Phylogenetic Systematics of Dart-Poison Frogs and Their Relatives ... [PDF]

SEARCH

Quick Search



Advanced Search



ABOUT RESOURCES CONTACT US

My Account : Log in | Admin | Help

Browse | Subscribe | Publish List of Issues Current Issue Category: BioOne.2 Aims & Scope

Home / All Titles / South American Journal of Herpetology / Sep 2017 / pg(s) S1-S90

South American Journal of Herpetology Published by: Brazilian Society of Herpetology

« previous article : next article »

Print ISSN: 1808-9798

translator disclaimer

Article Views » Abstract & References

Online ISSN: 1937-2418 Current: Dec 2017 : Volume 12 Issue 3 BioOne Member Since: 2007 Frequency: Tri-annual Impact Factor: 1.143

South American Journal of Herpetology 12(s1):S1-S90. 2017

Full Text

https://doi.org/10.2994/SAJH-D-17-00017.1

PDF (34472 KB)

Phylogenetic Systematics of Dart-Poison Frogs and Their Relatives Revisited (Anura: Dendrobatoidea)

Journal Citation Reports® Rankings:

Taran Grant , Marco Rada, Marvin Anganoy-Criollo, Abel Batista, Pedro Henrique Dias , Adriana Moriguchi Jeckel,

74/162 - Zoology

Denis Jacob Machado, José Vicente Rueda-Almonacid © 2017 Brazilian Society of Herpetology

Title Tools

Social Tools

Print Friendly

Article Impact

Received: March 14, 2017; Accepted: July 28, 2017; Published: September 2017

Most Read Articles Phylogenetic Systematics of Dart-Poison Frogs and Their Relatives Revisited (Anura: Dendrobatoidea)

[+] Author & Article Info via Altmetric.com

Sexual Differences in Growth Rates of Juveniles from a Litter of Bothrops fonsecai: The Role of Feeding Conversion in a FemaleBiased SSD Species

Abstract. Despite the impressive growth of knowledge on the phylogenetic systematics of dartpoison frogs and their relatives (Dendrobatoidea) over the past decade, many problems remain to be addressed. We analyzed up to 189 phenomic characters (morphology, behavior, defensive chemicals) and 15 mitochondrial and nuclear loci scored for 564 dendrobatoid and outgroup terminals, including 76 newly sequenced terminals and > 20 previously unanalyzed species, using tree-alignment and the parsimony optimality criterion in the program POY v.5.1.1 and additional analyses of the implied alignment using TNT v.1.5. Even though data coverage was highly heterogeneous, the strict consensus of 639 optimal trees is highly resolved and we detected only one instance of wildcard behavior involving a small clade of outgroup species. The monophyly of the median lingual process (MLP) possessing genus Anomaloglossus is decisively refuted, with the cis-Andean species being sister to Rheobates within Aromobatidae and the trans-Andean species nested within Hyloxalinae, implying two independent origins of the structure in Dendrobatoidea. Although this result was unexpected, it is not surprising given that the MLP evolved at least five times in Asian and African ranoids, including Arthroleptidae, Dicroglossidae, Mantellidae, and Rhacophoridae and either once in the most recent common ancestor of the massive clade Victoranura followed by independent losses or multiple times within component lineages. We restrict Anomaloglossus to the cis-Andean MLP-possessing species, describe a new genus for the trans-Andean MLP-possessing species, and resurrect Paruwrobates for its sister group, which includes Dendrobates andinus (formerly Ameerega), D. erythromos (formerly Hyloxalus and, until recently, Ameerega), and Prostherapis whymperi (formerly Hyloxalus). We also transfer Dendrobates maculatus from Ameerega to Epipedobates, making Ameerega an exclusively cis-Andean group. We describe two new species of the trans-Andean MLP-possessing genus—one from Cerro Tacarcuna, near the Colombo-Panamanian border, and the other from 800–900 m elevation on the western versant of the Colombian Cordillera Occidental (Cauca Department)—bringing the total number of species in the genus to seven. The discrete, round, white to yellowish-brown dots found on the venter of the new species from Cerro Tacarcuna and at least one other trans-Andean MLP-possessing species are formed by large, ellipsoid, densely distributed (up to 80 glands/mm2 ) granular glands. Although specimens of the new species from Cerro Tacarcuna exuded a noxious milky substance when handled, lipophilic alkaloids were not detected. In addition to the unexpected placement of the trans-Andean MLP-possessing species, major findings include the unexpected placement of Colostethus ruthveni and its undescribed sister species (the “C.” ruthveni group) within Dendrobatinae as sister of the newly recognized tribe Dendrobatini (all dendrobatines except Phyllobates and the “C.” ruthveni group). We describe a new genus for C. argyrogaster and C. fugax to remedy the paraphyly of Colostethus caused by the placement of those species as sister to Ameerega. Our evidence rejects the sister group relationship of Dendrobates + Oophaga in favor of Dendrobates + Adelphobates, which is consistent with their uniquely low diploid chromosome number of 2n = 18 (2n = 20 in Oophaga). With the exception of Anomaloglossus and Colostethus, all other genera are monophyletic. We recognize several monophyletic species groups— including the Atlantic Forest, trans-Andean, and 22-chromosome groups within Allobates, the An. stepheni, An. megacephalus, and An. beebei groups in Anomaloglossus, the C. latinasus (formed by the C. inguinalis and C. latinasus clades) and C. fraterdanieli groups within Colostethus, and the Am. braccata and Am. rubriventris groups within Ameerega—identify unambiguously optimized phenomic synapomorphies, and summarize patterns in the evolution of the diploid chromosome number, swelling of Finger IV in males, relative length of Fingers II and III, length of Finger V, and testicular and intestinal pigmentation. Finally, we address criticisms of the current taxonomy of Neotropical poison frogs and their relatives, concluding that they are either overstated, misguided, or false, and that the current system of names better communicates knowledge of the diversity of these frogs. Our results highlight the importance of increased taxon sampling, and we conclude by identifying key species to include in future phylogenetic analyses.

Survival of Amazonian Tadpoles Under Harsh Water-Limiting Conditions Geographic Variation in Kentropyx striata (Reptilia: Teiidae): Can We Distinguish Between Isolated Populations? Distribution and General Habitat Use Analysis of the Jamaican Boa (Chilabothrus subflavus) More Most Cited Articles Systematics of the Neotropical Genus Leptodactylus Fitzinger, 1826 (Anura: Leptodactylidae): Phylogeny, the Relevance of Non-molecular Evidence, and Species Accounts Anuran Species Composition and Distribution Patterns in Brazilian Cerrado, a Neotropical Hotspot Diet of the Invasive Frog Lithobates catesbeianus (Shaw, 1802) (Anura: Ranidae) in Viçosa, Minas Gerais State, Brazil Widespread Occurrence of the American Bullfrog, Lithobates catesbeianus (Shaw, 1802) (Anura: Ranidae), in Brazil Big, Bad, and Beautiful: Phylogenetic Relationships of the Horned Frogs (Anura: Ceratophryidae) More Sign up for e-alerts RSS Feeds

Looking for a job? Visit the BioOne Career Center and apply to open positions across the sciences. careercenter.BioOne.org

Article Tools Email Disable search highlighting Add to Favorites Sign Up for E-alerts Download to Citation Manager Alert me when this article is cited: Email | RSS Rights & Permissions

Citing Articles

Keywords: Andes, Aromobatidae, Chocó, Dendrobatidae, Median lingual process, New genus, New species, Phylogeny, Total evidence

