrogen) and DNA pol I (50 U; Invitrogen) were then added and the mixture was incubated at 16 1C for 2.5 h. Library construction and sequencing End-repair was performed by adding 45 mL of H2O, T4 DNA ligase buffer with 10 mM ATP (NEB; 10 mL), dNTP mix (10 mM), T4 DNA polymerase (15 U; NEB), Klenow DNA polymerase (5 U; NEB), and T4 PNK (50 U; NEB) to the sample and incubating for 30 min at 20 1C. A single base was added each to cDNA fragment by adding Klenow buffer (NEB), dATP (1 mM), and Klenow 3 0 to 5 0 exo-(15 U; NEB). The mixture was then incubated at 37 1C for 30 min. Standard Illumina adapters (FC) were ligated to the cDNA fragments using 2 DNA ligase buffer (Enzymatics), 1 mL of adapter oligo mix and DNA ligase (5 U; Enzymatics). The sample was incubated at 25 1C for 15 min. The sample was purified in a 2% low-melting point agarose gel, and a slice of gel containing 200 bp fragments was removed and the DNA purified. The polymerase chain reaction (PCR) was used to enrich the sequencing library. A 10 mL aliquot of purified cDNA library was amplified by PCR using the pfx DNA polymerase (2 U; Invitrogen) and with 1 mL of genomic primers 1.1 and 2.1 (Illumina). PCR cycling conditions included a denaturing step at 98 1C for 30 s, 12 cycles of 98 1C for 10 s, 65 1C for 30 s, 68 1C for 30 s, and a final extension at 68 1C for 5 min. All libraries were sequenced on a HiSeq 2000 platform to a depth of over 190 million 50 bp reads using standard Illumina operating procedures. Transcript abundance, annotation and functional analysis Sequenced libraries were mapped against the predicted transcripts from the Neurospora crassa OR74A genome (v10) with TopHat (v2.0.4)49 and the short sequence aligner Bowtie (v2.0.0.6).50 Transcript abundance measured as FPKMs (Fragments Per Kilobase transcript model per Million fragments mapped) was calculated with Cufflinks (v2.0.2) using counts that exclusively mapped to predict transcripts to estimate the FPKM denominator. Genes which had a differential expression cut-off of p-value o0.05 (we adjusted p-value as the Benjamini Hochberg filter; a q value in TopHat; to adjust for the false discovery rate) between control and sample were used for further analysis. In the fold change analysis a log2 fold change Z2 was adopted to characterize the main gene functions and genes involved in the response of N. crassa to chitosan. The project of N. crassa gene expression profile in response to chitosan has been deposited in NCBI’s Gene Expression Omnibus51 and is accessible through GEO series accession number GSE75293 (https://www.ncbi.nlm.nih.gov/geo/query/acc. cgi?acc=GSE75293).

Mol. BioSyst.

96

Molecular BioSystems

N. crassa transcript sequences were re-annotated using Blast2GO software (Version 2.7.1) to improve the standard annotation provided by the Broad N. crassa genome (http:// www.broadinstitute.org/annotation/genome/neurospora/Multi Home.html), a consensus set of transcripts were functionally annotated (gene ontology, GO) using Blast2GO (http://www. blast2go.com/b2ghome).52 Gene families were established using the InterPro (http://www.ebi.ac.uk/interpro) and KEGG databases (http://www.genome.jp/kegg/pathway.html). For N. crassa gene annotation we also used several tools, HMMR53 including Pfam, TIGRFAM, Gene 3D and Superfamily databases. In addition, Wolf PSORT54 was used to obtain information about domains and cellular gene localizations. Gene annotations were finally examined using BLASTp.55 RNA-seq time-series data analysis Significant differential gene expression changes over time were assessed by applying the maSigPro R package21 to the groups of genes included in each functional GO category. This approach was described, as an adaptation of maSigPro56 named as maSigFun24 for microarray data. This algorithm has been updated for RNA-seq data in this work. The maSigPro method follows a two-stage regression strategy to identify genes with significant changes in expression over time. The false discovery rate (FDR) and the R2 level as the measure of the good of fit of the regression model are the factors for gene selection. Finally, the package includes several clustering algorithms and visualization tools available to the group and displays the selected gene-profiles. Transcriptional responses of interest were detected using the application of the ASCA-gene method.22 Considering an experiment with 2 factors (a and b, usually time and the experimental group, in our case chitosan treatment), data can be collected in a data matrix X, where rows represent samples and columns represent genes. ASCA first decomposes X into matrices (Xa, Xb and Xab) with the estimates of the ANOVA (analysis of variance) parameters: Xa contains the time effects, Xb the treatment effects and Xab the interactions, obtained gene by gene. When the main interest of a study is the identification of genes with differences in the experimental groups, Xb is joined to Xab. Principal component analysis (PCA) is then applied on each of these matrices to summarize the information of each source of variation and giving as a result two PCA analyses that are called submodels. ASCA-genes compute the main patterns of variation and two statistics for each gene in each submodel: leverage and the squared-prediction error (SPE). Leverage indicates the importance of a gene in the main behavior discovered. SPE quantifies the variability of a gene that is not detected for the model. Focusing on these measures, ASCA-genes provide two lists of genes: the first one with genes that follow the main general patterns. The second one including genes with odd behaviors or outlier data. To obtain this gene selection the gamma method57 was applied. Real time quantitative PCR for RNA-seq validation cDNA was synthesized using a retro-transcriptase RevertAid (Thermo) with oligo dT (Thermo). Gene expression was quantified

This journal is © The Royal Society of Chemistry 2015

Molecular BioSystems

using real-time reverse transcription PCR (qRT-PCR), SYBR Green with ROX (Roche) was used following the manufacturer’s instructions. Gene quantifications were performed in a step one plus real-time PCR system (Applied Biosystems). Relative gene expression was estimated using the DDCt methodology,58 with three technical replicates per condition. Primers used to quantify the expression of genes related to N. crassa response to chitosan are shown in Table S4 (ESI†). Expression of the TATA-binding protein (NCU04770) and transcription elongation factor S-II (NCU02563) were used as endogenous controls for all experiments, since these genes showed Ct stability for all conditions tested. Evaluation of selected deletion strains to determine the genes involved in the response of N. crassa to chitosan Experiments in liquid media were set to evaluate growth kinetics of N. crassa (WT) and selected homokaryon deletion strains (Table S1, ESI†). N. crassa conidia were obtained from 8–10 day-old sporulated cultures, by adding 2 ml of distilled water. The resulting conidial suspensions were then filtered through a Miracloth (Calbiochem) to remove hyphal fragments. Conidial suspensions were adjusted to a final concentration of 106 conidia mlÿ1 with 1/100 VMM salts and 2% sucrose. Chitosan (1–6 mg mlÿ1) was added to the medium and 200 mL per well were dispensed into 96 well microtiter plates (Sterillin Ltd, Newport, UK). Plates were inoculated with N. crassa conidia (2  105 conidia per well) and then incubated at 25 1C for 48 h in a GENiost multiwell spectrophotometer ¨nnedorf, Switzerland) in the dark. The chitosan (Tecan, Ma effect on the growth of N. crassa strains was evaluated by measuring the optical density at 490 nm (OD490).4 In order to identify the antifungal activity of chitosan on N. crassa strains, we applied a spot assay in the SFG medium (2% sorbose, 0.05% glucose and fructose and 1.5% agar).59 Growth in the presence of the same concentration of deletion strains (mating type a) to chitosan was confirmed by segregation analysis.60 Ascospore progeny was selected from crosses with FGSC 2489 (mating type A). Segregants were tested both for chitosan and hygromycin sensitivity. The latter was tested in all deletion strains used in this work. Segregants had the same chitosan sensitivity than the original deletion strain and were hygromycin (200 mg mlÿ1) resistant. Evaluation of the effect of Ca2+ in the response of N. crassa to chitosan To evaluate the effect of Ca2+ on conidia treated with chitosan, we exposed N. crassa conidia (106 conidia mlÿ1) to chitosan (0.5 mg mlÿ1) with either 0.17; 0.34; 0.68; 1.36 or 2.72 mM CaCl2. Growth kinetics was evaluated in a 96-multiwell microplate by measuring the optical density at 490 nm for 48 h, as described above. Viability of conidia was determined using propidium iodide (PI; Sigma)7 after exposure to chitosan (0.5 mg mlÿ1) and CaCl2 at 0.68 mM, conidia without CaCl2 were used as a control for this compound. N. crassa conidia were treated with chitosan for 2 h and then labeled with 2 mg mlÿ1 PI to evaluate cell viability. Fluorescence in conidia was assessed using an Olympus BH-2

This journal is © The Royal Society of Chemistry 2015

Paper

fluorescence microscope with 488 nm and 560 nm as excitation and detection wavelengths, respectively, and then photographed using a Leica DFC480 digital camera (Leica Microsystems, Wetzlar, Germany). The effect of higher concentrations of Ca2+ (10 and 20 mM) on the WT and two deletion strains, DNCU10610 (Ca2+ regulator with FIG1 domain) and DNCU03263 (syt1) when combined with chitosan (4 mg mlÿ1) was also determined. A cytoscape network of functional gene annotation of N. crassa gene response to chitosan For this analysis, we performed functional enrichment analysis by GSEA (gene set enrichment analysis).61 The enrichment maps were generated using Enrichment Map Plugin v1.162 developed for Cytoscape.23 Nodes in the maps were clustered with the Markov clustering algorithm, using an overlap coefficient computed by the plugin as the similarity metric (coefficient o0.5 were set to zero) and an inflation parameter with value of 2. For each cluster, the leading edge was computed as in Subramanian et al. (2005)61 for each member of a node. A complete functional gene network map of N. crassa in response to chitosan was finally generated.

Acknowledgements This work was supported by the National Institutes of Health (USA) grant GM060468 to NLG and Spanish Ministry of Economy and Competitiveness Grant AGL 2011-29297/AGR to LVLL. We thank Dr Maria DLA Jaime (University of National Institutes of Health–NIDDK, Bethesda, USA) for helping in GSEA and Cytoscape analyses. We also thank support from BioBam Bioinformatics (Valencia, Spain) to use Blast2GO Pro. We also would like to thank Dr Nuria Escudero (University of Alicante) for her critical comments of the manuscript.