REFERENCES Abraham R.K., Pyron R.A., Ansil B.R., Zachariah A., Zachariah A. 2013. Two novel genera and one new species of treefrog (Anura: Rhacophoridae) highlight cryptic diversity in the Western Ghats of India. Zootaxa 3640: 177–189. DOI Crossref, PubMed, Google Scholar Abraham R.K., Zachariah A., Cyriac V.P. 2015. A reappraisal of the rhacophorid bush frog Raorchestes flaviventris (Boulenger, 1882), with an evaluation of the taxonomic status of R. emeraldi Vijayakumar, Dinesh, Prabhu and Shankar, 2014. Zootaxa 4048: 90–100. DOI Crossref, PubMed, Google Scholar Acosta A.R., Cuentas D.A., Coloma L.A. 2000. Una nueva especie de Colostethus (Anura: Dendrobatide) de la región del Caribe de Colombia. Revista de la Academia Colombiana de Ciencias Exactas, Físicas y Naturales 23: 225–230. Google Scholar Agudelo-Cantero G. a., Castaño-Valencia R.S., Castro-Herrera F., Fierro-Pérez L., Asencio-Santofimio H. 2015. Diet of the bluebellied poison frog Andinobates minutus (Anura: Dendrobatidae) in two populations from the Colombian Pacific. Journal of Herpetology 49: 452–461. DOI BioOne, Google Scholar Aguiar Jr O., Lima A.P., Giaretta A.A., Recco-Pimentel S.M. 2002. Cytogenetic analysis of four poison frogs of the Epipedobates genus (Anura: Dendrobatidae). Herpetologica 58: 293–303. BioOne, Google Scholar Aichinger M. 1991. A new species of poison-dart frog (Anura: Dendrobatidae) from the Serranía de Sira, Peru. Herpetologica 47: 1–5. Google Scholar Almendáriz C A., Ron S.R., Brito M J. 2012. Una especie nueva de rana venenosa de altura del género Excidobates (Dendrobatoidea: Dendrobatidae) de la Cordillera del Cóndor. Papéis Avulsos de Zoologia 52: 387–399. DOI Crossref, Google Scholar Amaro R.C., Pavan D., Rodrigues M.T. 2009. On the generic identity of Odontophrynus moratoi Jim & Caramaschi, 1980 (Anura, Cycloramphidae). Zootaxa 68: 61–68. Google Scholar Amézquita A., Flechas S.V., Lima A.P., Gasser H., Hödl W. 2011. Acoustic interference and recognition space within a complex assemblage of dendrobatid frogs. Proceedings of the National Academy of Sciences USA 108: 17058–17063. DOI Crossref, PubMed, Google Scholar Amézquita A., Márquez R., Medina R., Mejía-Vargas D., Kahn T.R., Suárez G., Mazariegos L. 2013a. A new species of Andean poison frog, Andinobates (Anura: Dendrobatidae), from the northwestern Andes of Colombia. Zootaxa 3620: 163–178. DOI Crossref, PubMed, Google Scholar Amézquita A., Castro L., Arias M., González M., Esquivel C. 2013b. Field but not lab paradigms support generalisation by predators of aposematic polymorphic prey: the Oophaga histrionica complex. Evolutionary Ecology 27: 769–782. DOI Crossref, Google Scholar Amézquita A., Ramos Ó., González M.C., Rodríguez C., Medina I., Simões P.I., Lima A.P. 2017. Conspicuousness, color resemblance, and toxicity in geographically diverging mimicry: The pan-Amazonian frog Allobates femoralis. Evolution 71: 1039–1050. DOI Crossref, PubMed, Google Scholar Anderson J. 1871. A list of the reptilian accession to the Indian Museum, Calcutta from 1865 to 1870, with a description of some new species. Journal of the Asiatic Society of Bengal 40: 12–39. Google Scholar Anganoy-Criollo M. 2012. A new species of Allobates (Anura, dendrobatidae) from the western flank of the Serranía de Perija, Colombia. Zootaxa 62: 49–62. Google Scholar Anganoy-Criollo M. 2013. Tadpoles of the high-Andean Hyloxalus subpunctatus (Anura: Dendrobatidae) with description of larval variation and species distinction by larval morphology. Papéis Avulsos de Zoologia 53: 211–224. Google Scholar Ardila-Robayo M.C., Acosta-Galvis A.R., Coloma L.A. 2000. Una nueva especie de Colostethus Cope 1867 (Amphibia: Anura: Dendrobatidae) de la Cordillera Oriental colombiana. Revista de la Academia Colombiana de Ciencias Exactas, Físicas y Naturales 23: 239–244. Google Scholar Arifin U., Iskandar D., Bickford D., Meier R., Kutty S.N., Brown R.M. 2011. Phylogenetic relationships within the genus Staurois (Anura, Ranidae) based on 16S rRNA sequences. Zootaxa 2744: 39–52. Google Scholar Baird S.F., Girard C. 1852. Descriptions of new species of reptiles, collected by the U.S. Exploring Expedition under the command of Capt. Charles Wilkes, U.S.N., First Part—including the species from the western part of America. Proceedings of the Academy of Natural Sciences of Philadelphia 6: 174–177. Google Scholar Barbour T. 1909. The Vertebrata of Gorgona Island, Colombia: Reptilia; Amphibia. Bulletin of the Museum of Comparative Zoology 46: 98–102. Google Scholar Barbour T., Noble G.K. 1920. Some amphibians from northwestern Perú, with a revision of the genera Phyllobates and Telmatobius. Bulletin of the Museum of Comparative Zoology 63: 395–427. Google Scholar Barrio A. 1970. Insuetophrynus acarpicus, un nuevo leptodactylido firmisternio sudamericano (Amphibia, Anura). Physis 30: 331–341. Google Scholar Barrio A. 1980. Una nueva especie de Ceratophrys (Anura: Ceratophryidae) del Dominio Chaqueno. Physis 39: 21–30. Google Scholar Barrio-Amorós C.L., Santos J.C. 2009. Description of a new Allobates (Anura, Dendrobatidae) from the eastern piedmont, Venezuela. Phyllomedusa 8: 89–104. Crossref, Google Scholar Barrio-Amorós C.L., Santos J.C. 2011. Redescription and generic assignation of Dendrobates rufulus Gorzula, 1990 (Anura: Dendrobatidae) from the Chimanta Massif, Venezuela. Salamandra 47: 155–160. Google Scholar Barrio-Amorós C.L., Santos J.C. 2012. A phylogeny for Aromobates (Anura: Dendrobatidae) with description of three new species from the Andes of Venezuela, taxonomic comments on Aromobates saltuensis, and notes on the conservation of the genus. Zootaxa 31: 1–31. Google Scholar Barrio-Amorós C.L., Fuentes Ramos O., Rivas Fuenmayor G. 2004. Two new species of Colostethus (Anura: Dendrobatidae) from the Venezuelan Guayana. Salamandra 40: 183–200. Google Scholar Barrio-Amorós C.L., Santos J.C., Jovanovic O. 2010a. A new dendrobatid frog (Anura: Dendrobatidae: Anomaloglossus) from the Orinoquian rainforest, southern Venezuela. Zootaxa 2413: 37–50. Google Scholar Barrio-Amorós C.L., Rivas G.A., Molina C.R., Santos J.C., Kaiser H. 2010b. Intraspecific variation in the endangered frog Mannophryne riveroi (Anura, Dendrobatidae, Aromobatinae), with comments on coloration and natural history. Herpetological Notes 3: 151–160. Google Scholar Barrio-Amorós C.L., Romero E., Infante E. 2010c. The critically endangered Venezuelan dendrobatid frog Aromobates meridensis (Amphibia: Anura): Redescription, natural history and conservation. Revista de Ecología Latinoamericana 15: 1–12. Google Scholar Barrio-Amorós C.L., Santos J.C., Molina C.R. 2010d. An addition to the diversity of dendrobatid frogs in Venezuela: description of three new collared frogs (Anura: Dendrobatidae: Mannophryne). Phyllomedusa 9: 3–35. Google Scholar Barrio-Amorós C.L., Rivero R., Santos J.C. 2011. A new striking dendrobatid frog (Dendrobatidae: Aromobatinae, Aromobates) from the Venezuelan Andes. Zootaxa 52: 39–52. Google Scholar Bastos R.P., Pombal Jr J.P. 1995. New species of Crossodactylus (Anura: Leptodactylidae) from the Atlantic rain forest of southeastern Brazil. Copeia 1995: 436–439. DOI Crossref, Google Scholar Bastos R.P., Signorelli L., Morais A.R., Costa T.B., Lima L.P., Pombal Jr J.P. 2011. Advertisement calls of three anuran species (Amphibia) from the Cerrado, central Brazil. South American Journal of Herpetology 6: 67–72. DOI BioOne, Google Scholar Batista A., Jaramillo A C.A., Ponce M., Crawford A.J. 2014. A new species of Andinobates (Amphibia: Anura: Dendrobatidae) from west central Panama. Zootaxa 3866: 333–352. DOI Crossref, PubMed, Google Scholar Batsch A.J.G.K. 1796. Umriß der gesammten Naturgeschichte: Ein Auszug aus den frühern Handbüchern des Verfassers fur seine Vorlesungen. Christian Ernst Gabler, Jena. Google Scholar Bauer L. 1985a. Remarks on relationship and names of dart poison frogs with description of a new genus Ranitomeya. RIPA April 1985: 1–3. Google Scholar Bauer L. 1985b. Ripalus-an introductory word. RIPA April 1985: [unnumbered pages]. Google Scholar Bauer L. 1986. A new genus and a new specific name in the dart poison frog family (Dendrobatidae, Anura, Amphibia). RIPA November: 1–12. Google Scholar Bauer L. 1988. Pijlgifkikkers en verwanten: de familie Dendrobatidae. Het Paludarium 1 November: 1–6. Google Scholar Bauer L. 1994. New names in the family Dendrobatidae (Anura, Amphibia). RIPA Fall 1994: 1–6. Google Scholar Baumann F. 1912. Brasilianische Batrachier des Berner Naturhistorischen Museums nebst Untersuchungen über die geographische Verbreitung der Batrachier in Brasilien. Zoologische Jahrbücher. Abteilung für Systematik, Geographie und Biologie der Tiere 33: 87–172. Google Scholar Bell T. 1843. Reptiles. Pp. 1–51, The Zoology of the Voyage of the H.M.S. Beagle, Under the Command of Captain Fitzroy, R.N., During the Years 1832 to 1836. Volume 5. Smith, Elder and Co., London. Google Scholar Bernal M.H., Luna-Mora V.F., Gallego O., Quevedo A. 2007. A new species of poison frog (Amphibia: Dendrobatidae) from the Andean mountains of Tolima, Colombia. Zootaxa 1638: 59–68. Google Scholar Berthold A.A. 1845. Ueber verschiedene neue oder seltene Reptilien aus Neu-Granada und Crustaceen aus China. Nachrichten von der Georg-Augusts-Universitat und der Konigl. Gesellschaft der Wissenschaften zu Göttingen 1845: 37–48. Google Scholar Besnard G., Bertrand J.A., Delahaie B., Bourgeois Y.X., Lhuillier E., Thébaud C. 2016. Valuing museum specimens: highthroughput DNA sequencing on historical collections of New Guinea crowned pigeons (Goura). Biological Journal of the Linnean Society 117: 71–82. DOI Crossref, Google Scholar Biju S.D., Shouche Y., Dubois A., Dutta S.K., Bossuyt F. 2010. A ground-dwelling rhacophorid frog from the highest mountain peak of the Western Ghats of India. Current Science 98: 1119–1125. Google Scholar Biju S.D., Garg S., Gururaja K. V, Shouche Y., Walujkar S.A. 2014. DNA barcoding reveals unprecedented diversity in dancing frogs of India (Micrixalidae, Micrixalus): a taxonomic revision with description of 14 new species. Ceylon Journal of Science 43: 1–87. Google Scholar Blommers-Schlösser R.M.A. 1993. Systematic relationships of the Mantellinae Laurent 1946 (Anura Ranoidea). Ethology Ecology & Evolution 5: 199–218. Crossref, Google Scholar Blotto B.L., Nunez J.J., Basso N.G., Úbeda C.A., Wheeler W.C., Faivovich J. 2013. Phylogenetic relationships of a Patagonian frog radiation, the Alsodes + Eupsophus clade (Anura: Alsodidae), with comments on the supposed paraphyly of Eupsophus. Cladistics 18: 113–131. DOI Crossref, Google Scholar Boettger O. 1892. Katalog Der Batrachier-Sammlung im Museum der Senckenbergischen Naturforschenden Gesellschaft in Frankfurt. Gebruder Knauer, Frankfurt am Main. Google Scholar Boettger O. 1893. Ein neuer Laubfrosch aus Costa Rica. Bericht der Senckenbergischen Naturforschenden Gesellschaft in Frankfurt am Main 1893: 251–252. Google Scholar Bogart J.P. 1991. The influence of life history on karyotypic evolution in frogs. Pp. 233–258, in Green D.M., Sessions S.K. (Eds.), Amphibian Cytogenetics and Evolution. Academic Press, San Diego. Google Scholar Bogdanowicz D., Giaro K. 2012. Matching split distance for unrooted binary phylogenetic trees. IEEE/ACM Transactions on Computational Biology and Bioinformatics 9: 150–160. DOI Crossref, PubMed, Google Scholar Boistel R., de Massary J.-C. 1999. Les amphibiens veneneux de la famille des dendrobatides. Le Courrier de la Nature 176: 34–39. Google Scholar Bokermann W.C.A. 1967a. Novas especies de “Phyllobates” do leste e sudeste brasileiro (Anura, Dendrobatidae). Revista Brasileira de Biologia 27: 349–353. Google Scholar Bokermann W.C.A. 1967b. Una nueva especie de Elosia de Itatiaia, Brasil (Amphibia, Leptodactylidae). Neotropica 13: 135–137. Google Scholar Bonaparte C.L. 1850. Conspectus Systematum. Herpetologiae et Amphibiologiae. Editio Altera Reformata. Lugdini Batavorum, E J Brill. Google Scholar Borah M.M., Bordoloi S., Purkayastha J., Das M., Dubois A., Ohler A. 2013. Limnonectes (Taylorana) medogensis (Fei, Ye & Huang, 1997) from Arunachal Pradesh (India), and on the identity of some diminutive ranoid frogs. Herpetozoa 26: 39–48. Google Scholar Born M., Bongers F., Poelman E.H., Sterck F.J. 2010. Dry-season retreat and dietary shift of the dart-poison frog Dendrobates tinctorius (Anura: Dendrobatidae). Phyllomedusa 9: 37–52. DOI Crossref, Google Scholar Bossuyt F., Dubois A. 2001. A review of the frog genus Philautus Gistel, 1848 (Amphibia, Anura, Ranidae, Rhacophorinae). Zeylanica 6: 1–112. Google Scholar Bouchon D., Souty-Grosset C., Raimond R. 1994. Mitochondrial DNA variation and markers of species identity in two penaeid shrimp species: Penaeus monodon Fabricius and P. japonicus Bate. Aquaculture 127: 131–144. DOI Crossref, Google Scholar Boulenger G.A. 1882a. Account of the reptiles and batrachians collected by Mr. Edward Whymper in Ecuador in 1879–80. Annals and Magazine of Natural History Series 5 9: 457–467. DOI Crossref, Google Scholar Boulenger G.A. 1882b. Catalogue of the Batrachia Salientia s. Ecaudata in the Collection of the British Museum. Second Edition. Taylor and Francis, London. DOI Google Scholar Boulenger G.A. 1883. Notes on little-known species of frogs. Annals and Magazine of Natural History Series 5 11: 16–19. Crossref, Google Scholar Boulenger G.A. 1884. On a collection of frogs from Yurimaguas, Huallaga River, northern Peru. Proceedings of the Zoológical Society of London 1883: 635–638. DOI Google Scholar Boulenger G.A. 1887. Descriptions of new reptiles and batrachians in the British Museum (Natural History).— Part III. Annals and Magazine of Natural History Series 5 20: 50–53. DOI Google Scholar Boulenger G.A. 1888. Note on the classification of the Ranidae. Proceedings of the Zoológical Society of London 1888: 204–206. Google Scholar Boulenger G.A. 1896. Descriptions of two new batrachians obtained by Mr. A. Everett on Mount Kina Balu, North Borneo. Annals and Magazine of Natural History Series 6 17: 449–450. DOI Google Scholar Boulenger G.A. 1898. An account of the reptiles and batrachians collected by Mr. W.F.H. Rosenberg in western Ecuador. Proceedings of the Zoológical Society of London 1898: 107–126. DOI Google Scholar Boulenger G.A. 1899. Descriptions of new batrachians in the collection of the British Museum (Natural History). Annals and Magazine of Natural History Series 7 3: 273–277. DOI Google Scholar Boulenger G.A. 1903. On some batrachians and reptiles from Venezuela. Journal of Natural History, Series 7 11: 481–484. DOI Google Scholar Boulenger G.A. 1912a. Descriptions of new batrachians from the Andes of South America, preserved in the British Museum. Annals and Magazine of Natural History Series 8 10: 185–191. DOI Crossref, Google Scholar Boulenger G.A. 1912b. Descriptions of new African batrachians preserved in the British Museum. Annals and Magazine of Natural History Series 8 10: 140–142. DOI Google Scholar Boulenger G.A. 1913. On a collection of batrachians and reptiles made by Dr. H.G.F. Spurrell, F.Z.S., in the Chocó, Colombia. Proceedings of the Zoológical Society of London 1913: 1019–1038. DOI Google Scholar Boulenger G.A. 1914. On a second collection of batrachians and reptiles made by Dr. H.G.F. Spurrell, F.Z.S., in the Chocó, Colombia. Proceedings of the Zoológical Society of London 84: 813–817. DOI Crossref, Google Scholar Boulenger G.A. 1918. Descriptions of South-American batrachians. Annals and Magazine of Natural History Series 9 2: 427–433. Google Scholar Bourne G.R., Collins A.C., Holder A.M., McCarthy C.L. 2001. Vocal communication and reproductive behavior of the frog Colostethus beebei in Guyana. Journal of Herpetology 35: 272–281. Crossref, Google Scholar Brandvain Y., Pauly G.B., May M.R., Turelli M. 2014. Explaining Darwin's corollary to Haldane's rule: the role of mitonuclear interactions in asymmetric postzygotic isolation among toads. Genetics 197: 743–747. DOI Crossref, PubMed, Google Scholar Bremer K. 1988. The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42: 795–803. Crossref, PubMed, Google Scholar Brown J.L., Schulte R., Summers K. 2006. A new species of Dendrobates (Anura: Dendrobatidae) from the Amazonian lowlands in Peru. Zootaxa 58: 45–58. Google Scholar Brown J.L., Twomey E. 2009. Complicated histories: three new species of poison frogs of the genus Ameerega (Anura: Dendrobatidae) from north-central Peru. Zootaxa 2049: 1–38. Google Scholar Brown J.L., Twomey E., Pepper M., Sánchez Rodríguez M. 2008a. Revision of the Ranitomeya fantastica species complex with description of two new species from central Peru (Anura: Dendrobatidae). Zootaxa 1823: 1–24. Google Scholar Brown J.L., Twomey E., Morales V., Summers K. 2008b. Phytotelm size in relation to parental care and mating strategies in two species of Peruvian poison frogs. Behaviour 145: 1139–1165. DOI Crossref, Google Scholar Brown J.L., Morales V., Summers K. 2008c. Divergence in parental care, habitat selection and larval life history between two species of Peruvian poison frogs: an experimental analysis. Journal of Evolutionary Biology 21: 1534–1543. DOI Crossref, PubMed, Google Scholar Brown J.L., Morales V.R., Summers K. 2010. A key ecological trait drove the evolution of biparental care and monogamy in an amphibian. American Naturalist 175: 436–446. DOI Crossref, PubMed, Google Scholar Brown J.L., Twomey E., Amézquita A., Souza M.B. de, Caldwell J.P., Lötters S., … Summers K. 2011a. A taxonomic revision of the Neotropical poison frog genus Ranitomeya (Amphibia: Dendrobatidae). Zootaxa 3083: 1–120. Google Scholar Brown J.L., Caldwell J.P., Twomey E., Melo-Sampaio P.R., Souza M.B. 2011b. Ranitomeya toraro Brown, Caldwell, Twomey, Melo-Sampaio & Souza sp. nov. in Brown J.L., Twomey E., Amézquita A., Souza M.B. de, Caldwell J.P., Lötters S., … Summers K. Zootaxa 3083: 1–120. Google Scholar Brown R.M., Foufopoulos J., Richards S.J. 2006. New species of Platymantis (Amphibia; Anura; Ranidae) from New Britain and redescription of the poorly known Platymantis nexipus. Copeia 2006: 674–695. DOI BioOne, Google Scholar Brown R.M., Siler C.D., Richards S.J., Diesmos A.C., Cannatella D.C. 2015. Multilocus phylogeny and a new classification for Southeast Asian and Melanesian forest frogs (family Ceratobatrachidae). Zoológical Journal of the Linnean Society 174: 130–168. DOI Crossref, Google Scholar Bruker Micro CT. 2012. NRecon, Version 1.6.6.0. Available from: http://brukermicroct.com/products/downloads.htm. Google Scholar Bruker Micro CT. 2015. CTvox, Version 2.3.0. Available from: http://brukermicroct.com/products/downloads.htm. Google Scholar Budgett J.S. 1899. Notes on the batrachians of Paraguayan Chaco, with observations upon their breeding habits and development, especially with regard to Phyllomedusa hypochondrialis Cope. Also a description of a new genus. Quarterly Journal of Microscopical Science 42: 305–333. Crossref, Google Scholar Burrell A.S., Disotell T.R., Bergey C.M. 2015. The use of museum specimens with high-throughput DNA sequencers. Journal of Human Evolution 79: 35–44. DOI Crossref, PubMed, Google Scholar Caldwell J.P. 2005. A new Amazonian species of Cryptophyllobates (Anura: Dendrobatidae). Herpetologica 61: 449–461. DOI BioOne, Google Scholar Caldwell J.P., Lima A.P. 2003. A new Amazonian species of Colostethus (Anura: Dendrobatidae) with a nidicolous tadpole. Herpetologica 59: 219–234. DOI BioOne, Google Scholar Caldwell J.P., Myers C.W. 1990. A new poison frog from Amazonian Brazil, with further revision of the quinquevittatus group of Dendrobates. American Museum Novitates 2988: 1–21. Google Scholar Caldwell J.P., Lima A.P., Keller C. 2002. Redescription of Colostethus marchesianus (Melin, 1941) from its type locality. Copeia 2002: 157–165. BioOne, Google Scholar Cambrón Infante A. 1998. Ramon de la Sagra, un gallego ilustrado. Anuario da Facultade de Dereito da Universidade da Coruña 2: 215–228. Google Scholar Canedo C., Pombal Jr J.P. 2007. Two new species of torrent frog of the genus Hylodes (Anura, Hylodidae) with nuptial thumb tubercles. Herpetologica 63: 224–235. DOI BioOne, Google Scholar Cannatella D.C. 1980. Two new species of Centrolenella from Bolivia (Anura: Centrolenidae). Proceedings of the Biological Society of Washington 93: 714–724. Google Scholar Cannatella D.C. 1981. A new Atelopus from Ecuador and Colombia. Journal of Herpetology 15: 133–138. DOI Crossref, Google Scholar Carvalho A.L. 1946. Um novo genero de ceratofridideo do sudeste baiano. Boletim do Museu Nacional 73: 1–18. Google Scholar Carvalho T.R. de, Martins L.B., Giaretta A.A. 2016. A new account for the endangered Cerrado rocket frog Allobates goianus (Bokermann, 1975) (Anura: Aromobatidae), with comments on taxonomy and conservation. Acta Herpetologica 11: 21–30. DOI Google Scholar Castillo-Trenn P., Coloma L.A. 2008. Notes on behaviour