References 1 R. M. N. V. Kumar, React. Funct. Polym., 2000, 46(1), 1–27. 2 C. R. Allan and L. A. Hadwiger, Exp. Mycol., 1979, 3(3), 285–287. 3 S. N. Kulikov, S. A. Lisovskaya, P. V. Zelenikhin, E. A. Bezrodnykh, D. R. Shakirova, I. V. Blagodatskikh and V. E. Tikhonov, Eur. J. Med. Chem., 2014, 74, 169–178. 4 F. Lopez-Moya, M. F. Colom-Valiente, P. Martinez-Peinado, J. E. Martinez-Lopez, E. Puelles, J. M. Sempere-Ortells and L. V. Lopez-Llorca, Fungal Biol., 2015, 119(2–3), 154–169. 5 M. D. L. A. Jaime, L. V. Lopez-Llorca, A. Conesa, A. Y. Lee, M. Proctor, L. E. Heisler, M. Gebbia, G. Giaever, J. T. Westwood and C. Nislow, BMC Genomics, 2012, 13(1), 267. 6 A. Zakrzewska, A. Boorsma, S. Brul, K. J. Hellingwerf and F. M. Klis, Eukaryotic Cell, 2005, 4(4), 703–715. 7 J. Palma-Guerrero, I. C. Huang, H.-B. Jansson, J. Salinas, L. V. Lopez-Llorca and N. D. Read, Fungal Genet. Biol., 2009, 46(8), 585–594. ´rez-Berna ´, 8 J. Palma-Guerrero, J. A. Lopez-Jimenez, A. J. Pe I. Huang, H.-B. Jansson, J. Salinas, J. Villalaı´n, N. D. Read

Mol. BioSyst.

97

Paper

9 10

11 12 13

14 15

16 17 18 19

20 21 22

23 24 25 26 27 28 29

30

and L. V. Lopez-Llorca, Mol. Microbiol., 2010, 75(4), 1021–1032. M. A. Ghannoum and L. B. Rice, Clin. Microbiol. Rev., 1999, 12(4), 501–517. I. E. J. A. François, B. P. A. Cammue, M. Borgers, J. Ausma, G. D. Dispersyn and K. Thevissen, Anti-Infect. Agents Med. Chem., 2006, 5(1), 3–13. N. Delattin, B. P. Cammue and K. Thevissen, Future Med. Chem., 2014, 6(1), 77–90. N. W. Andrews, P. E. Almeida and M. Corrotte, Trends Cell Biol., 2014, 24(12), 734–742. K. D. Brewer, T. Bacaj, A. Cavalli, C. Camilloni, J. D. Swarbrick, J. Liu, A. Zhou, P. Zhou, N. Barlow, J. Xu, ¨ussinger, A. M. A. B. Seven, E. A. Prinslow, R. Voleti, D. Ha Bonvin, D. R. Tomchick, M. Vendruscolo, B. Graham, ¨dhof and J. Rizo, Nat. Struct. Mol. Biol., 2015, T. C. Su 22(7), 555–564. J. Palma-Guerrero, A. C. Leeder, J. Welch and N. L. Glass, Mol. Microbiol., 2014, 92(1), 164–182. A. P. Gonçalves, J. M. Cordeiro, J. Monteiro, C. Lucchi, ´ and A. Videira, Biochim. Biophys. Acta, P. Correia-de-Sa 2015, 1847(10), 1064–1074. E. M. Muller, N. A. Mackin, S. E. Erdman and K. W. Cunningham, J. Biol. Chem., 2003, 278(40), 38461–38469. A. Fleissner, S. Diamond and N. L. Glass, Genetics, 2009, 181(2), 497–510. B. Cavinder and F. Trail, Eukaryotic Cell, 2012, 11(8), 978–988. ´. Curto, M. R. Sharifmoghadam, E. Calpena, N. De M. A ´n, M. Hoya, C. Doncel, J. Leatherwood and M. H. Leo Valdivieso, Genetics, 2014, 196(4), 1059–1076. J. Palma-Guerrero, J. Zhao, A. P. Gonçalves, T. L. Starr and N. L. Glass, Eukaryotic Cell, 2015, 14(3), 265–277. M. J. Nueda, S. Tarazona and A. Conesa, Bioinformatics, 2014, 30(18), 2598–2602. M. J. Nueda, A. Conesa, J. A. Westerhuis, H. C. J. Hoefsloot, ´n and A. Ferrer, Bioinformatics, 2007, A. K. Smilde, M. Talo 23(14), 1792–1800. M. E. Smoot, K. Ono, J. Ruscheinski, P. L. Wang and T. Ideker, Bioinformatics, 2011, 27(3), 431–432. ´n, S. Tarazona, F. Garcı´a-Garcı´a, M. J. Nueda, P. Sebastia J. Dopazo, A. Ferrer and A. Conesa, BMC Bioinf., 2009, 10(6), S9. F. C. Odds, A. J. Brown and N. A. Gow, Trends Microbiol., 2003, 11(6), 272–279. ˜ oz, G. Giusiano, P. A. Ezkurra and A. J. Carrillo-Mun ´s, Rev. Esp. Quimioter., 2006, 19(2), 130–139. G. Quindo J. Palma-Guerrero, H.-B. Jansson, J. Salinas and L. V. LopezLlorca, J. Appl. Microbiol., 2008, 104(2), 541–553. L. N. Nguyen, A. Gacser and J. D. Nosanchuk, Virulence, 2011, 2(6), 538–541. C. M. Schauder, X. Wu, Y. Saheki, P. Narayanaswamy, F. Torta, M. R. Wenk, P. De Camilli and K. M. Reinisch, Nature, 2014, 510(7506), 552–555. A. K. Agarwal, P. D. Rogers, S. R. Baerson, M. R. Jacob, K. S. Barker, J. D. Cleary, L. A. Walker, D. G. Nagle and A. M. Clark, J. Biol. Chem., 2003, 278(37), 34998–35015.

Mol. BioSyst.

98

Molecular BioSystems

31 C. F. Hoehamer, E. D. Cummings, G. M. Hilliard and P. D. Rogers, Antimicrob. Agents Chemother., 2010, 54(5), 1655–1664. 32 E. Thomas, E. Roman, S. Claypool, N. Manzoor, J. Pla and S. L. Panwar, Antimicrob. Agents Chemother., 2013, 57(11), 5580–5599. 33 H. L. Mobley, R. J. Doyle, U. N. Streips and S. O. Langemeier, J. Bacteriol., 1982, 150(1), 8–15. 34 B. M. Hayes, M. A. Anderson, A. Traven, N. L. van der Weerden and M. R. Bleackley, Cell. Mol. Life Sci., 2014, 71(14), 2651–2666. ˜o, A. S. Fernandes, N. L. Glass 35 A. Castro, C. Lemos, A. Falca and A. Videira, Eukaryotic Cell, 2010, 9(6), 906–914. 36 A. P. Gonçalves, C. Hall, D. J. Kowbel, N. L. Glass and A. Videira, G3 (Bethesda), 2014, 4(6), 1091–1102. 37 F. Brodhun and I. Feussner, FEBS J., 2011, 278(7), 1047–1063. 38 A. Singh and M. Del Poeta, Cell. Microbiol., 2011, 13(2), 177–185. 39 Y. Yang, J. Z. Cheng, S. S. Singhal, M. Saini, U. Pandya, S. Awasthi and Y. C. Awasthi, J. Biol. Chem., 2010, 276(22), 19220–19230. 40 A. S. Fernandes, A. Castro and A. Videira, Apoptosis, 2013, 18(8), 940–948. 41 L. S. Ryder, Y. F. Dagdas, T. A. Mentlak, M. J. Kershaw, C. R. Thornton, M. Schuster, J. Chen, Z. Wang and N. J. Talbot, Proc. Natl. Acad. Sci. U. S. A., 2013, 110(8), 3179–3184. ´lvarez-Delfı´n, W. Hansberg and 42 N. Cano-Domı´nguez, K. A J. Aguirre, Eukaryotic Cell, 2008, 7(8), 1352–1361. 43 Y. Yan, C. L. Wei, W. R. Zhang, H. P. Cheng and J. Liu, Acta Pharmacol. Sin., 2006, 27(7), 821–826. 44 A. P. Gonçalves, J. Monteiro, C. Lucchi, D. J. Kowbel, ´, D. J. Rigden, N. L. Glass J. M. Cordeiro, P. Correia-de-Sa and A. Videira, Microb. Cell, 2014, 1(9), 289–302. 45 P. D’hooge, C. Coun, V. Van Eyck, L. Faes, R. Ghillebert, ¨n, J. Winderickx and G. Callewaert, Cell Calcium, L. Marie 2015, 58(2), 226–235. 46 H. V. Colot, G. Park, G. E. Turner, C. Ringelberg, C. M. Crew, L. Litvinkova, R. L. Weiss, K. A. Borkovich and J. C. Dunlap, Proc. Natl. Acad. Sci. U. S. A., 2006, 103(27), 10352–10357. 47 J. C. Dunlap, K. A. Borkovich, M. R. Henn, G. E. Turner, M. S. Sachs, N. L. Glass, K. McCluskey, M. Plamann, J. E. Galagan, B. W. Birren, R. L. Weiss, J. P. Townsend, J. J. Loros, M. A. Nelson, R. Lambreghts, H. V. Colot, G. Park, P. Collopy, C. Ringelberg, C. Crew, L. Litvinkova, D. DeCaprio, H. M. Hood, S. Curilla, M. Shi, M. Crawford, M. Koerhsen, P. Montgomery, L. Larson, M. Pearson, ¨rkmen, L. Altamirano and T. Kasuga, C. Tian, M. Bas- tu J. Xu, Adv. Genet., 2007, 57, 49–96. 48 K. McCluskey, Adv. Appl. Microbiol., 2003, 52, 245–262. 49 C. Trapnell, L. Pachter and S. L. Salzberg, Bioinformatics, 2009, 25(9), 1105–1111. 50 B. Langmead, C. Trapnell, M. Pop and S. L. Salzberg, Genome Biol., 2009, 10(3), R25. ¨tz, Int. J. Plant Genomics, 2008, 51 A. Conesa and S. Go 2008, 619832.

This journal is © The Royal Society of Chemistry 2015

Molecular BioSystems

52 R. Edgar, M. Domrachev and A. E. Lash, Nucleic Acids Res., 2002, 30(1), 207–210. 53 R. D. Finn, J. Clements and S. R. Eddy, Nucleic Acids Res., 2011, 39, 29–37. 54 P. Horton, K. J. Park, T. Obayashi, N. Fujita, H. Harada, C. J. Adams-Collier and K. Nakai, Nucleic Acids Res., 2007, W585–W587. 55 W. Gish and D. J. States, Nat. Genet., 1993, (3), 266–272. 56 A. Conesa, M. J. Nueda, A. Ferrer and M. Talon, Bioinformatics, 2006, 22(9), 1096–1102. ´pez, J. Dopazo, A. Ferrer and 57 S. Tarazona, S. Prado-Lo A. Conesa, Chemom. Intell. Lab. Syst., 2012, 100, 113–122.

This journal is © The Royal Society of Chemistry 2015

Paper

58 K. J. Livak and T. D. Schmittgen, Methods, 2001, 25, 402–408. 59 H. E. Brockman and F. J. de Serres, Genetics, 1963, 48(4), 597–604. 60 A. C. Leeder, W. Jonkers, J. Li and N. L. Glass, Genetics, 2013, 195(3), 883–898. 61 A. Subramanian, P. Tamayo, V. K. Mootha, S. Mukherjee, B. L. Ebert, M. A. Gillette, A. Paulovich, S. L. Pomeroy, T. R. Golub, E. S. Lander and J. P. Mesirov, Proc. Natl. Acad. Sci. U. S. A., 2005, 102(43), 15545–15550. 62 D. Merico, R. Isserlin, O. Stueker, A. Emili and G. D. Bader, PLoS One, 2010, 5(11), e13984.

Mol. BioSyst.

99

Molecular BioSystems

Supplementary materials

Figure S1. qRT-PCR validation of differentially-expressed N. crassa genes. Bars represent the expression levels (log2foldchange) of selected N. crassa genes obtained from qRT-PCR (dark grey) and Illumina RNA-seq data (light grey) analyses. Genes were used for validation of up-regulated genes were NCU02363, NCU05018, NCU05134 whereas NCU06123, NCU05764, NCU05767, NCU07610, NCU01382, NCU03494 (PIN-C) and NCU05712 were selected for down-regulated gene validation.

100

Paper

Paper

Molecular BioSystems

Figure S2. Pie chart of up-regulated functions of Gene Ontology (GO) annotation of N. crassa genes differentially expressed in response to chitosan.

Molecular BioSystems

Paper

Figure S3. Pie chart of down-regulated functions of Gene Ontology (GO) annotation of N. crassa genes differentially expressed in response to chitosan.

Paper

Molecular BioSystems

Figure S4. Time-series analysis of genes associated with the response of N. crassa to chitosan by ASCA-genes submodel b+ab. (A) Loading of the first PC represents 52.38% of the variability. No interaction between treatment and time is observed. (B) Loading of the second PC represents 40.62% of the variability which represents an interaction between chitosan treatment and control through time. (C) Computed scores of all the genes in the analysis for the two principal component (PC) Red dots represented the genes which overlap with the fold-change analysis. Blue triangles represent the selection included in Table 1.

103

Molecular BioSystems

Figure S5. Leverage and SPE values obtained from the ASCA model (b+ab). Red lines represent the cut-off values computed with the gamma method and genes in red are those selected with fold-change criteria.

104

Paper

Paper

Molecular BioSystems

Figure S6. Time-series analysis of genes associated with the response of N. crassa to chitosan by ASCA-genes. Graphs represent gene expression average trend of six clusters of genes that do not follow the discovered general patterns of the ASCA model.

105

Molecular BioSystems

Figure S7. Effect of chitosan on growth kinetics of N. crassa whole deletion strains tested (n=4; mean ± SE).

106

Paper

Paper

Molecular BioSystems

Figure S8. Ca2+ reduces mortality of N. crassa conidia in presence of chitosan. Conidia exposed to chitosan and calcium shown increasing survival after 30 min of exposure. The marks of IP fluorescence significantly increase in absence to calcium. Asterisks remark significantly differences of conidia treated with Ca2+ and chitosan respect that with no Ca2+ (p-value < 0.05).

107

Molecular BioSystems

Paper

Table S1. N. crassa genes with a significant change of expression during the 4 to 16h time-course in response to chitosan. Log2 foldchange > ±4.5 and the main annotation and GO descrition. Genes selected with the ASCA analysis and their cluster localization. Deletion strains evaluated to determine N.crassa sensitivity to chitosan. Grey line highlines a set of 22 genes significantly expresed durin whole timecourse (4-16h). Numbers in bold represented gene expression over 4.5 fold-change. Asterisk indicate genes selected deletion strain. Abreviations: NAGO (non-asociated GO-term); F (molecular function); P (biological process); C (cellular component); M (well-modelled in ASCA analysis); NM (bad-modelled in ASCA analysis). Annotation/Description

NCU01849*

Extracellular dioxygenase. Aromatic compound dioxygenase

NCU00733*

Hypothetical protein/C-terminal domain of homeodomain 1

NAGO

7,71

6,87 1,35

1M

NCU01071*

Hypothetical protein/biofilm formation and stress response. 2OG-Fe dioxygenase

NAGO

7,70

7,28 1,91

1M

NCU02363*

RTA1 domain-containing protein/Signaling and response to compounds

C: membrane; P: response to stress

6,57

5,64 3,98

1M

NCU05018*

Hypothetical protein/related with heterokaryon incompatibility

NAGO

5,89

5,20

4,20

1M

NCU04555*

Hypothetical protein/peroxisomal membrane anchored protein (Pex14p) conserved region

NAGO

5,33

6,15 1,83

1M

NCU07840*

Hypothetical protein/heterokaryon incompatibility protein (het domain), with transmembrane region

P: oxidation-reduction process; F: oxidorreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen; F: heme binding; F: electron carrier activity; F. iron ion binding

5,21

6,36 0,71

1M

NCU05134*

Hypothetical protein/cellular response to oxidative stress

NAGO

4,83

6,03 8,74

4M

NCU03639*

Lipase (class 3)/ lipid, fatty acid and isoprenoid metabolism. Response to oxidative stress

P: biological process; F: hydrolase activity

3,09

2,00 6,29

4NM

NCU08907*

BYS1 domain-containing protein/Clock controller gene 13 (ccg13). Cellular response to oxidative stress

P: response to acetate; C: fungal-type cell wall

0,57

1,91 5,39

4M

NCU04537*

Monosaccharide transporter/MFS sugar transporter

F: C-transporter activity; C: membrane; P: transport

0,27

1,79 9,27

4M

F: ATP binding; F: protein kinase activity; F: nucletide binding; P: protein phosphorilation; F: transferase activity, transferring phosphorous containing groups; P: translational elongation; F: translation elongation factor activity; F: transferase activity

-0,03

8,19 0,91

5NM

Glutathione S-transferase-4/ROS NCU10521* detoxification. Stress related/Cellular response to oxidative stress

Associated GO-term

4h

8h

16h

ASCA Clusters

Gene ID

F:molecular function; P: cellular aromatic compound metabolic process; F: 11,16 8,42 0,33 oxidorreductase activity; P: biological process

1M

NCU08770*

Hypothetical protein. Histone chaperone domain CHZ

NAGO

-3,09

6,91 4,44

3NM

NCU06123

Phosphoketolase, d-xylulose 5-phosphate dfructose 6-phosphate phosphoketolase-like protein. Cellular response to oxidative stress

F: lyase activity; P: biological process

-4,10

4,03 5,77

3M

NCU01861

Short-chain dehydrogenase/ shikimate-quinate 5-dehydrogenase. Response to light stimulus

P: bilogical process; F: molecular function; F: transferase activity; F: oxidorreductase activity

-4,15

4,93 5,83

3M

NCU05069

Fad dependent oxidoreductase

F: molecular function; F: oxidorreductase; P: biological process

-4,17

5,12 4,91

2M

108

Paper

Molecular BioSystems

NCU05764

Hypothetical protein/ sam-dependent methyltransferase

F:methyltransferase activity; F: transferase activity; P: methylation

-4,22

7,20 7,64

1NM

NCU05767

Pro1a c6 zink-finger protein/ DNA binding. Fruit body development (sexually or asexually derived spore)

C: nucleus; F: molecular function; P: RNA metabolic process; P: transcription, DNA template

-4,32

4,45 8,33

2M

NCU09235

Conidiation-specific protein-8/ response to light stimulus. Ascospore, macroconidium and micrconidium

P: biological process; P: sporulation resulting in formation of a cellular spore

-4,36

5,40 4,23

2M

NCU08224

Domain-containing protein/ response to light stimulus

NAGO

-4,51

4,25 4,19

3M

NCU01098

Hypothetical protein/ ankyrin repeat containing protein

F: proteing binding

-4,90

4,08 4,55

2M

NCU10610*

Hypothetical protein/ Ca2+ regulator and membrane fusion protein fig1. Surf7/PalI family

NAGO

-5,14

4,26 3,78

2M

NCU07610

Taurine dioxigenase/ family taurine catabolism dioxygenase. Taurine degradation IV

P: biological process; F: oxidorreductase activity

-5,35

NCU03863

Hypothetical protein/ rta1 domain

C: membrane; P: response to stress

NCU01382

Hypothetical protein/ cellular response to oxidative stress. Fungal specific protein

NAGO

NCU06140

Myb family transcription factor

F: DNA binding; P: RNA metabolic process; P: transcription, DNA-templated; F: molecular function

-6,25

4,86 5,20

2M

NCU05768

Mating response protein POI2/ sporocarp development involved in sexual reproduction. Cellular response of oxidative stress

NAGO

-6,47

8,14 8,24

2M

NCU05761

Hypothetical protein

NAGO

-6,57

NCU11172

Hypothetical protein

NAGO

NCU10387

Dimethylaniline monooxygenase/ nitrogen, sulfur and selenium metabolism

F: molecular function; F: oxidorreductase activity; P: biological process

NCU03494

Partner for incompatibility with het-c/ heterokaryon incompatibility protein. Pin-c

NAGO

NCU06328

Hypothetical protein

NAGO

NCU05712

Hypothetical protein/ cellular response to oxidative stress

NAGO

3,64 7,84 -5,44 5,77 6,30 -6,23 4,47 4,12

8,97 6,36 -6,74 4,58 4,74 -6,85 4,33 6,56 6,25 4,83 -7,52 3,48 6,91 -8,84 6,79 4,51 -7,08

109

3NM 2M 2M

2M 3NM 3NM 2M 3NM 2M

Molecular BioSystems

Paper

Table S2A: Genes with high change of expression at 4h.