and reproduction in captive Allobates kingsburyi (Anura: Dendrobatidae), with comments on evolution of reproductive amplexus. International Zoo Yearbook 42: 58–70. DOI Crossref, Google Scholar Cei J.M. 1976. Remarks on some Neotropical amphibians of the genus Alsodes from southern Argentina. Atti della Societa Italiana di Scienze Naturali e del Museo Civico di Storia Naturale di Milano 117: 159–164. Google Scholar Chang J.L. 2008. Sexual dimorphism of the second-to-fourth digit length ratio (2D:4D) in the strawberry poison dart frog (Oophaga pumilio) in Costa Rica. Journal of Herpetology 42: 414–416. DOI BioOne, Google Scholar Channing A., Schmitz A., Burger M., Kielgast J. 2013. A molecular phylogeny of African dainty frogs, with the description of four new species (Anura: Pyxicephalidae: Cacosternum). Zootaxa 3701: 518–550. DOI Crossref, PubMed, Google Scholar Cipriani I., Rivera M. 2009. Detección de alcaloides en la piel de cuatro especies de anfibios ecuatorianos (Anura: Dendrobatidae). Revista Ecuatoriana de Medicina y Ciencias Biológicas 30: 42–49. Crossref, Google Scholar Cisneros-Heredia D.F., Yánez-Muñoz M.H. 2010. A new poison frog of the genus Epipedobates (Dendrobatoidea: Dendrobatidae) from the north-western Andes of Ecuador. Avances 2: B83–B86. Google Scholar Cochran D.M. 1953. Three new Brazilian frogs. Herpetologica 8: 111–115. Google Scholar Cochran D.M., Goin C.J. 1964. Description of a new frog of the genus Phyllobates from Colombia (Amphibia, Ranidae, Dendrobatinae). Senckenbergiana Biologica 45: 255–257. Google Scholar Cochran D.M., Goin C.J. 1970. Frogs of Colombia. Bulletin of the U.S. National Museum 288: 1–655. Crossref, Google Scholar Coloma L.A. 1995. Ecuadorian frogs of the genus Colostethus (Anura: Dendrobatidae). The University of Kansas Natural History Museum Miscellaneous Publication 87: 1–72. Google Scholar Conradie W. 2014. The King of the Dwarves: A new cryptic species of dainty frog (Anura: Pyxicephalidae: Cacosternum) from the eastern Great Escarpment of South Africa. Zootaxa 3785: 438–452. DOI Crossref, PubMed, Google Scholar Cope E.D. 1861. Descriptions of reptiles from tropical America and Asia. Proceedings of the Academy of Natural Sciences of Philadelphia 12: 368–374. Google Scholar Cope E.D. 1862. Catalogues of the reptiles obtained during the Explorations of the Parana, Paraguay, Vermejo and Uraguay [sic] Rivers, by Capt. Thos. J. Page, U.S.N.; and of those procured by Lieut. N. Michler, U.S. Top Eng., Commander of the Expedition conducting the. Proceedings of the Academy of Natural Sciences of Philadelphia 14: 346–359. Google Scholar Cope E.D. 1863. On Trachycephalus, Scaphiopus, and other American Batrachia. Proceedings of the Academy of Natural Sciences of Philadelphia 15: 43–54. Google Scholar Cope E.D. 1865. Sketch of primary groups of Batrachia Salientia. Natural History Review 5: 97–120. Google Scholar Cope E.D. 1866a. Fourth contribution to the herpetology of tropical America. Proceedings of the Academy of Natural Sciences of Philadelphia 18: 123–132. Google Scholar Cope E.D. 1866b. On the structures and distribution of the genera of the arciferous Anura. Journal of the Academy of Natural Sciences of Philadelphia Series 2 6: 67–112. DOI Google Scholar Cope E.D. 1867. On the families of the raniform Anura. Journal of the Academy of Natural Sciences of Philadelphia Series 3 6: 189–206. Google Scholar Cope E.D. 1868. An examination of the Reptilia and Batrachia obtained by the Orton Expedition to Ecuador and the upper Amazon, with notes on other species. Proceedings of the Academy of Natural Sciences of Philadelphia 20: 96–140. Google Scholar Cope E.D. 1869. Sixth contribution to the herpetology of tropical America. Proceedings of the Academy of Natural Sciences of Philadelphia 20: 305–312. Google Scholar Cope E.D. 1875. On the Batrachia and Reptilia of Costa Rica: with notes on the herpetology and ichthyology of Nicaragua and Peru. Journal of the Academy of Natural Sciences of Philadelphia Series 2 8: 93–154. Philadelphia. DOI Google Scholar Cope E.D. 1887. Synopsis of the Batrachia and Reptilia obtained by H.H. Smith, in the Province of Mato Grosso, Brazil. Proceedings of the American Philosophical Society 24: 44–60. Google Scholar Cope E.D. 1893. Second addition to the knowledge of the Batrachia and Reptilia of Costa Rica. Proceedings of the American Philosophical Society 31: 333–347. Google Scholar Cope E.D. 1899. Contributions to the herpetology of New Granada and Argentina, with descriptions of new forms. The Philadelphia Museums Scientific Bulletin 1: 2–22. DOI Google Scholar Costa R.C., Facure K.G., Giaretta A.A. 2006. Courtship, vocalization, and tadpole description of Epipedobates flavopictus (Anura: Dendrobatidae) in southern Goiás, Brazil. 6. Google Scholar Cuvier G.L.C.F.D. 1797. Tableau Élémentaire de L'histoire Naturelle des Animaux. Baudouin, Paris. Google Scholar Daly J.W. 1998. Thirty years of discovering arthropod alkaloids in amphibian skin. Journal of Natural Products 61: 162–172. DOI Crossref, PubMed, Google Scholar Daly J.W., Myers C.W. 1967. Toxicity of Panamanian poison frogs (Dendrobates): some biological and chemical aspects. Science 156: 970–973. Crossref, PubMed, Google Scholar Daly J.W., Highet R.J., Myers C.W. 1984. Occurrence of skin alkaloids in non-dendrobatid frogs from Brazil (Bufonidae), Australia (Myobatrachidae) and Madagascar (Mantellinae). Toxicon 22: 905–19. DOI Crossref, PubMed, Google Scholar Daly J.W., Myers C.W., Whittaker N. 1987. Further classification of skin alkaloids from Neotropical poison frogs (Dendrobatidae), with a general survey of toxic/noxious substances in the Amphibia. Toxicon 25: 1023–1095. DOI Crossref, PubMed, Google Scholar Daly J.W., Gusovsky F., Myers C.W., Yotsu-Yamashita M., Yasumoto T. 1994a. First occurrence of tetrodotoxin in a dendrobatid frog (Colostethus inguinalis), with further reports for the bufonid genus Atelopus. Toxicon 32: 279–285. DOI Crossref, PubMed, Google Scholar Daly J.W., Secunda S.I., Garraffo H.M., Spande T.F., Wisnieski A., Cover Jr J.F. 1994b. An uptake system for dietary alkaloids in poison frogs (Dendrobatidae). Toxicon 32: 657–663. DOI Crossref, PubMed, Google Scholar Daly J.W., Garraffo H.M., Spande T.F., Clark V.C., Ma J., Ziffer H., Cover Jr J.F. 2003. Evidence for an enantioselective pumliotoxin 7-hydroxylase in dendrobatid poison frogs of the genus Dendrobates. Proceedings of the National Academy of Sciences USA 100: 11092–11097. DOI Crossref, PubMed, Google Scholar Daly J.W., Spande T.F., Garraffo H.M. 2005. Alkaloids from amphibian skin: a tabulation of over eight-hundred compounds. Journal of Natural Products 68: 1556–1575. DOI Crossref, PubMed, Google Scholar Daly J.W., Ware N., Saporito R.A., Spande T.F., Garraffo H.M. 2009. N-methyldecahydroquinolines: an unexpected class of alkaloids from Amazonian poison frogs (Dendrobatidae). Journal of Natural Products 72: 1110–1114. DOI Crossref, PubMed, Google Scholar Darst C.R., Cummings M.E. 2006. Predator learning favours mimicry of a less-toxic model in poison frogs. Nature 440: 208–211. DOI Crossref, PubMed, Google Scholar Darst C.R., Menéndez-Guerrero P.A., Coloma L.A., Cannatella D.C. 2005. Evolution of dietary specialization and chemical defense in poison frogs (Dendrobatidae): a comparative analysis. American Naturalist 165: 56–69. DOI Crossref, PubMed, Google Scholar Darst C.R., Cummings M.E., Cannatella D.C. 2006. A mechanism for diversity in warning signals: Conspicuousness versus toxicity in poison frogs. Proceedings of the National Academy of Sciences USA 103: 5852–5857. DOI Crossref, PubMed, Google Scholar Davis D.D. 1935. A new generic and family position for Bufo borbonica. Field Museum of Natural History Publications Zoológical Series 20: 87–92. DOI Google Scholar Dehling J.M., Matsui M., Imbun P.Y. 2016. A new small montane species of Philautus (Amphibia: Anura: Rhacophoridae) from Gunung Kinabalu, Sabah, Malaysia (Borneo). Salamandra 52: 77–90. Google Scholar Dempewolf L., Hailey A., Mannette R., Cazabon M., Roach A., Alemu I J., … Naranjit K. 2007. Ecological observations on the critically endangered Tobago endemic frog Mannophryne olmonae. Applied Herpetology 4: 377–386. DOI Crossref, Google Scholar Denton J.S., Wheeler W.C. 2012. Indel information eliminates trivial sequence alignment in maximum likelihood phylogenetic analysis. Cladistics 28: 514–528. DOI Crossref, Google Scholar di Tada I.E., Barla M.J., Martori R.A., Cei J.M. 1984. Odontophrynus achalensis, una nueva especie de anfibio de La Pampa de Achala (Cordoba, Argentina). Historia Natural 4: 149–155. Google Scholar Dias P.H.D.S., Amaro R.C., De Carvalho-E-Silva A.M.P.T., Rodrigues M.T. 2013. Two new species of Proceratophrys Miranda-Ribeiro, 1920 (Anura; Odontophrynidae) from the Atlantic forest, with taxonomic remarks on the genus. Zootaxa 3682: 277–304. DOI Crossref, PubMed, Google Scholar Dole J.W., Durant P. 1972. A new species of Colostethus (Amphibia: Salientia) from the Merida Andes, Venezuela. Carribean Journal of Science 12: 191–193. Google Scholar Donoso-Barros R. 1965. Nuevos reptiles y anfibios de Venezuela. Noticiario Mensual. Museo Nacional de Historia Natural 102: 2–3. Google Scholar Donoso-Barros R. 1974. Nuevos reptiles y anfibios de Chile. Boletin de la Sociedad de Biología de Concepción 48: 217–229. Google Scholar Downie J.R., Nokhbatolfoghahai M. 2014. Tadpoles of Mannophryne trinitatis and M. olmonae (Anura: Aromobatidae): further description and comparison. Living World, Journal of The Trinidad and Tobago Field Naturalists' Club 2014: 21–24. Google Scholar Downie J.R., Robinson E., Linklater-McLennan R.J., Somerville E., Kamenos N. 2005. Are there costs to extended larval transport in the Trinidadian stream frog, Mannophryne trinitatis (Dendrobatidae)? Journal of Natural History 39: 2023–2034. DOI Crossref, Google Scholar Dreher C.E., Pröhl H. 2014. Multiple sexual signals: calls over colors for mate attraction in an aposematic, color-diverse poison frog. Frontiers in Ecology and Evolution 2: 1–10. DOI Crossref, Google Scholar Dring J. 1987. Bornean treefrogs of the genus Philautus (Rhacophoridae). Amphibia-Reptilia 8: 19–47. DOI Crossref, Google Scholar Dubois A. 1982. Dendrobates Wagler, 1830 and Dendrobatidae Cope, 1865 (Amphibia, Anura): proposed conservation. The Bulletin of Zoológical Nomenclature 39: 267–278. Crossref, Google Scholar Dubois A. 1986. Living amphibians of the world: a first step towards a comprehensive checklist. Alytes 5: 99–149. Google Scholar Dubois A. 1987. Miscellanea taxonomica batrachologica (I). Alytes 5: 7–95. Google Scholar Dubois A. 2017. The nomenclatural status of Hysaplesia, Hylaplesia, Dendrobates and related nomina (Amphibia, Anura), with general comments on Zoológical nomenclature and its governance, as well as on taxonomic databases and websites. Bionomina 11: 1–48. DOI Crossref, Google Scholar Dubois A., Ohler A., Biju S.D. 2001. A new genus and species of Ranidae (Amphibia, Anura) from southwestern India. Alytes 19: 53–79. Google Scholar Dubois A., Frétey T., Ohler A. 2016. The nomenclatural status of the amphibian nomina published by Luuc Bauer from 1985 to 1994, with comments on the Rules of the Code concerning the techniques of printing. Bionomina 10: 22. DOI Crossref, Google Scholar Duellman W.E. 2004. Frogs of the genus Colostethus (Anura; Dendrobatidae) in the Andes of northern Peru. Scientific Papers, Natural History Museum, The University of Kansas 35: 1–49. DOI Google Scholar Duellman W.E., Lynch J.D. 1988. Anuran amphibians from the Cordillera de Cutucú, Ecuador. Proceedings of the Academy of Natural Sciences of Philadelphia 140: 125–142. Google Scholar Duellman W.E., Simmons J.E. 1988. Two new species of dendrobatid frogs, genus Colostethus, from the Cordillera del Cóndorm Ecuador. Proceedings of the Academy of Natural Sciences of Philadelphia 140: 115–124. Google Scholar Dugas M.B., Richards-Zawaki C.L. 2015. A captive breeding experiment reveals no evidence of reproductive isolation among lineages of a polytypic poison frog. Biological Journal of the Linnean Society 116: 52–62. DOI Crossref, Google Scholar Dugas M.B., Wamelink C.N., Killius A.M., Richards-Zawacki C.L. 2015. Behavioral parental care is beneficial for offspring, costly for mothers, and limited by family size in an egg-feeding frog. Behavioral Ecology 0: 1–8. DOI Google Scholar Duméril A.-M.-C., Bibron G. 1841. Erpétologie General ou Histoire Naturelle Compléte des Reptiles. Librairie Encyclopédique de Roret, Paris. Google Scholar Dunn E.R. 1924. Some Panamanian frogs. Occasional Papers of the Museum of Zoology, University of Michigan 151: 1–17. Google Scholar Dunn E.R. 1931. The amphibians of Barro Colorado Island. Occasional Papers of the Boston Society of Natural History 5: 403–421. Google Scholar Dunn E.R. 1933. Amphibians and reptiles from El Valle de Anton, Panama. Occasional Papers of the Boston Society of Natural History 8: 65–79. Google Scholar Dunn E.R. 1957. Neotropical frog genera: Prostherapis versus Hyloxalus, with remarks on Phyllobates. Copeia 1957: 77–78. Crossref, Google Scholar Edwards S.R. 1971. Taxonomic notes on South American Colostethus with descriptions of two new species (Amphibia, Dendrobatidae). Proceedings of the Biological Society of Washington 84: 147–162. Google Scholar Edwards S.R. 1974. Taxonomic notes on South American dendrobatid frogs of the genus Colostethus. Occasional Papers of the Museum of Natural History, The University of Kansas 30: 1–14. DOI Crossref, Google Scholar Erdtmann L.K., Amézquita A. 2009. Differential evolution of advertisement call traits in dart-poison frogs (Anura: Dendrobatidae). Ethology 115: 801–811. DOI Crossref, Google Scholar Fabrezi M., Alberch P. 1996. The carpal elements of anurans. Herpetologica 52: 188–204. Google Scholar Faivovich J., Haddad C.F.B., Garcia P.C.A., Frost D.R., Campbell J.A., Wheeler W.C. 2005. Systematic review of the frog family Hylidae, with special reference to Hylinae: phylogenetic analysis and taxonomic revision. Bulletin of the American Museum of Natural History 294: 1–240. DOI BioOne, Google Scholar Faivovich J., Nicoli L., Blotto B.L., Pereyra M.O., La Marca E., Barrionuevo J.S., … Haddad C.F.B. 2014. Big, bad, and beautiful: phylogenetic relationships of the horned frogs (Anura: Ceratophryidae). South American Journal of Herpetology 9: 207–227. DOI BioOne, Google Scholar Fitzinger L.J. 1826. Neue classification der Reptilien nach ihren naturlichen Verwandtschaften nebst einer Verwandtschafts-Tafel und einem Verzeichnisse der Reptilien-Sammlung des K.K. Zoologisch Museum's zu Wien. J.G. Heubner, Vienna. DOI Google Scholar Fitzinger L.J. 1843. Systema Reptilium. Fasciculus Primus. Braumuller et Seidel, Wien. DOI Google Scholar Fitzpatrick S.W., Brasileiro C.A., Haddad C.F.B., Zamudio K.R. 2009. Geographical variation in genetic structure of an Atlantic Coastal Forest frog reveals regional differences in habitat stability. Molecular Ecology 18: 2877–2896. DOI Crossref, PubMed, Google Scholar Fitzsimons V. 1932. Preliminary descriptions of new forms of South African Reptilia and Amphibia, from the Vernay-Lang Kalahari Expedition, 1930. Annals of the Transvaal Museum 15: 35–40. Google Scholar Flores E.E., Stevens M., Moore A.J., Blount J.D. 2013. Diet, development and the optimization of warning signals in postmetamorphic green and black poison frogs. Functional Ecology 27: 816–829. DOI Crossref, Google Scholar Ford L.S., Cannatella D.C. 1993. The major clades of frogs. Herpetological Monographs 7: 94–117. Crossref, Google Scholar Formas J.R. 1989. A new species of Eupsophus (Amphibia: Anura: Leptodactylidae) from southern Chile. Proceedings of the Biological Society of Washington 102: 568–576. Google Scholar Forti L.R., Strüssmann C., Mott T. 2010. Acoustic communication and vocalization microhabitat in Ameerega braccata (Steindachner, 1864) (Anura, Dendrobatidae) from midwestern Brazil. Brazilian Journal of Biology 70: 211–216. Crossref, PubMed, Google Scholar Forti L.R., Tissiani A.S.O., Mott T., Strüssmann C. 2011. Diet of Ameerega braccata (Steindachner, 1864) (Anura: Dendrobatidae) from Chapada dos Guimarães and Cuiabá, Mato Grosso State, Brazil. Brazilian Journal of Biology 71: 189–196. Crossref, PubMed, Google Scholar Forti L.R., Mott T., Strüssmann C. 2013. Breeding biology of Ameerega braccata (Steindachner, 1864) (Anura: Dendrobatidae) in the Cerrado of Brazil. Journal of Natural History 47: 2363–2371. DOI Crossref, Google Scholar Fouquet A., Pineau K., Rodrigues M.T., Mailles J., Schneider J.-B., Ernst R., Dewynter M. 2013a. Endemic or exotic: the phylogenetic position of the Martinique volcano frog Allobates chalcopis (Anura: Dendrobatidae) sheds light on its origin and challenges current conservation strategies. Systematics and Biodiversity 11: 87–101. DOI Crossref, Google Scholar Fouquet A., Blotto B.L., Maronna M.M., Verdade V.K., Juncá F.A., de Sá R.O., Rodrigues M.T. 2013b. Unexpected phylogenetic positions of the genera Rupirana and Crossodactylodes reveal insights into the biogeography and reproductive evolution of leptodactylid frogs. Molecular Phylogenetics and Evolution 67: 445–57. DOI Crossref, PubMed, Google Scholar Fouquet A., Souza S.M., Nunes P.M.S., Kok P.J.R., Curcio F.F., de Carvalho C.M., … Rodrigues M.T. 2015. Two new endangered species of Anomaloglossus (Anura: Aromobatidae) from Roraima State, northern Brazil. Zootaxa 3926: 191–210. DOI Crossref, PubMed, Google Scholar Franco-Belussi L., Sköld H.N., de Oliveira C. 2016. Internal pigment cells respond to external UV radiation in frogs. Journal of Experimental Biology 219: 1378–1383. DOI Crossref, PubMed, Google Scholar Frost D.R. 1985. Amphibian Species of the World: A Taxonomic and Geographical Reference. Allen Press/Association of Systematics Collections, Lawrence. Google Scholar Frost D.R. 1986. A new species of Colostethus (Anura: Dendrobatidae) from Ecuador. Proceedings of the Biological Society of Washington 99: 214–217. Google Scholar Frost D.R. 1999. Amphibian species of the world: an online reference. Version 2.21 (June 1999). Accessible at: http://research.amnh.org/herpetology/amphibia/index.html [version no longer available online]. Google Scholar Frost D.R. 2017. Amphibian species of the world: an online reference. Version 6.0 (28 February 2017). Accessible at: http://research.amnh.org/herpetology/amphibia/index.html. Google Scholar Frost D.R., Grant T., Faivovich J., Bain R.H., Haas A., Haddad C.F.B., … Wheeler W.C. 2006. The amphibian tree of life. Bulletin of the American Museum of Natural History 297: 1–370. DOI BioOne, Google Scholar Frost D.R., Grant T., Faivovich J., Bain R.H., Haas A., Haddad C.F.B., … Wheeler W.C. 2008. Is The Amphibian Tree of Life really fatally flawed? Cladistics 24: 385–395. DOI Crossref, Google Scholar Funkhouser J.W. 1956. New frogs from Ecuador and southwestern Colombia. Zoológica 41: 73–79. Google Scholar Gaige H.T. 1926. A new frog from British Guiana. Occasional Papers of the Museum of Zoology, University of Michigan 176: 1–3. Google Scholar Gallardo J.M. 1961. Anfibios anuros de Misiones con la descripcion de una nueva especie de Crossodactylus. Neotropica 7: 33–38. Google Scholar Gallardo J.M. 1962. Los generos Telmatobius y Bratrachophrynus (Amphibia, Leptodactylidae) en la Argentina. Neotropica 8: 45–58. Google Scholar Gallardo J.M. 1965. A proposito de los Leptodactylidae (Amphibia, Anura). Papéis Avulsos de Zoologia 17: 77–87. Google Scholar Garman S. 1888. West Indian Batrachia in the Museum of Comparative Zoology. Bulletin of the Essex Institute 19: 13–16. Google Scholar Gasser H., Amézquita A., Hödl W. 2009. Who is calling? Intraspecific call variation in the aromobatid frog Allobates femoralis. Ethology 115: 596–607. Crossref, Google Scholar Gene Codes Corporation. 