Gene

Annotation

log2(foldchange)

NCU01849 NCU09163 NCU08074 NCU03213 NCU05277 NCU16960 NCU11664 NCU07770 NCU07898 NCU01848 NCU12029 NCU05131 NCU00733 NCU01071 NCU10245 NCU06443 NCU00031 NCU08075 NCU09964 NCU04556 NCU04046 NCU11606 NCU02363 NCU11054 NCU11539

extracellular dioxygenase 11,1628 hypothetical protein 9,86534 hypothetical protein 9,39137 mannosylphosphorylation protein8,78922 hypothetical protein 8,23857 hypothetical protein 8,17026 hypothetical protein 8,16686 hypothetical protein 8,016 endoglucanase IV 7,98315 hypothetical protein 7,93537 hypothetical protein 7,92967 hypothetical protein 7,757 hypothetical protein 7,71174 hypothetical protein 7,69824 hypothetical protein 7,53987 hypothetical protein 7,52564 hypothetical protein 7,35708 hypothetical protein 7,27661 hypothetical protein 7,14572 hypothetical protein 7,03414 hypothetical protein 6,89776 hypothetical protein 6,75515 RTA1 domain-containing protein 6,56697 hypothetical protein 6,55458 hypothetical protein 6,5333

NCU08087 NCU01098 NCU06326 NCU03247 NCU10610 NCU08095 NCU09562 NCU07610 NCU02246 NCU03863 NCU02046 NCU09848 NCU11981 NCU01382 NCU06140 NCU05762 NCU05768 NCU06327 NCU05761 NCU11172 NCU10387 NCU03494 NCU12068 NCU06328 NCU05712

hypothetical protein -4,83461 hypothetical protein -4,90098 pectate lyase 1 -5,00484 hypothetical protein -5,07257 hypothetical protein -5,14047 hypothetical protein -5,24743 hypothetical protein -5,31526 taurine dioxygenase -5,34955 hypothetical protein -5,40027 hypothetical protein -5,44343 hypothetical protein -5,66122 hypothetical protein -5,74921 hypothetical protein -6,12894 hypothetical protein -6,23024 hypothetical protein -6,2497 hypothetical protein -6,28496 mating response protein POI2 -6,46907 benzoate 4-monooxygenase cytoc-6,5044 hypothetical protein -6,57046 hypothetical protein -6,7421 dimethylaniline monooxygenase -6,85144 heterokaryon incompatibility prot-7,0822 hypothetical protein -7,21393 hypothetical protein -7,51704 hypothetical protein -8,83828

110

Description

References 4h

FAD binding domain LICD family N-linked oligosaccharides K-hell Sordania Blast Geranyl reductase

Cellulase (polymer degradation) AcylCoA transferase BZip transcription factor Involve in cell cycle and cell division Biofilm formation and stress response factor K-hell Sordania Blast Fungal Zn(2)-Cys(6) binuclear cluster domain K-hell Sordania Blast K-hell Sordania Blast Collagen triple helix Colletotrichium gloesporioides Transciption factor Transciption factor Geranyl reductase. Bisynthesis membrane lipids Signaling. Resistance to compounds. InterPro. PFAM04479 Heterokaryon incompatibility protein Monooxygenase. ROS reduction of dioxygenase

Hutchinson 2009

Hutchinson 2009

Hutchinson 2009

Hutchinson 2009 Jamieson 2013 Jamieson 2014 Corradetti 2012 Hutchinson 2009

4h

Glycosyl hydrolase. Endoglucanase Cellular response to oxidative stress Taurine catabolism dioxygenase. S source in absence of sulphate Ca2+ regulator and membrane fusion protein (fig 1) Response to light stimulus Secretion protein (Blast) Signal peptide. Carbohydrate-binding modulate (Blast) Response to oxidative stress Unknow function. Malate dehydrogenase (Blast). InterPro Unknow function. Malate dehydrogenase (Blast). InterPro

Common central domain of tyrosinase Cellular response to oxidative stress. Detoxification

Saprolegina (SOD) Blast. Transmembrane region (InterPro)

Hutchinson 2009

Paper

Molecular BioSystems

Table S2B: Genes with high change of expression at 8h.

Gene

Annotation

NCU11683 NCU04556 NCU01849 NCU09163 NCU11564 NCU06443 NCU11664 NCU01071 NCU08074 NCU00733 NCU07463 NCU05649 NCU00761 NCU04911 NCU00031 NCU04445 NCU12124 NCU05131 NCU07770 NCU08774 NCU07840 NCU09603 NCU07124

hypothetical protein hypothetical protein extracellular dioxygenase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein RTA1 domain-containing protein triacylglycerol lipase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein

NCU05351

hypothetical protein

NCU04555

hypothetical protein

NCU04371 NCU05069 NCU11983 NCU05844 NCU06650

peptidyl-prolyl cis-trans isomerase f FAD dependent oxidoreductase hypothetical protein hypothetical protein secretory phospholipase A2 thiamine biosynthesis protein NMT1 phytoene desaturase conidiation-specific protein-8 hypothetical protein rds1 hypothetical protein hypothetical protein conidiation-specific protein 6 hypothetical protein heterokaryon incompatibility protei hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein mating response protein POI2 hypothetical protein hypothetical protein hypothetical protein

NCU09345 NCU00552 NCU09235 NCU05914 NCU05143 NCU03863 NCU07449 NCU08769 NCU06597 NCU03494 NCU08095 NCU05712 NCU08770 NCU05764 NCU05763 NCU05762 NCU05768 NCU11984 NCU11981 NCU05761

log2(foldchange)

Description

9,06383 8,55256 8,41696 8,30816 7,75429 Transcription factor IIF, B subunit 7,58667 7,32168 7,27709 6,88329 6,87196 6,86346 Tetratricopeptide repeat. Kinesin. Microtubules motility. Mitosis. 6,74549 Transmembrane protein. Resistance to compounds. PF04479. 6,69956 Carboxyl hydrolase 6,64316 K-hell Sordania 6,59581 6,56899 Restriction enzyme. Helikase. DNA repair. Blast (Botrytis ) 6,49134 DNA binding ribosomal. NCU(12087) Nitrilase 6,47169 6,39562 6,38931 Signal peptide. Transmembrane region (InterPro) 6,35538 Heterokaryon incompatibility protein. Het domain 6,29591 ATP binding (Blast) 6,2458 Terpenoid sinthase UDP-N-acetyl muramoyl tripeptide (Blast). Degradación aas 6,17806 muramoyl. Degradacion glycopeptide de pared SMAC protein (Blast). Promotes citocromo C dependent caspase. 6,15253 Mitocondrial prot. Apoptosis citosol -5,08598 Response light. Response Zn and Ca ion. Signal -5,12466 -5,17713 Signal peptide. Transmembrane region. InterPro -5,18177 Respone light stimulus. -5,26142 Signal peptide No message in thiamine-1. Response pH, response acetate, Hyphal -5,27056 growth -5,37707 albino-1 oxidorreductase. Response ROS, response salt stress -5,40475 -5,43545 Sodium/hydrogen exchange (Blast). Halalkalicoccus -5,74696 Ferritin like domain. Signal peptide (InterPro) -5,76585 -5,88103 -6,04063 Respone light stimulus. -6,10694 Respone light stimulus. -6,25102 -6,36921 -6,78993 -6,91404 ATPase (Blast) -7,20317 -7,2488 Short protein. Signal peptide. Transmembrane InterPro -7,44703 -8,14435 -8,3177 Signal peptide. Transmembrane region. InterPro -8,63892 -8,96639

References 8h

Hutchinson 2009

Hutchinson 2009 Jamieson 2013

Jamieson 2013 Jamieson 2013

8h

Jamieson 2013 Hutchinson 2009 Hutchinson 2009 Hutchinson 2009 Hutchinson 2009

Jamieson 2013

111

Molecular BioSystems

Paper

Table S2C: Genes with high change of expression at 16h.

Gene

NCU04537

Annotation

monosaccharide transporter

NCU05134

hypothetical protein

NCU10521 NCU07902 NCU05908

hypothetical protein hypothetical protein hypothetical protein

NCU01050 NCU03476

endoglucanase II hypothetical protein

NCU04265

hypothetical protein

NCU03639 NCU09648

lipase aldehyde dehydrogenase

NCU10019 NCU07306

hypothetical protein hypothetical protein

NCU09604 NCU05780 NCU02324 NCU03092 NCU09497

hypothetical protein glutathione transferase hypothetical protein nuclear localization sequence binding protein bifunctional D12/D15 fatty acid desaturase

NCU08907 NCU11691

BYS1 domain-containing protein hypothetical protein

log2(foldchange)

Description

References 16h

9,27222 Sugar transporter. Degradation. Cellulosic activity. Cellular response to oxidative stress. Signal peptidase. 8,73905 Transmembrane region InterPro 8,18877 Glutation S-transferase-4. Detoxification. Cell signaling 7,39203 Signal transduction histidine kinase (Blast). Haloferax 6,7343 Deuterollicin metalloprotease (M35) glycosyl hydrolase. Monooxygenase. Cellulase catabolic 6,69942 process 6,508 Glycosyl hydrolase. Response light. Response to 6,44161 fructose. Negative regulation of transcription by glucose 6,29245 Response to oxidative stress 6,01435 Carbohydrate metabolism. Response oxidative stress Integral membrane prot. (Blast). Signal peptidase. 7 5,97546 transmembrane regions 5,79913 Carbon monooxyde dehydrogenase (Blast) Response to oxidative stress. Related myosin heavy 5,62248 chain (Blast) 5,53182 Response oxidative stress 5,5222 5,43864 RNA recognition. Oxidative stress 5,42257 Cellular response to oxidative stress Blastomycetes yeast-phase specific prot. (ccg13). Fugal 5,38678 type cell wall. Response oxidative stress. 5,08776 B-mannosydase Sugar transporter. MFS transporter. Cellulose 4,98088 degradation 4,97605 Serine carboxypeptidase. Response light stimulus 4,8469 Transmemembrane aminoacid. Stimulus. 4,82613 Cellular response to oxydative stress 4,79601 Mucin 5AC like (Bos mutus) Blast 4,71897 Nucleic acids binds

Hutchinson 2009

Hutchinson 2009 Hutchinson 2009 Hutchinson 2009

Jamieson 2013 Hutchinson 2009 Hutchinson 2009 Hutchinson 2009

NCU01633

hexose transporter HXT13

NCU09992 NCU06619 NCU03696 NCU09851 NCU00931

serine peptidase neutral amino acid permease nitroreductase hypothetical protein lysyl-tRNA synthetase

NCU06582 NCU05764

hypothetical protein hypothetical protein

NCU09039 NCU05081 NCU09906 NCU07610 NCU07129 NCU06583 NCU03011 NCU02500

hypothetical protein hypothetical protein hypothetical protein taurine dioxygenase amino-acid permease inda1 hypothetical protein hypothetical protein clock-controlled pheromone CCG-4

NCU07736

PEP5

NCU10539 NCU05768 NCU04282 NCU05767

hypothetical protein mating response protein POI2 hypothetical protein PRO1A C6 Zink-finger protein

NCU09856

hypothetical protein

NCU02196 NCU09823

taurine catabolism dioxygenase TauD hypothetical protein

-7,63108 Protein kinase domain. Energy. Blast. InterPro. -7,63716 Major facilitator superfamily (MFS). Carbohydrate -7,73866 transport -7,74445 Formamidase (Blast). Hydrolase activity. -7,75357 Glycosyl transferase domain -7,84009 -7,86536 Aminoacid transport. 12 transmembrane region -7,93818 Heterokaryon incompatibility prot. Cell diferentiation -7,95818 Aminotransferase class-V -8,04479 Sexual reproduction. Cyrcadian rythm Major facilitator superfamily (MFS). Drug transport. -8,08737 Cellular secretion. Virulence -8,17427 Ankyrin repeat. Transmembrane region -8,23505 -8,25364 -8,3328 ATPase familly associated with various cellular activities. -8,37896 Hydrolase -8,44316 -8,66517 Integral membrane protein (Blast)

NCU07821

dimethylaniline monooxygenase

-8,98665

NCU09904 NCU05822 NCU09046

glucan 1,3-beta-glucosidase hypothetical protein hypothetical protein

NCU07819 NCU08533 NCU07820

alpha-ketoglutarate-dependent taurine hypothetical protein pantothenate transporter

-9,44342 Glycosyl hydrolase. Glucane B-1,3- glucosidase Hutchinson 2009 -9,51265 SAM methyl transferase (Blast) -9,86542 t-RNA dihydrouridine Jamieson 2013 Catabolism dioxygenase (TAU-D). Nitrogen, sulfur and -10,0084 selenium metabolism -10,6019 Ton-B receptor. Energy and signal transcription Jamieson 2013 -10,6412 C-compound and carbohydrate transport. Cellular import

112

Hutchinson 2009

Hutchinson 2009

16h

Jamieson 2013 Jamieson 2013 Hutchinson 2009

Jamieson 2013

Jamieson 2013

FAD dependent oxydorreductase. Nitrogen, sulfur and selenium metabolism

Paper

Molecular BioSystems

Table S3. Time (h) of start the exponential phase of N. crassa WT and selected deletion strains under different concentration of chitosan. NEP: indicate absecnce of growth, non exponential phase. N. crassa Strain WT ΔNCU00733 ΔNCU01071 ΔNCU01849 ΔNCU02363 ΔNCU03639 ΔNCU04537 ΔNCU04555 ΔNCU05018 ΔNCU05134 ΔNCU07840 ΔNCU08770 ΔNCU08907 ΔNCU10521 ΔNCU10610

Start exponential Phase (hours) 1 2 3 4 6 ug/ml ug/ml ug/ml ug/ml ug/ml 12 17 20 32 NEP 13 17 23 36 NEP 15 20 27 32 NEP 13 20 24 30 NEP 3 4 17 25 NEP 14 23 NEP NEP NEP 10 25 NEP NEP NEP 9 10 16 32 NEP 13 17 26 34 NEP 6 12 13 16 NEP 12 16 31 NEP NEP 4 7 14 17 30 12 17 32 NEP NEP 9 10 26 NEP NEP 14 18 23 40 NEP

113

Molecular BioSystems

Paper

Table S4. Primers used to quantify the gene expression of genes involved in response to chitosan by qRT-PCR in N. crassa to validate RNAseq data.

Primer Name NCU04770-TATA-binding_3_F (HK) NCU04770-TATA-binding_3_R (HK) NCU02563-TEF S-II_1_F (HK) NCU02563-TEF S-II_1_R (HK) NCU01382-F NCU01382-R NCU02363-F NCU02363-R NCU03494-F NCU03494-R NCU05018-F NCU05018-R NCU05134-F NCU05134-R NCU05712-F NCU05712-R NCU05764-F NCU05764-R NCU05767-F NCU05767-R NCU06123-F NCU06123-R NCU07610-F NCU07610-R

Seq (5'→3') CGATTGTCGTCTTGATCTGAA CTCACGGATACGCATGATAAC ACTTTTGGAGGAATTGAAAAGAGAT ATACGGGCAATGTCCTTGTT AACTGATAGTCGCAGGAAGGAG ACTACATCCCGACCATCTTCAC ACTTGGTGCCTTTGATTATGGT CTAAGCGCCAACCAGTCTCTT GACAAGTGGGATTGGAGGATAG CTTGCCAACTAGACTGCTCGAT AACGGTATATTTGGGTCCATTTT TATGTATGGAAAAAGAGTGAAGCC ATCCTTCCTCTCGAGGTTCG ACAGTTGCTTCCTACTTGGAGTC GCAAAGAACAAGAGCATGATGA GACCAGGGGGTAAGAGGAATAC CCTCTTCTACTTCCCCTCTTCC TAAGAAAGAAGAGATGCCGCTG AGCTTTGGACAGCTTTTGTGAG ATAGCGGGATCAACAAATCATC AGGATAAGGACGGCGGTAAT CCTCTCTCAACATCCTCCTCAC GACCAGTATGAGCACTTTGACG CTCCAAAAACAACTCATCCTCC

(HK) genes used as a housekeeping to validate the relative gene expression

114

UNPUBLISHED PAPERS

CHAPTER 3

Chitosan arrests Magnaporthe oryzae appressorium differentiation affecting cytoskeletal remodelling Federico Lopez-Moya1, Mark D. Fricker2, George Littlejhon3, Luis V. Lopez-Llorca1 and Nicholas J. Talbot3 1Laboratory

of

Plant

Pathology,

Multidisciplinary

Institute

for

Environment Studies (MIES) Ramón Margalef. University of Alicante, Alicante, Spain. 2Department of Plant Science, University of Oxford, South Parks Road, Oxford, OX1 3RB, United Kingdom. 3School of Biosciences, University of Exeter, Exeter EX4 4QD, United Kingdom.

Manuscript in preparation

117

CHAPTER 4

Chitosan inhibits root growth altering hormone homeostasis and repressing quiescent centre WOX5 gene expression Federico Lopez-Moya1, Nuria Escudero1,2, Ernesto A. ZavalaGonzalez1, David Esteve-Bruna3, Alfonso Prieto1, Miguel A. Blázquez3, David Alabadí3 and Luis V. Lopez-Llorca1 1Laboratory

of

Plant

Pathology,

Multidisciplinary

Institute

for

Environment Studies (MIES) Ramón Margalef. University of Alicante, Alicante, Spain. 2Departament d'Enginyeria Agroalimentària i Biotecnologia, Universitat Politècnica de Catalunya, Barcelona, Spain. 3Instituto de Biología Molecular y Celular de Plantas, Consejo Superior de Investigaciones Científicas-Universidad Politécnica de Valencia, Valencia, Spain.

Manuscript in preparation

153

GENERAL DISCUSSION

Chitosan is a versatile natural polymer with biological activity. This makes it suitable for a wide variety of industrial applications. Nanotechnology allows new chitosan formulations (fibres or nanocapsules) with potential for drug delivery, in medical mycology or agrobiotechnology (Alburquenque et al., 2010; Bégin et al., 1999; El Hadrami et al., 2010; Kong et al., 2010; Ing et al., 2012). Previous studies have investigated the effect of chitosan on fungi at physiological and cellular levels evaluating the role of the plasma membrane composition in the chitosan sensitivity of fungi (Palma-Guerrero et al., 2009; Palma-Guerrero et al., 2010).

We have demonstrated in this Thesis that

induction of oxidative stress is directly related with plasma membrane permeabilisation in N. crassa. So reactive oxygen species (ROS) have a key role in the antifungal activity of chitosan. We have also provided evidences that Ca2+ increases tolerance to chitosan in N. crassa. Since there is a cross-talk

189

General Discussion

between calcium and ROS signalling (Yan et al., 2006) future studies on the mode of action of chitosan should take into account both factors. Several genomic studies have investigated the main gene targets of chitosan. Chemogenomics in S. cerevisiae identified plasma membrane GPI-anchored proteins and enzymes for ergosterol biosynthesis as main targets of chitosan (Jaime et al., 2012). Recent studies have demonstrated that cell wall synthesis and its composition also play a determinant role on the sensitivity of filamentous fungi to chitosan (Aranda-Martinez et al., 2016). This, together with several clinical studies (Kulikov et al., 2014; Rabea et al., 2003), suggests chitosan is an antifungal compound with applications on clinical mycology. In view of the potential of chitosan to control human fungal infections and its specific mode of action affecting plasma membrane and oxidative metabolism, we have investigated the inhibitory effect of exogenous chitosan on the rice blast fungus Magnaporthe oryzae. Chitosan is present in appressoria of Magnaporthe oryzae (Fujikawa et al., 2009). However, the effect of external application of chitosan on M. oryzae appressorium differentiation has not been fully investigated. Previous studies showed the antifungal activity of chitosan on plant pathogenic fungi infecting the phyloplane of important crops such as tomato, maize or soybean (El Hadrami et al., 2010). Chitosan also induces plant defences

against

fungal

pathogens

such

as

Fusarium

spp.

or

Botrytis spp. (Doares et al., 1995; Benhamou, 1996). Chitosan has been studied in combination of biocontrol fungi (PalmaGuerrero et al. 2008). This polymer enhances sporulation of nematophagous and entomopathogenic biocontrol fungi such as Pochonia spp. or Beauveria bassiana, respectively (Palma-Guerrero et al., 2008). Chitosan promotes parasitism of root-knot nematode eggs by P. chlamydosporia (Escudero et al., 2016). This opens the possibility for developing new integrated strategies for

190

General Discussion

sustainable management of plant-parasitic nematodes in economically important crops such as tomato or barley. In Chapter 1 of this PhD Thesis the mode of action of chitosan on N. crassa and human fungal pathogens was investigated. Nutrient (carbon; C and

nitrogen;

N)

limitation

enhances

chitosan

antifungal

activity.