2014. Sequencher DNA sequence analysis software version 5.3. Available from: www.genecodes.comhttp://www.genecodes.com. Google Scholar Giaretta A.A., Aguiar Jr O. 1998. A new species of Megaelosia from the Mantiqueira Range, southeastern Brazil. Journal of Herpetology 32: 80–83. Crossref, Google Scholar Girard C. 1853. Descriptions of new species of reptiles, collected by the U.S. Exploring Expedition, under the command of Capt. Charles Wilkes, U.S.N. Second Part. Including the species of batrachians, exotic to North America. Proceedings of the Academy of Natural Sciences of Philadelphia 6: 420–424. Google Scholar Girard C. 1855. Abstract of a report to Lieut. James M. Gilliss, U.S.N., upon the reptiles collected during the U.S.N. Astronomical Expedition to Chili. Proceedings of the Academy of Natural Sciences of Philadelphia 7: 226. Google Scholar Gistel J. 1848. Naturgeschichte des Thierreichs: Fur hohere Schulen. Scheitlin & Krais, Stuttgart. DOI Google Scholar Goloboff P.A. 1996. Methods for faster parsimony analysis. Cladistics 12: 199–220. DOI Crossref, Google Scholar Goloboff P.A. 1999. Analyzing large data sets in reasonable times: solutions for composite optima. Cladistics 15: 415–428. DOI Crossref, Google Scholar Goloboff P.A., Catalano S.A. 2016. TNT version 1.5, including a full implementation of phylogenetic morphometrics. Cladistics 32: 221–238. DOI Crossref, Google Scholar Goloboff P.A., Pol D. 2005. Parsimony and Bayesian phylogenetics. Pp. 148–159, in Albert V. (Ed.), Parsimony, Phylogeny, and Genomics. Oxford Univeristy Press, Oxford. Google Scholar Goloboff P.A., Farris J.S., Nixon K.C. 2008. TNT, a free program for phylogenetic analysis. Cladistics 24: 774–786. DOI Crossref, Google Scholar Goodman M., Olson C.B., Beeber J.E., Czelusniak J. 1982. New perspectives in the molecular biological analysis of mammalian phylogeny. Acta Zoológica Fennica 169: 19–35. Google Scholar Gorzula S. 1990. Una nueva especie de Dendrobates (Amphibia, Dendrobatidae) del Macizo del Chimantá, Estado Bolívar, Venezuela. Google Scholar Grant T. 2004. On the identities of Colostethus inguinalis (Cope, 1868) and C. panamensis (Dunn, 1933), with comments on C. latinasus (Cope, 1863) (Anura: Dendrobatidae). American Museum Novitates 3444: 1–24. DOI BioOne, Google Scholar Grant T. 2007. A new, toxic species of Colostethus (Anura: Dendrobatidae) from the Cordillera Central of Colombia. Zootaxa 1555: 39–51. Google Scholar Grant T., Ardila-Robayo M.C. 2002. A new species of Colostethus (Anura: Dendrobatidae) from the eastern slopes of the Cordillera Oriental of Colombia. Herpetologica 58: 252–260. DOI BioOne, Google Scholar Grant T., Castro F. 1998. The cloud forest Colostethus (Anura, Dendrobatidae) of a region of the Cordillera Occidental of Colombia. Journal of Herpetology 32: 378–392. Crossref, Google Scholar Grant T., Frost D.R. 2016. Recent progress in the systematics of poison frogs and their relatives (Dendrobatoidea). Pp. 9–18, in Kahn T.R., La Marca E., Lötters S., Brown J.L., Twomey E., Amézquita A. (Eds.), Aposematic Poison Frogs (Dendrobatidae) of the Andean Countries: Bolivia, Colombia, Ecuador, Peru and Venezuela. Conservation International Tropical Field Guide Series, Conservation lnternational, Arlington. Google Scholar Grant T., Kluge A.G. 2003. Data exploration in phylogenetic inference: Scientific, heuristic, or neither. Cladistics 19: 379–418. DOI Crossref, Google Scholar Grant T., Kluge A.G. 2008a. Clade support measures and their adequacy. Cladistics 24: 1051–1064. DOI Crossref, Google Scholar Grant T., Kluge A.G. 2008b. Credit where credit is due: the Goodman-Bremer support metric. Molecular Phylogenetics and Evolution 49: 405–406. DOI Crossref, PubMed, Google Scholar Grant T., Kluge A.G. 2009. Parsimony, explanatory power, and dynamic homology testing. Systematics and Biodiversity 7: 357–363. Crossref, Google Scholar Grant T., Myers C.W. 2013. Review of the frog genus Silverstoneia, with descriptions of five new species from the Colombian Chocó (Dendrobatidae: Colostethinae). American Museum Novitates 1–58. DOI BioOne, Google Scholar Grant T., Rodríguez L.O. 2001. Two new species of frogs of the genus Colostethus (Dendrobatidae) from Peru and a redescription of C. trilineatus (Boulenger, 1883). American Museum Novitates 3355: 1–24. BioOne, Google Scholar Grant T., Humphrey E.C., Myers C.W. 1997. The median lingual process of frogs: a bizarre character of Old World ranoids discovered in South American dendrobatids. American Museum Novitates 3212: 1–40. Google Scholar Grant T., Frost D.R., Caldwell J.P., Gagliardo R., Haddad C.F.B., Kok P.J.R., … Wheeler W.C. 2006. Phylogenetic systematics of dart-poison frogs and their relatives (Anura: Athesphatanura: Dendrobatidae). Bulletin of the American Museum of Natural History 299: 1–262. DOI BioOne, Google Scholar Grant T., Acosta-Galvis A.R., Rada M. 2007. A name for the species of Allobates (Anura: Dendrobatoidea: Aromobatidae) from the Magdalena Valley of Colombia. Copeia 2007: 844–854. DOI BioOne, Google Scholar Gray H.M., Summers K., Ibáñez D R. 2009. Kin discrimination in cannibalistic tadpoles of the green poison frog, Dendrobates auratus (Anura, Dendrobatidae). Phyllomedusa 8: 41–50. DOI Crossref, Google Scholar Gray J.E. 1825. A synopsis of the genera of reptiles and Amphibia, with a description of some new species. Annals of Philosophy. Series 2. London 10: 193–217. Google Scholar Guarnizo C.E., Cannatella D.C. 2013. Genetic divergence within frog species is greater in topographically more complex regions. Journal of Zoológical Systematics and Evolutionary Research 51: 333–340. DOI Google Scholar Günther A.C.L.G. 1858. Neue Batrachier in der Sammlung des britischen Museums. Archiv für Naturgeschichte 24: 319–328. DOI Crossref, Google Scholar Günther A.C.L.G. 1862. Descriptions of new species of reptiles and fishes in the collection of the British Museum. Proceedings of the Zoológical Society of London 30: 188–194. DOI Crossref, Google Scholar Günther A.C.L.G. 1873. Contribution to our knowledge of Ceratophrys and Megalophrys. Annals and Magazine of Natural History Series 4 11: 417–419. Crossref, Google Scholar Günther A.C.L.G. 1881. Account of the Zoológical collections made during the survey of H.M.S. ‘Alert’ in the Straits of Magellan and on the coast of Patagonia. III. Reptiles, batrachians, and fishes. Proceedings of the Zoológical Society of London 49: 18–22. DOI Google Scholar Haas A. 2001. Mandibular arch musculature of anuran tadpoles, with comments on homologies of amphibian jaw muscles. Journal of Morphology 247: 1–33. Crossref, PubMed, Google Scholar Haddad C.F.B., Pombal Jr J.P. 1995. A new species of Hylodes from southeastern Brazil (Amphibia: Leptodactylidae). Herpetologica 51: 279–286. Google Scholar Hantak M.M., Paluh D.J., Saporito R.A. 2016. Bufadienolide and alkaloid-based chemical defences in two different species of Neotropical anurans are equally effective against the same arthropod predators. Journal of Tropical Ecology 32: 165–169. DOI Crossref, Google Scholar Hardy J.D.J. 1983. A new frog of the genus Colostethus from the island of Tobago, West Indies (Anura: Dendrobatidae). Bulletin of the Maryland Herpetological Society 19: 47–57. Google Scholar Hardy L.M., Crnkovic A.C. 2006. Diet of amphibians and reptiles from the Engare Ondare River region of central Kenya, during the dry season. African Journal of Herpetology 55: 143–159. DOI Crossref, Google Scholar Hegna R.H., Saporito R.A., Donnelly M.A. 2013. Not all colors are equal: predation and color polytypism in the aposematic poison frog Oophaga pumilio. Evolutionary Ecology 27: 831–845. DOI Crossref, Google Scholar Hellmich W. 1940. Beiträge zur Kenntnis der Gattung Hyloxalus (Brachycephalidae, Amphibia). Zoologischer Anzeiger 131: 113–128. Google Scholar Hensel R. 1867. Beitrâge zur Kenntniss der Wirbelthiere Südbrasiliens. Archiv für Naturgeschichte 33: 120–162. Crossref, Google Scholar Hervas F., Torres K., Montenegro-Larrea P., Del Pino E.M. 2015. Development and gastrulation in Hyloxalus vertebralis and Dendrobates auratus (Anura: Dendrobatidae). Amphibian & Reptile Conservation 8: 121–135. Google Scholar Hewitt J. 1919. Anhydrophryne rattrayi, a remarkable new frog from Cape Colony. Record of the Albany Museum. Grahamstown 3: 182–189. Google Scholar Heyer W.R. 1983. Variation and systematics of frogs of the genus Cycloramphus (Amphibia, Leptodactylidae). Arquivos de Zoologia 30: 235–339. Crossref, Google Scholar Heyer W.R. 1999. A new genus and species of frog from Bahia, Brazil (Amphibia: Anura: Leptodactylidae) with comments on the zoogeography of the Brazilian campos repestres. Proceedings of the Biological Society of Washington 112: 19–39. Google Scholar Heyer W.R., Cocroft R.B. 1986. Descriptions of two new species of Hylodes from the Atlantic forests of Brazil (Amphibia: Leptodactylidae). Proceedings of the Biological Society of Washington 99: 100–109. Google Scholar Hill H.Z. 1992. The function of melanin or six blind people examine an elephant. BioEssays 14: 49–56. DOI Crossref, PubMed, Google Scholar Hoffman A.C. 1932. Researches relating to the validity of the South African Polypedatidae (Rhacophoridae) as an autonomous family of the Anura. South African Journal of Science 29: 562–583. Google Scholar Hoogmoed M.S. 1969. Notes on the herpetofauna of Surinam: 3. A new species of Dendrobates (Amphibia Salientia, Dendrobatidae) from Surinam. Zoologische Mededelingen 44: 133–141. Google Scholar Hoogmoed M.S., Avila-Pires T.C.S. 2012. Inventory of color polymorphism in populations of Dendrobates galactonotus (Anura: Dendrobatidae), a poison frog endemic to Brazil. Phyllomedusa 11: 95–115. DOI Crossref, Google Scholar HUGO Gene Nomenclature Committee. 2017. Accessible at http://www.genenames.org. Accessed: 22 June 2017. Google Scholar Ibáñez D R., Griffith E.J., Lips K.R., Crawford A.J. 2017. Altitudinal distribution and advertisement call of Colostethus latinasus (Amphibia: Dendrobatidae), endemic species from eastern Panama and type species of Colostethus, with a molecular assessment of similar sympatric species. Zootaxa 4254: 91–101. DOI Crossref, PubMed, Google Scholar ICZN. 1999. International Code of Zoological Nomenclature, 4th ed. International Trust for Zoological Nomenclature 1999, London. Google Scholar ICZN. 2009. Opinion 2223 (Case 3345): Dendrobatidae Cope, 1865 (1850) (Amphibia, Anura): family-group name conserved. Bulletin of Zoológical Nomenclature 66: 103–105. Link, Google Scholar ICZN. 2012. Amendment of Articles 8, 9, 10, 21 and 78 of the International Code of Zoológical Nomenclature to expand and refine methods of publication. ZooKeys 219: 1–10. DOI Crossref, Google Scholar Inger R.F. 1954. Systematics and zoogeography of Philippine Amphibia. Fieldiana 33: 181–531. Google Scholar Irisarri I., Mauro D.S., Abascal F., Ohler A., Vences M., Zardoya R. 2012. The origin of modern frogs (Neobatrachia) was accompanied by acceleration in mitochondrial and nuclear substitution rates. BMC genomics 13: 626. DOI Crossref, PubMed, Google Scholar Jeckel A.M., Grant T., Saporito R.A. 2015. Sequestered and synthesized chemical defenses in the poison frog Melanophryniscus moreirae. Journal of Chemical Ecology 41: 505–512. DOI Crossref, PubMed, Google Scholar Jiménez de la Espada M. 1870. Fauna neotropicalis species quaedam nondum cognitae. Jornal de Sciências, Mathemáticas, Physicas e Naturaes. Lisboa 3: 57–65. Google Scholar Jiménez de la Espada M. 1875. Vertebrados del Viaje al Pacífico Verificado de 1862 a 1865 por una Comisión de Naturalistas Enviada por El Gobierno Español. Batracios. Imprenta de Miguel Ginesta, Madrid. DOI Google Scholar Juncá F.A., Altig R., Gascon C. 1994. Breeding biology of Colostethus stepheni, a dendrobatid with a nontransported nidicolous tadpole. Copeia 1994: 747–750. Crossref, Google Scholar Juncá F.A., Rodrigues M.T. 2006. Morphological changes in the female reproductive organs during mating in Colostethus stepheni and associated behaviour. Amphibia-Reptilia 27: 303–308. DOI Crossref, Google Scholar Juncá F.A., Eterovick P.C. 2007. Feeding ecology of two sympatric species of Aromobatidae, Allobates marchesianus and Anomaloglossus stepheni, in central Amazon. Journal of Herpetology 41: 301–308. DOI BioOne, Google Scholar Jungfer K.