Deprivation of nutrients modifies cell wall architecture which affects fungal growth (Nitsche et al., 2012; Szilágyi et al., 2013). To this respect, a recent study demonstrates that low branching (glucan content) of fungal cell wall confers sensitivity to chitosan (Aranda-Martinez et al., 2016). There is a direct link between cell wall and membrane since the synthesis of cell wall components (glucans and chitin) is performed by plasma membrane-associated synthase complexes (Levdansky et Therefore

chitosan

al.,

2010;

Maddi

et

al.,

2010).

membrane-driven permeabilisation (Palma-Guerrero et

al., 2009) is also linked with the cell wall and the nutrient content of the fungal environment. Chitosan-sensitive

fungi

(e.g.

N.

crassa)

have

high-fluidity

(polyunsaturated free fatty acid rich) membranes. Conversely, chitosanresistant fungi (Pochonia chlamydosporia) have low-fluidity membranes (enriched on saturated free fatty acids; Palma-Guerrero et al., 2010). Damage of plasma membrane depends on the free fatty acid (FFA) composition (PalmaGuerrero et al., 2010). Fungi with poly-unsaturated FFA (linolenic acid) in their plasma membrane (N. crassa) are more sensitive to chitosan than fungi (Pochonia chlamydosporia) with enriched plasma membrane with saturated FFA (palmitic or stearic acids; Palma-Guerreo et al., 2010). In this work, we found that chitosan permeabilises N. crassa plasma membrane and this it is linked with intracellular production of ROS and subsequent cell death. Other antifungals such as Phenylpropanoids also activate an oxidative response in their target microorganisms (Khan et al., 2011). Synthesis of oxidative byproducts of the cell metabolism (in peroxisomes and mitochondria) is directly related with the nergetic status of the cell. 191

General Discussion

This would explain why plasma membrane permeabilisation is an energy dependent process (Palma-Guerrero et al., 2009). A chemical or physiological block of the electron transport chain abolishes the antifungal activity of chitosan on N. crassa (Palma-Guerrero et al., 2009). Peroxisome and mainly mitochondria are the main organelles involved in ROS generation. Oxidative metabolism is directly related with the energetic status of the cell.

Using

flow

cytometry

we

have

detected

partial

membrane

permeabilisation and the onset of ROS production by chitosan. We can hypothesize that chitosan causes an intracellular ROS burst which starts oxidizing FFA of the cell membranes. Increased membrane oxidation which finally leads to full plasma membrane permeabilisation is perhaps responsible for the antifungal effect of chitosan. Induction of ROS and effectivity of antifungal also happens under deprivation of nutrients (glucose) in Candida glabrata (Ng et al., 2016). This again links nutrient content, ROS and antifungal action and may explain our results with chitosan. Future studies should study the generation of oxylipins, metabolites derived from lipid peroxidation, (Brodhun and Feussner, 2011) by chitosan to confirm this view and its relationship with the nutritional status.

We explore in this PhD Thesis the potential of chitosan as an antifungal with clinical applicability. Chitosan is fungicidal on Fusarium proliferatum and Hamigera avellanea. Chitosan also arrests germination and growth of Fusarium oxysporum f. sp. radicis lycopersici or Verticillium dahliae, (Palma-Guerrero et al., 2008) fungi phylogenetically close to the opportunistic human pathogens studied in this Thesis. However, chitosan is fungistatic to other fungal human pathogens such as Aspergillus fumigatus and Rhizophus stolonifer. As for N. crassa, limitation of nutrients (C and N) enhances antifungal activity of chitosan for all human pathogens tested. Chitosan inhibits growth of Candida spp. and

192

General Discussion

Cryptococcus spp. pathogenic yeasts. Furthermore, we have discovered that chitosan is inhibitory to Candida spp. (including C. albicans) resistant to currently used antifungals. Chitosan is fungicidal to C. albicans under the same C nutritional status as in human blood (glycemia). We also show in this chapter that chitosan significantly reduces C. albicans virulence in Galleria mellonella L. This organism is a well-established model host to test efficacy of antimicrobials on Candida albicans virulence (Fuchs et al., 2010; Li et al., 2013; Ramarao et al., 2012). Chitosan is harmless to mammalian (human and monkey) cells at concentrations fungicidal to human fungal pathogens. We therefore conclude that chitosan can be further developed for clinical use against Candida spp. and perhaps other human fungal pathogens. Oxidative stress and plasma membrane homeostasis genes are the main chitosan targets during early development of N. crassa (Chapter 2). This supports the link of ROS and plasma membrane permeabilisation found in Chapter 1. Oxidorreductase activity, plasma membrane and transport as main Gene Ontology (GO) categories enriched by chitosan. Chitosan also enriched oxidative metabolism, respiration and transport GOs in Saccharomyces cerevisiae (Jaime et al., 2012). Zakrzewska et al. (2005) also show in S. cerevisiae, plasma membrane, response to stress and cell wall integrity genes induced by chitosan. We that

Lipase

transferase

Class encoding

have

confirmed

III, Monosaccharide genes

by

testing

transporter

(NCU03639;

KO

mutants

and

Glutathione

NCU04537;

NCU10521,

respectively) are N. crassa main chitosan targets. They could respectively be involved in membrane repair, assimilation of catabolites and buffering excess ROS derived from chitosan damage. In this Chapter we have also found that Ca2+ increases tolerance to chitosan in N. crassa. The role of Ca2+ membrane remodelling during cell fusion in N. crassa (Fu et al., 2014; Muñoz et al., 2014) and Saccharomyces cerevisiae (Groppi et al., 2011) is well established. We also find FIG1 and SYT1 deletion strains involved in plasma membrane homeostasis mediated by Ca2+ (Cavinder and Trail, 2012; 193

General Discussion

Palma-Guerrero et al., 2014) more sensitive to chitosan than the wt. The link of ROS, membrane homeostasis, Ca2+ and chitosan is therefore an attractive subject for future studies (Yan et al., 2006). We investigate in Chapter 3 the effect of chitosan on Magnaporthe oryzae appressorium differentiation. Chitosan delays appressorium differentiation and alters its morphology reducing M. oryzae pathogenicity to rice. M. oryzae appressorium differentiation is a highly regulated process which involves the formation of a cytoskeleton (septin and actin) ring (Dagdas et al., 2012). Chitosan blocks by the mechanisms of cytoskeleton (septin and actin) organization. Septin and actin organization in a ring in the centre of appressorium together with melanisation and turgor accumulation are essential for M. oryzae pathogenicity (Dagdas et al., 2012; Dixon et al., 1999; Jacobson, 2000; Ryder et al., 2013; Martin-Urdiroz et al., 2015). Chitosan prevents septin and actin ring formation avoiding appressorium pore formation. This stops penetration peg formation and subsequent plant cell penetration. M. oryzae appressorium development is also mediated by modifications in the plasma membrane and by the induction of an oxidative burst (Egan et al., 2007; Ryder et al., 2013; Wilson and Talbot, 2009). Both physiological processes are also affected by chitosan. This polymer permeabilizes plasma membrane of M. oryzae appressorium and also induces oxidative metabolism. Unlike M. oryzae, appressorium differentiation of the nematophagous fungus Pochonia chlamydosporia is enhanced by chitosan (Escudero et al., 2016). These results revealed increased virulence of the fungus to eggs of plant parasitic nematodes by chitosan. This specific response could perhaps be due to the enrichment of chitin/chitosan hydrolases in P. chlamydosporia genome (Larriba et al., 2014). Conversely, M. oryzae genome is rich in plant cell wall degrading hydrolases (Dean et al., 2005). Chitosan also induces expression of

194

General Discussion

proteases (VCP1 and SCP1) involved in parasitism to nematode eggs (Escudero et al., 2016). The effect of chitosan on M. oryzae gene expression should be analysed in future studies. Chitosan applied at high doses in the rhizosphere of tomato or barley arrests root development (Chapter 4). Chitosan alters root cells morphology and their pattern of division. This abolishes polarity of root apex growth, stops elongation and modifies root architecture. Using the model plant Arabidopsis thaliana we have analysed the mechanisms of root growth inhibition by chitosan. Chitosan causes accumulation of auxin and stress related (jasmonic and salicylic acid) in roots. We have also identified in this work accumulation of

the

expression

of

DR5

an

auxin-responsive

promoter in lateral roots, indicating the relevance of auxins accumulations by chitosan. These changes could explain some of the growth arrest caused by chitosan. The latter could be reflected on the inhibition by chitosan of WOX5 gene (quiescent centre organization) involved in root stem cell maintenance. WOX5 maintains stem cells allowing root growth and elongation (Sarkar et al., 2007). Future RNAseq studies will address the impact of auxin accumulation and alteration of the stem cells differentiation on root apex by chitosan.