-H. 1989. Pfeilgiftfrösche der Gattung Epipedobates mit rot granuliertem Rücken aus dem Oriente von Ecuador und Peru. Salamandra 25: 81–98. Google Scholar Jungfer K. 2017. On Warszewicz's trail: the identity of Hyla molitor O. Schmidt, 1857. Salamandra 53: 18–24. Google Scholar Jungfer K.-H., Böhme W. 2004. A new poison-dart frog (Dendrobates) from northern central Guyana (Amphibia: Anura: Dendrobatidae). Salamandra 99–103. Google Scholar Jungfer K.-H., Weygoldt P., Juraske N. 1996. Dendrobates vicentei, ein neuer Pfeilgiftfrosch aus ZentralPanama. Herpetofauna. Weinstadt 18: 17–26. Google Scholar Jungfer K.-H., Lötters S., Jörgens D. 2000. Der kleinste Pfeilgiftfrosch-eine neue Dendrobates-Art aus WestPanama. Herpetofauna 22: 11–18. Google Scholar Jungfer K.-H., Faivovich J., Padial J.M., Castroviejo-Fisher S., Lyra M.M., Berneck B.V.M., … Haddad C.F.B. 2013. Systematics of spinybacked treefrogs (Hylidae: Osteocephalus): an Amazonian puzzle. Zoológica Scripta 42: 351–380. DOI Crossref, Google Scholar Kaefer I.L., Tsuji-Nishikido B.M., Lima A.P. 2012. Beyond the river: underlying determinants of population acoustic signal variability in Amazonian direct-developing Allobates (Anura: Dendrobatoidea). Acta Ethologica 15: 187–194. DOI Crossref, Google Scholar Kaiser H., Altig R. 1994. The atypical tadpole of the dendrobatid frog, Colostethus chalcopis, from Martinique, French Antilles. Copeia 1994: 374–378. Crossref, Google Scholar Kaiser H., Coloma L.A., Gray H.M. 1994. A new species of Colostethus (Anura: Dendrobatidae) from Martinique, French Antilles. Herpetologica 50: 23–32. Google Scholar Kaiser H., Steinlein C., Feichtinger W., Schmid M. 2003. Chromosome banding of six dendrobatid frogs (Colostethus, Mannophryne). Herpetologica 59: 203–218. BioOne, Google Scholar Kaplan M. 1997. A new species of Colostethus from the Sierra Nevada de Santa Marta (Colombia) with comments on intergeneric relationships within the Dendrobatidae. Journal of Herpetology 31: 369–375. Crossref, Google Scholar Katoh K., Standley D.M. 2013. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. DOI Crossref, PubMed, Google Scholar Kearney M. 2002. Fragmentary taxa, missing data, and ambiguity: mistaken assumptions and conclusions. Systematic Biology 51: 369–381. DOI Crossref, PubMed, Google Scholar Kearney M., Clark J.M. 2003. Problems due to missing data in phylogenetic analyses including fossils: a critical review. Journal of Vertebrate Paleontology 23: 263–274. DOI BioOne, Google Scholar Kearse M., Moir R., Wilson A., Stones-Havas S., Cheung M., Sturrock S., … Drummond A. 2012. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. DOI Crossref, PubMed, Google Scholar Kluge A.G. 1989. A concern for evidence and a phylogenetic hypothesis of relationships among Epicrates (Boidae, Serpentes). Systematic Zoology 38: 7–25. DOI Crossref, Google Scholar Kluge A.G. 2004. On total evidence: for the record. Cladistics 20: 205–207. DOI Crossref, Google Scholar Kluge A.G., Grant T. 2006. From conviction to anti-superfluity: old and new justifications for parsimony in phylogenetic inference. Cladistics 22: 276–288. DOI Crossref, Google Scholar Kneller M., Henle K. 1985. Ein neuer Blattsteiger-Frosch (Salientia: Dendrobatidae: Phyllobates) aus Peru. Salamandra 21: 62–69. Google Scholar Koch C., Venegas P.J., Rödder D. 2011. Advertisement call of Hyloxalus elachyhistus (Edwards, 1971) (Anura, Dendrobatidae). Salamandra 47: 116–119. Google Scholar Kok P.J.R. 2010. A redescription of Anomaloglossus praderioi (La Marca, 1998) (Anura: Aromobatidae: Anomaloglossinae), with description of its tadpole and call. Papéis Avulsos de Zoologia 50: 51–68. Google Scholar Kok P.J.R., Ernst R. 2007. A new species of Allobates (Anura: Aromobatidae: Allobatinae) exhibiting a novel reproductive behaviour. Zootaxa 1555: 21–38. Google Scholar Kok P.J.R., MacCulloch R.D., Gaucher P., Poelman E.H., Bourne G.R., Lathrop A., Lenglet G.L. 2006a. A new species of Colostethus (Anura, Dendrobatidae) from French Guiana with a redescription of Colostethus beebei (Noble, 1923) from its type locality. Phyllomedusa 5: 43–66. DOI Crossref, Google Scholar Kok P.J.R., Sambhu H., Roopsind I., Lenglet G.L., Bourne G.R. 2006b. A new species of Colostethus (Anura: Dendrobatidae) with maternal care from Kaieteur National Park, Guyana. Zootaxa 1238: 35–61. Google Scholar Kok P.J.R., Macculloch R.D., Lathrop A., Willaert B., Bossuyt F. 2010. A new species of Anomaloglossus (Anura: Aromobatidae) from the Pakaraima Mountains of Guyana. Zootaxa 2660: 18–32. Google Scholar Kok P.J.R., MacCulloch R.D., Means D.B., Roelants K., Van Bocxlaer I., Bossuyt F. 2012. Low genetic diversity in tepui summit vertebrates. Current Biology 22: R589–R590. DOI Crossref, PubMed, Google Scholar Kok P.J.R., Willaert B., Means D.B. 2013a. A new diagnosis and description of Anomaloglossus roraima (La Marca, 1998) (Anura: Aromobatidae: Anomaloglossinae), with description of its tadpole and call. South American Journal of Herpetology 8: 29–45. DOI BioOne, Google Scholar Kok P.J.R., Hölting M., Ernst R. 2013b. A third microendemic to the Iwokrama Mountains of central Guyana: A new “cryptic” species of Allobates Zimmerman and Zimmerman, 1988 (Anura: Aromobatidae). Organisms Diversity and Evolution 13: 621–638. DOI Crossref, Google Scholar Krings M., Klein B., Heneka M.J., Rödder D. 2017. Morphological comparison of five species of poison dart frogs of the genus Ranitomeya (Anura: Dendrobatidae) including the skeleton, the muscle system and inner organs. PLoS One 12: e0171669. DOI Crossref, PubMed, Google Scholar La Marca E. 1985. A new species of Colostethus (Anura: Dendrobatidae) from the Cordillera de Mérida, northern Andes, South America. Occasional Papers of the Museum of Zoology, University of Michigan 710: 1–10. Google Scholar La Marca E. 1989. A new species of collared frog (Anura: Dendrobatidae: Colostethus) from Serranía de Portuguesa, Andes of Estado Lara, Venezuela. Amphibia-Reptilia 10: 175–183. Crossref, Google Scholar La Marca E. 1992. Catálogo taxonómico, biogeográfico y bibliográfico de las ranas de Venezuela. Cuadernos Geográficos Universidad de los Andes 9: 1–197. Google Scholar La Marca E. 1994a. Taxonomy of the frogs of the genus Mannophryne (Amphibia; Anura; Dendrobatidae). Publicaciones de la Asociación de Amigos de Doñana 4: 1–75. Google Scholar La Marca E. 1994b. Descripción de un nuevo género de ranas (Amphibia: Dendrobatidae) de la Cordillera de Mérida, Venezuela. Anuario de Investigación 1991: 39–41. Google Scholar La Marca E. 1995. Biological and systematic synopsis of a genus of frogs from northern mountains of South America (Anura: Dendrobatidae: Mannophryne). Bulletin of the Maryland Herpetological Society 31: 40–78. Google Scholar La Marca E. 1997. Ranas del género Colostethus (Amphibia: Anura: Dendrobatidae) de la Guayana venezolana, con descripción de siete especies nuevas. Publicaciones de la Asociación de Amigos de Doñana 9: 1–64. Google Scholar La Marca E., Vences M., Lötters S. 2002. Rediscovery and mitochondrial relationships of the dendrobatid frog Colostethus humilis suggest parallel colonization of the Venezuelan Andes. Studies on Neotropical Fauna and Environment 37: 233–240. DOI Crossref, Google Scholar La Marca E., Manzanilla Puppo J., Mijares-Urrutia A. 2004. Revisión taxonómica del Colostethus del Norte de Venezuela confundido durante largo tiempo con C. brunneus. Herpetotropicos 1: 40–50. Google Scholar La Marca E., Otero López L.M. 2012. Rediscovery of the types of Colostethus meridensis, with description of a related new species and redescription of Aromobates mayorgai (Amphibia: Anura: Dendrobatidae). Herpetotropicos 7: 55–74. Google Scholar la Sagra R. de. 1838. Historia Física Política y Natural de La Isla de Cuba. Tomo I. Introducción, Geografía, Clima y Estadística. Arthur Bertrand, Paris. DOI Google Scholar la Sagra R. de. 1840. Historia Física, Política Y Natural de La Isla de Cuba, Segunda Parte, Tomo VIII, Atlas de Zoología. Arthur Bertrand, Paris. DOI Google Scholar Largen M.J. 1991. A new genus and species of petropedetine frog (Amphibia Anura Ranidae) from high altitude in the mountains of Ethiopia. Tropical Zoology 4: 139–152. DOI Crossref, Google Scholar Laurent R.F. 1941. Contribution à l'ostéologie et à la systématique des ranides africains. Première note. Revue de Zoologie et de Botanique Africaines. Tervuren 34: 74–96. Google Scholar Laurent R.F. 1943. Contribution a l'osteologie et a la systematique des rhacophorides non Africains. Bulletin du Musée Royal d'Histoire Naturelle de Belgique 19: 1–16. Google Scholar Laurent R.F. 1946. Mises au point dans la taxonomie des ranides. Revue de Zoologie et de Botanique Africaines. Tervuren 39: 336–338. Google Scholar Laurent R.F. 1986. Sous classe des lissamphibiens (Lissamphibia). Systematique. Pp. 594–797, in Grassé P., Delsol M. (Eds.), Traite de Zoologie. Anatomie, Systematique, Biologie. Tome 14. Batraciens. Paris. Google Scholar Lechelt S., Hödl W., Ringler M. 2014. The role of spectral advertisement call properties in species recognition of male Allobates talamancae (Cope, 1875). Herpetozoa 26: 139–150. Google Scholar Lehtinen R.M., Halley A. 2008. A description of the tadpole of Mannophryne olmonae (Anura: Aromobatidae). Caribbean Journal of Science 44: 260–264. Link, Google Scholar Lemmon A.R., Brown J.M., Stanger-Hall K., Lemmon E.M. 2009. The effect of ambiguous data on phylogenetic estimates obtained by maximum likelihood and Bayesian inference. Systematic Biology 58: 130–45. DOI Crossref, PubMed, Google Scholar Lenger D.R., Berkey J.K., Dugas M.B. 2014. Predation on the toxic Oophaga