195

Concluding Remarks

CONCLUDING REMARKS Figure 4 summarizes the main findings of this PhD Thesis. Chitosan has potential as antifungal of human fungal pathogens. Reduces Candida albicans virulence with low toxicity to mammalian cells. Chitosan should however be applied under oxidative and low nutrient status since these factors favour its antifungal action. Plasma membrane homeostasis and oxidative metabolism genes are key targets of chitosan on N. crassa. The control of their expression would modify the antifungal activity of chitosan. Calcium enhances tolerance to chitosan so should be avoided when targeting fungal pathogens. Chitosan has proven a useful experimental tool to study M. oryzae appressorium differentiation. Chitosan perturbs cytoskeleton (septin and actin) ring formation inhibiting pore and penetration peg formation. This results in reduced pathogenicity to rice so chitosan could also be used for management of rice blast. Damage to M. oryzae appressoria occurs by plasma membrane permeabilisation and accumulation of reactive oxygen species. High doses of chitosan block tomato and barley development affecting root cell architecture and organization. In Arabidopsis quiescent centre organization and hormone homeostasis, mainly auxins, play a key role in sensitivity to chitosan. Therefore chitosan dosing in agricultural applications should be monitored to avoid plant toxicity.

196

Concluding Remarks

Figure 4. Conceptual diagram of chitosan as antifungal and gene modulator in fungi and plants (modified from Lopez-Moya and Lopez-Llorca, 2016).

197

Conclusions

CONCLUSIONS

1. Carbon and nitrogen limitation enhance chitosan antifungal activity to Neurospora crassa and human fungal pathogens

2. Chitosan induces an oxidative burst in N. crassa which causes plasma membrane permeabilisation and subsequent cell death

3. Chitosan displays antifungal activity against important human fungal pathogens, including Candida spp. strains resistant to currently used antifungals

4. Chitosan causes no damage to human

(including immune) cells at

concentrations lethal to human fungal pathogens

5. Chitosan significantly reduces virulence of Candida albicans to Galleria mellonella under the nutritional (C/N) conditions of human blood

6. Chitosan induces expression of N. crassa genes related with plasma membrane homeostasis, oxidorreductase activity and transport

198

Conclusions

7. A lipase Class III, a monosaccharide transporter and a glutathione transferase encoding genes are the main chitosan targets in N. crassa

8. Chitosan arrests appressorium differentiation in Magnaporthe oryzae blocking cytoskeleton ring formation

9. Chitosan reduces pathogenicity of Magnaporthe oryzae to rice avoiding penetration peg formation and rice cell invasion

10. Chitosan irrigation at high doses inhibits plant growth by altering morphology and growth habit of root cells

11. Chitosan repression of Arabidopsis thaliana WOX5 transcription factor, necessary for cell division in the quiescent center, affects root cell organization and elongation

12. Auxin, jasmonic and salicylic acid accumulation could explain changes of growth and architecture in A. thaliana roots treated with chitosan

199

General Discussion

GENERAL DISCUSSION REFERENCES Alburquenque C, Bucarey SA, Neira-Carrillo A, Urzúa B, Hermosilla G, Tapia CV. 2010. Antifungal activity of low molecular weight chitosan against clinical isolates of Candida spp. Med Mycol. 48(8): 1018-1023 Allan CR, Hadwiger LA. 1979. The fungicidal effect of chitosan on fungi of varying cell wall composition. Exp Mycol. 3 (3): 285-287. Aranda-Martinez A, Lopez-Moya L, Lopez-Llorca LV. 2016. Cell wall composition plays a key role on sensitivity of filamentous fungi to chitosan. J Basic Microbiol. doi:10.1002/jobm.201500775. Bégin A, Van Calsteren MR. 1999. Antimicrobial films produced from chitosan. Int J Biol Macromol. 26(1): 63-67. Brodhun F, Feussner I. 2011. Oxylipins in fungi. FEBS J. 278(7): 1047-1063. Cavinder B, Trail F. 2012. Role of Fig1, a Component of the Low-Affinity Calcium Uptake System, in Growth and Sexual Development of Filamentous Fungi. Eukaryot Cell. 11(8): 978–988. Dagdas YF, Yoshino K, Dagdas G, Ryder LS, Bielska E, Steinberg G, Talbot NJ. 2012. Septin-mediated plant cell invasion by the rice blast fungus, Magnaporthe oryzae. Science. 336(6088): 1590-1595. Dean RA, Talbot NJ, Ebbole DJ, Farman ML, Mitchell TK, Orbach MJ, Thon M, Kulkarni R, Xu JR, Pan H, Read ND, Lee YH, Carbone I, Brown D, Oh YY, et al. 2005. The genome sequence of the rice blast fungus Magnaporthe grisea. Nature. 434(7036): 980-986. Dixon KP, Xu JR, Smirnoff N, Talbot NJ. 1999. Independent signaling pathways regulate cellular turgor during hyperosmotic stress and appressorium-

200

General Discussion

mediated plant infection by Magnaporthe grisea. Plant Cell. 11(10): 20452058. Doares SH, Syrovets T, Weiler EW, Ryan CA. 1995. Oligogalacturonides and chitosan activate plant defensive genes through the octadecanoid pathway. Proc Natl Acad Sci U S A. 92(10): 4095–4098. Egan MJ, Wang ZY, Jones MA, Smirnoff N, Talbot NJ 2007. Generation of reactive oxygen species by fungal NADPH oxidases is required for rice blast disease. Proc. Natl. Acad. Sci. USA. 104 (28): 11772-11777. El Hadrami, A., Adam, L. R., Hadrami, El, I., and Daayf, F. 2010. Chitosan in Plant Protection. Marine Drugs 8(4): 968–987 Escudero N, Ferreira SR, Lopez-Moya F, Naranjo-Ortiz MA, Marin-Ortiz MI, Thorton CR, Lopez-Llorca LV. 2016. Chitosan enhances parasitism of Meloidogyne javanica eggs by the nematophagous fungus Pochonia chlamydosporia. Fun Biol. 120(4): 572-585. Fu C, Ao J, Dettmann A, Seiler S, Free SJ. 2014. Characterization of the Neurospora crassa cell fusion proteins, HAM-6, HAM-7, HAM-8, HAM-9, HAM-10, AMPH-1 and WHI-2. PLoS One. 9(10): e107773. Fuchs BB, O'Brien E, Khoury JBE, Mylonakis E. 2010. Methods for using Galleria mellonella as a model host to study fungal pathogenesis. Virulence. 1(6): 475-482. Fujikawa T, Kuga Y, Yano S, Yoshimi A, Tachiki T, Abe K, Nishimura M. 2009. Dynamics of cell wall components of Magnaporthe grisea during infectious structure development. Mol Microbiol. 73(4): 553-570. Groppi S, Belotti F, Brandão RL, Martegani E, Tisi R. 2011. Glucose-induced calcium influx in budding yeast involves a novel calcium transport system and can activate calcineurin. Cell Calcium. 49(6): 376-386.

201

General Discussion

Ing LY, Zin NM, Sarwar A, Katas H. 2012. Antifungal activity of chitosan nanoparticles and correlation with their physical properties. Int J Biomater. 2012: 632698. Jacobson ES. 2000. Pathogenic Roles for Fungal Melanins. Clin Microbiol Rev. 13(4): 708–717. Jaime MDLA, Lopez-Llorca LV, Conesa A, Lee AY, Proctor M, Heisler LE, Gebbia M, Giaever G, Westwood JT, Nislow C. 2012. Identification of yeast genes that confer resistance to chitosan oligosaccharide (COS) using chemogenomics. BMC Genomics. 13(1): 267. Khan A, Ahmad A, Akhtar F, Yousuf S, Xess I, Khan LA, Manzoor N. 2011. Induction of oxidative stress as a possible mechanism of the antifungal action of three phenylpropanoids. FEMS Yeast Res. 11(1): 114-122. Kong M, Chen XG, Xing K, Park HJ. 2010. Antimicrobial properties of chitosan and mode of action: a state of the art review. Int J Food Microbiol. 144(1): 51-63. Kulikov SN, Lisovskaya SA, Zelenikhin, PV, Bezrodnykh, EA, Shakirova DR, Blagodatskikh

IV,

Tikhonov

VE.

2014.

Antifungal

activity

of

oligochitosans (short chain chitosans) against some candida species and clinical

isolates

of

Candida

albicans:

Molecular

weight-activity

relationship. Eur J Med Chem. 74: 169-178. Larriba E, Jaime MDLA, Carbonell-Caballero J, Conesa A, Dopazo J, Nislow C, Martín-Nieto J, Lopez-Llorca LV. 2014. Sequencing and functional analysis of the genome of a nematode egg-parasitic fungus, Pochonia chlamydosporia. Fungal Genet Biol. 65: 69-80. Levdansky E, Kashi O, Sharon H, Shadkchan Y, Osherov N. 2010. The Aspergillus fumigatus cspA gene encoding a repeat-rich cell wall protein

202

General Discussion

is important for normal conidial cell wall architecture and interaction with host cells. Eukaryot Cell. 9: 1403-1415. Li DD, Deng L, Hu GH, Zhao LX, Hu DD, Jiang YY, Wang Y. 2013. Using Galleria mellonella-Candida albicans infection model to evaluate antifungal agents. Biol Pharm Bull. 36(9): 1482-1487. Lopez-Moya F, Lopez-Llorca LV. 2016. Omics for Investigating Chitosan as an Antifungal

and

Gene

Modulator.

J

Fungi. 2(1):

11.

doi:10.3390/jof2010011 Maddi A, Free SJ. 2010. α-1,6-mannosylation of N-linked oligosaccharide present on cell wall proteins is required for their incorporation into the cell wall in the filamentous fungus Neurospora crassa. Eukaryot Cell. 9: 1766-1775. Martin-Urdiroz M, Oses-Ruiz M, Ryder LS, Talbot NJ. 2015. Investigating the biology of plant infection by the rice blast fungus Magnaporthe oryzae. Fungal Genet Biol. 90: 61-68 Muñoz A, Chu M, Marris PI, Sagaram US, Kaur J, Shah DM, Read ND. 2014. Specific domains of plant defensins differentially disrupt colony initiation, cell fusion and calcium homeostasis in Neurospora crassa. Mol Microbiol. 92(6): 1357-1374 Ng TS, Desa MN, Sandai D, Chong PP, Than LT. 2016. Growth, biofilm formation, antifungal susceptibility and oxidative stress resistance of Candida glabrata are affected by different glucose concentrations. Infect Genet Evol. 40: 331-338. Nitsche BM, Jørgensen TR, Akeroyd M, Meyer V, Ram AFJ. 2012. The carbon starvation response of Aspergillus niger during submerged cultivation:

203

General Discussion

Insights from the transcriptome and secretome. BMC Genomics. 13(1): 380. Palma-Guerrero J, Jansson HB, Salinas J, Lopez-Llorca L.V. 2008. Effect of chitosan on hyphal growth and spore germination of plant pathogenic and biocontrol fungi. J. Appl. Microbiol. 104(2): 541-553. Palma-Guerrero J, Huang I, Jansson HB, Salinas J, Lopez-Llorca LV, Read ND. 2009. Chitosan permeabilizes the plasma membrane and kills cells of Neurospora crassa in an energy dependent manner. Fun Genet Biol. 46(8): 585-594. Palma-Guerrero J, Lopez-Jimenez J, Pérez-Berná AJ, Huang IC, Jansson HB, Salinas J, Villalaín J, Read ND, Lopez-Llorca LV. 2010. Membrane fluidity determines sensitivity of filamentous fungi to chitosan. Mol Microbiol. 75(4): 1021-1032. Palma-Guerrero J, Leeder AC, Welch J, Glass NL. 2014. Identification and characterization of LFD1, a novel protein involved in membrane merger during cell fusion in Neurospora crassa. Mol Microbiol. 92(1): 164-182. Rabea EI, Badawy ME-T, Stevens CV, Smagghe G, Steurbaut W. 2003. Chitosan as

antimicrobial

agent:

applications

and

mode

of

action.

Biomacromolecules. 4: 1457-1465. Ramarao N, Nielsen-Leroux C, Lereclus D. 2012. The insect Galleria mellonella as a powerful infection model to investigate bacterial pathogenesis. J Vis Exp. (70): e4392. Ryder LS, Dagdas YF, Mentlak TA, Kershaw MJ, Thornton CR, Schuster M, Chen J, Wang Z, Talbot NJ. 2013. NADPH oxidases regulate septinmediated cytoskeletal remodelling during plant infection by the rice blast fungus. Proc Natl Acad Sci USA. 110(8): 3179-3184.

204

General Discussion

Sarkar AK, Luijten M, Miyashima S, Lenhard M, Hashimoto T, Nakajima K, Scheres B, Heidstra R, Laux T. 2007. Conserved factors regulate signalling in Arabidopsis thaliana shoot and root stem cell organizers. Nature. 446(7137): 811-814. Szilágyi M, Miskei M, Karányi Z, Lenkey B, Pócsi I, Emri T. 2013. Transcriptome changes initiated by carbon starvation in Aspergillus nidulans. Microbiology (UK). 159(1): 176-190. Wilson RA, Talbot NJ. 2009. Under pressure: investigating the biology of plant infection by Magnaporthe oryzae. Nat Rev Microbiol. 7: 185-195. Yan Y, Wei C, Zhang W, Cheng H, Liu J. 2006. Cross-talk between calcium and reactive oxygen species signaling. Acta Pharmacol Sin. 27(7): 821-826. Zakrzewska

A, Boorsma

A, Brul

S, Hellingwerf

KJ, Klis

FM.

2005.

Transcriptional response of Saccharomyces cerevisiae to the plasma membrane-perturbing compound chitosan. Eukaryot Cell. 4(4): 703-715.

205

Curriculum Vitae

Federico Lopez-Moya was born on July 28th 1986 in Elche, Alicante, Spain. In 2004 he started his degree in Biology at the University of Alicante. During his formation he participates in an internship to perform immunological and cellular analysis in the General Hospital of Alicante under the supervision of Dr Mari Luz Sen Fernandez. In July 2010 he started as a young research in the Laboratory of Plant Pathology, Department of Marine Science and Applied Biology, University of Alicante, under the Supervision of Prof Luis Vicente Lopez-Llorca. In September 2010 he was in charge of the private research project “Development of new formulations to manage post-harvest fungal infections on stored grape”. In December 2010 he graduated and obtained his Bsc. in Biology. In September 2011 he started his Master in Master in Analysis and Management of Mediterranean Ecosystems. In 2012 he did a research stay for 2 months at the Department of Plant & Microbial Biology at the University of California, Berkeley (USA) to evaluate the transcriptomic response of Neurospora crassa to chitosan under the supervision of Prof N Louise Glass. In July 2012 he graduate and obtained his Msc. in Applied Biology and started his PhD. At the end of this phase he did another research stay for 3 months at Plant Pathology Research Group (Bioscience) at University of Exeter (UK) investigating about the mode of action of chitosan during

207

Curriculum vitae

Magnaporthe oryzae appressoria differentiation. The research during this time on the mode of action on fungi is described in this PhD Thesis.

List of Publications Federico Lopez-Moya, Maria F. Colom-Valiente, Pascual Martinez-Peinado, Jesus E. Martinez-Lopez, Eduardo Puelles, Jose M. Sempere-Ortells, Luis V. LopezLlorca. 2015. Carbon and nitrogen limitation increase chitosan antifungal activity in

Neurospora

crassa

and

fungal

human

pathogens.

Fungal

Biology

DOI:10.1016/j.funbio.2014.12.003. Cited 3 times. Corresponding author.

E.A. Zavala-Gonzalez, N. Escudero, F. Lopez-Moya, A. Aranda-Martinez, A. Exposito, J. Ricaño-Rodríguez, M.A. Naranjo-Ortiz, M. Ramírez-Lepe, L.V. Lopez-Llorca. 2015. Some isolates of the nematophagous fungus Pochonia chlamydosporia promote root growth and reduce flowering time of tomato. Annals of Applied Biology. 166(3). DOI:10.1111/aab.12199

Federico

Lopez-Moya , David

Kowbel , Mª

Jose

Nueda , Javier

Palma-

Guerrero, N. Louise Glass and Luis V. Lopez-Llorca. 2016. Neurospora crassa transcriptomics reveals oxidative stress and plasma membrane homeostasis biology genes as key targets in response to chitosan. Molecular BioSystems. 12(2):391-403. DOI: 10.1039 / C5MB00649. Corresponding author.

Federico Lopez-Moya and Luis V. Lopez-Llorca. Omics for investigating Chitosan as

Antifungal

and

Gene

Modulator. Journal

of

Fungi

(accepted).

Corresponding author.

N. Escudero, S. R. Ferreira, F. Lopez-Moya, M.A. Naranjo-Ortiz, A. I. Marin-Ortiz, C.R. Thornton, & L.V. Lopez-Llorca. 2016. Chitosan enhances parasitism

208

Curriculum vitae

of Meloidogyne

javanica eggs

by

the

nematophagous

fungus Pochonia

chlamydosporia. Fungal Biology. Doi 10.1016/j.funbio.2015.12.005.

Ernesto A. Zavala-González, F. Lopez-Moya, Almudena Aranda-Martinez, Mayra Cruz-Valerio, Luis Vicente Lopez-Llorca and Mario Ramírez-Lepe. Tolerance to chitosan by Trichoderma species is associated with low membrane fluidity. Journal of Basic Microbiology. DOI 10.1002/jobm.201500758.

Almudena Aranda-Martinez, F. Lopez-Moya, Luis Vicente Lopez-Llorca. Cell wall composition plays a key role on sensitivity of filamentous fungi to chitosan. Journal of Basic Microbiology. DOI 10.1002/jobm.201500775

Patents Name: “Use of chitosan to enhance appressorium differentiation, increases phytopathogenic nematodes parasitism and root colonization by Pochonia chlamydosporia”. Application number: P201431399

Congress Presentations 1. Title: Evaluation of antifungal activity of chitosan using Neurospora crassa and other fungal pathogens Name of the conference: Forum Micológico Type of event: Conference Your role: Speaker

Field of the conference: National City of the publishing body: Alicante, Spain

Date of the event: 26/11/2011 Federico Lopez-Moya; Mª Francisca Colom Valiente; Luis Vicente LopezLlorca. "Evaluation of antifungal activity of chitosan using Neurospora crassa and other fungal pathogens".

209

Curriculum vitae

2. Title: Endophytic colonization of tomato plants (Solanum lycopersicum) and root-knot nematode infection by Pochonia chlamydosporia isolates from worldwide origin. Name of the conference: British Mycological Society (BMS) Annual Scientific Meeting Type of event: Conference Your role: Poster

Field of the conference: Non EU International

City of the publishing body: Alicante,

Date of the event: 03/09/2012 Zavala; E; Peinado; P; Escudero; N; Lopez-Moya; F; Ramirez; M; Lopez-Llorca; L. V. "Endophytic colonization of tomato plants (Solanum lycopersicum) and root-knot nematode infection by Pochonia chlamydosporia isolates from worldwide origin". 3. Title: High-Throughput Evaluation of the effect of Chitosan, Amphotericin-B and Benomyl on Neurospora crassa Name of the conference: Neurospora Fungal Genetics (Asilomar) Type of event: Conference Your role: Poster

Field of the conference: Non EU International

City of the publishing body: Asilomar Conference Center,

Pacific Grove, California, United States of America Date of the event: 08/03/2012 Federico Lopez-Moya; Mª Francisca Colom Valiente; Luis V. Lopez-Llorca. "High-Throughput Evaluation of the effect of Chitosan, Amphotericin-B and Benomyl on Neurospora crassa". 4. Title: Transcriptomic analysis of Neurospora crassa germination in response to chitosan using RNAseq Name of the conference: British Mycological Society (BMS) Annual Scientific Meeting Type of event: Conference Your role: Poster

City of the publishing body: Alicante,

Date of the event: 03/09/2012

210

Field of the conference: Non EU International

Curriculum vitae

Lopez-Moya; F; Kowbel; D; Glass; N.L; Lopez-Llorca; L. V. "Transcriptomic analysis of Neurospora crassa germination in response to chitosan using RNAseq". 5. Title: Transcriptomic response of Neurospora crassa germinating conidia to chitosan in sub-lethal dose. Name of the conference: Fungal Genetics (Asilomar) Type of event: Conference Your role: Poster

Field of the conference: Non EU International

City of the publishing body: Asilomar, California, United

States of America Date of the event: 12/03/2013 Lopez-Moya; F; Kowbel; D; Glass; N. L; Lopez-Llorca; L.V. "Transcriptomic response of Neurospora crassa germinating conidia to chitosan in sub-lethal dose." In: 27th Fungal Genetics Conference Program.

211