pumilio (Anura: Dendrobatidae) by Rhadinaea decorata (Squamata: Colubridae). Herpetology Notes 7: 83–84. Google Scholar Lescure J. 1975. Contribution à l'étude des amphibiens de Guyane Française. III. Une nouvelle espèce de Colosthetus [sic] (Dendrobatidae): Colosthetus [sic] degranvillei n. sp. Bulletin du Muséum National d'Histoire Naturelle, Paris. Série 3, Zoologie 293: 413–420. Google Scholar Lescure J., Marty C. 2000. Atlas des amphibiens de Guyane. Patrimoines Naturels 45: 1–388. Google Scholar Li J., Che J., Murphy R.W., Zhao H., Zhao E., Rao D., Zhang Y. 2009. New insights to the molecular phylogenetics and generic assessment in the Rhacophoridae (Amphibia: Anura) based on five nuclear and three mitochondrial genes, with comments on the evolution of reproduction. Molecular Phylogenetics and Evolution 53: 509–522. DOI Crossref, PubMed, Google Scholar Lichtenstein H. 1823. Verzeichniss der Doubletten des Zoologischen Museums der Königl. Universität Zu Berlin: Nebst Beschreibung vieler bisher unbekannter Arten von Säugethieren, Vögeln, Amphibien und Fischen. T. Trautwein, Berlin. DOI Google Scholar Lima A.P., Caldwell J.P. 2001. A new Amazonian species of Colostethus with sky blue digits. Herpetologica 57: 180–189. Google Scholar Lima A.P., Moreira G. 1993. Effects of prey size and foraging mode on the ontogenetic change in feeding niche of Colostethus stepheni (Anura: Dendrobatidae). Oecologia 95: 93–102. Crossref, PubMed, Google Scholar Lima A.P., Sánchez D.E. a., Souza J.R.D. 2007. A new Amazonian species of the frog genus Colostethus (Dendrobatidae) that lays its eggs on undersides of leaves. Copeia 2007: 114–122. DOI BioOne, Google Scholar Lima A.P., Caldwell J.P., Strussmann C. 2009. Redescription of Allobates brunneus (Cope) 1887 (Anura: Aromobatidae: Allobatinae), with a description of the tadpole, call, and reproductive behavior. Zootaxa 16: 1–16. Google Scholar Lima A.P., Erdtmann L.K., Amézquita A. 2012. Advertisement call and colour in life of Allobates crombei (Morales) “2000” [2002] (Anura: Aromobatidae) from the type locality (Cachoeira do Espelho), Xingu River, Brazil. Zootaxa 3475: 86–88. Google Scholar Lima A.P., Caldwell J.P., Biavati G.M., Montanarin A. 2010. A new species of Allobates (Anura: Aromobatidae) from Paleovarzea Forest in Amazonas, Brazil. Zootaxa 2337: 1–17. Google Scholar Lima N.G.S., Eterovick P.C. 2013. Natural history of Ameerega flavopicta (Dendrobatidae) on an Island formed by Três Marias hydroelectric reservoir in southeastern Brazil. Journal of Herpetology 47: 480–488. DOI BioOne, Google Scholar Lima A.P., Simões P.I., Kaefer I.L. 2014. A new species of Allobates (Anura: Aromobatidae) from the Tapajós River basin, Pará State, Brazil. Zootaxa 3889: 355–387. DOI Crossref, PubMed, Google Scholar Lima A.P., Simões P.I., Kaefer I.L. 2015. A new species of Allobates (Anura: Aromobatidae) from Parque Nacional da Amazônia, Pará State, Brazil. Zootaxa 3980: 501–525. DOI Crossref, PubMed, Google Scholar Linnaeus C. 1758. Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differential, synonymis, locis, Tomus I. Editio decima, reformata. Laurentiis Salvii, Holmiae. DOI Google Scholar Liu K., Raghavan S., Nelesen S.M., Linder C.R., Warnow T. 2009. Rapid and accurate large-scale coestimation of sequence alignments and phylogenetic trees. Science 324: 1561–1564. DOI Crossref, PubMed, Google Scholar Liu Y., Day L.B., Summers K., Burmeister S.S. 2016. Learning to learn: advanced behavioural flexibility in a poison frog. Animal Behaviour 111: 167–172. DOI Crossref, Google Scholar Loader S.P., Poynton J.C., Lawson L.P., Blackburn D.C., Menegon M. 2011. Herpetofauna of montane areas of Tanzania. 3. Amphibian diversity in the northwestern Eastern Arc Mountains, with the description of a new species of Arthroleptis (Anura: Arthroleptidae). Fieldiana Life and Earth Sciences 4: 90–102. DOI Link, Google Scholar Logan M.M., Toma T., Thomas-Tran R., Bois J. Du. 2016. Asymmetric synthesis of batrachotoxin: Enantiomeric toxins show functional divergence against NaV. Science 354: 865–869. DOI Crossref, PubMed, Google Scholar Lötters S., Debold P., Henle K., Glaw F., Kneller M. 1997a. Ein neuer Pfeilgiftfrosch aus der Epipedobates pictus-Gruppe vom Osthang der Cordillera Azul in Peru. Herpetofauna 19: 25–34. Google Scholar Lötters S., Castro-Herrera F., Köhler J., Richter R. 1997b. Notes on the distribution and color variation of poison frogs of the genus Phyllobates from western Colombia (Anura: Dendrobatidae). Revue Française d'Aquariologie, Herpétologie 24: 55–58. Google Scholar Lötters S., Jungfer K.-H., Widmer A. 2000. A new genus of aposematic poison frog (Amphibia: Anura: Dendrobatidae) from the upper Amazon basin, with notes on its reproductive behaviour and tadpole morphology. Jahreshefte der Gesellschaft für Naturkunde in Wurttemberg 156: 233–243. Google Scholar Lötters S., Morales V.R., Proy C. 2003a. Another new riparian dendrobatid frog species from the upper Amazon basin of Peru. Journal of Herpetology 37: 707–713. DOI BioOne, Google Scholar Lötters S., Reichle S., Jungfer K.-H. 2003b. Advertisement calls of Neotropical poison frogs (Amphibia: Dendrobatidae) of the genera Colostethus, Dendrobates and Epipedobates, with notes on dendrobatid call classification. Journal of Natural History 37: 1899–1911. DOI Crossref, Google Scholar Lötters S., Schmitz A., Reichle S. 2005. A new cryptic species of poison frog from the Bolivian Yungas (Anura: Dendrobatidae: Epidedobates). Herpetozoa 18: 115–124. Google Scholar Lötters S., Jungfer K.-H., Henkel F.W., Schmidt W. 2007. Poison Frogs. Edition Chimaira, Frankfurt. Google Scholar Lötters S., Schmitz A., Reichle S., Rödder D., Quennet V. 2009. Another case of cryptic diversity in poison frogs (Dendrobatidae: Ameerega)—description of a new species from Bolivia. Zootaxa 2028: 20–30. Google Scholar Luiz L.F., Leon Contrera A.F., Neckel-Oliveira S. 2015. Diet and tadpole transportation in the poison dart frog Ameerega trivittata. Herpetological Journal 25: 187–190. Google Scholar Lutz A. 1925. Batraciens du Brésil. Comptes Rendus et Mémoires Hebdomadaires des Séances de la Société de Biologie et des ses Filiales 2: 137–139. Google Scholar Lynch J.D. 1969. Program. Final PhD Examination. University of Kansas, Lawrence, Kansas. Google Scholar Lynch J.D. 1982. Two new species of poison-dart frogs (Colostethus) from Colombia. Herpetologica 38: 366–374. Google Scholar Maan M.E., Cummings M.E. 2008. Female preferences for aposematic signal components in a polymorphic poison frog. Evolution 62: 2334–2345. DOI BioOne, Google Scholar Machado D.J. 2016. YBYRÁ facilitates comparison of large phylogenetic trees. BMC Bioinformatics 16: 204. DOI Crossref, Google Scholar Mackintosh J.A. 2001. The antimicrobial properties of melanocytes, melanosomes and melanin and the evolution of black skin. Journal of Theoretical Biology 211: 101–13. DOI Crossref, PubMed, Google Scholar Maddison W.P., Maddison D.R. 2016. Mesquite: a modular system for evolutionary analysis, Version 3.04. Available from: http://mesquiteproject.org. Google Scholar Manamendra-Arachchi K., Pethiyagoda R. 2005. The Sri Lankan shrub-frogs of the genus Philautus Gistel, 1848 (Ranidae: Rhacophorinae), with description of 27 new species. The Raffles Bulletin of Zoology Supplement 163–303. Google Scholar Manzanilla Puppo J., La Marca E., Jowers M., Sánchez D., García-París M. 2005. Un nuevo Mannophryne (Amphibia: Anura: Dendrobatidae) del macizo del Turimiquire, Noreste de Venezuela. Herpetotropicos 2: 105–113. Google Scholar Manzanilla Puppo J., Jowers M.J., La Marca E., García-Paris M. 2007. Taxonomic reassessment of Mannophryne trinitatis (Anura: Dendrobatidae) with a description of a new species from Venezuela. Herpetological Journal 17: 31–42. Google Scholar Manzanilla J., La Marca E., García-París M. 2009. Phylogenetic patterns of diversification in a clade of Neotropical frogs (Anura: Aromobatidae: Mannophryne). Biological Journal of the Linnean Society 97: 185–199. DOI Crossref, Google Scholar Márquez R., Mejía-Vargas D., Palacios-Rodríguez P., Ramírez-Castañeda V., Amézquita A. 2017. A new species of Andinobates (Anura: Dendrobatidae) from the Urabá region of Colombia. Zootaxa 4290: 531–546. DOI Crossref, Google Scholar Martins M. 1989. Nova espécie de Colostethus da Amazonia central (Amphibia: Dendrobatidae). Revista Brasileira de Biologia 49: 1009–1012. Google Scholar Masche S., Zimmermann H., Pröhl H. 2010. Description and ecological observations of the tadpole of Ranitomeya variabilis (Anura: Dendrobatidae). South American Journal of Herpetology 5: 207–211. DOI BioOne, Google Scholar Matsui M., Mohamed M., Shimada T., Sudin A. 2007. Resurrection of Staurois parvus from S. tuberilinguis from Borneo (Amphibia, Ranidae). Zoológical Science 24: 101–106. DOI BioOne, Google Scholar McKeon C.S., Summers K. 2013. Predator driven reproductive behavior in a tropical frog. Evolutionary Ecology 27: 725–737. DOI Crossref, Google Scholar Mebs D., Jansen M., Köhler G., Pogoda W., Kauert G. 2010. Myrmecophagy and alkaloid sequestration in amphibians: a study on Ameerega picta (Dendrobatidae) and Elachistocleis sp. (Microhylidae) frogs. Salamandra 46: 11–15. Google Scholar Meegaskumbura M., Manamendra-Arachchi K. 2005. Description of eight new species of shrub-frogs (Ranidae: Rhacophorinae: Philautus) from Sri Lanka. The Raffles Bulletin of Zoology Supplement 305–338. Google Scholar Meegaskumbura M., Senevirathne G., Biju S.D., Garg S., Meegaskumbura S., Pethiyagoda R., … Schneider C.J. 2015. Patterns of reproductive-mode evolution in Old World tree frogs (Anura, Rhacophoridae). Zoológica Scripta 44: 509–522. DOI Crossref, Google Scholar Meinhardt D.J., Parmelee J.R. 1996. A new species of Colostethus (Anura: Dendrobatidae) from Venezuela. Herpetologica 52: 70–77. Google Scholar Melin D. 1941. Contributions to the knowledge of the Amphibia of South America. Goteborgs Kungl. Vetenskaps och Vittehets Samhalles Handlingar B 1: 1–71. Google Scholar Melo-Sampaio P.R., Souza M.B., Peloso P.L.V. 2013. A new, riparian, species of Allobates Zimmermann and Zimmermann, 1988 (Anura: Aromobatidae) from southwestern Amazonia. Zootaxa 3716: 336–348. DOI Crossref, PubMed, Google Scholar Mercadal de Barrio I.T., Barrio A. 1993. Una nueva especies de Proceratophrys (Leptodactylidae) del nordeste de Argentina. Amphibia-Reptilia 14: 13–18. DOI Crossref, Google Scholar Mertens R. 1927. Neue Froschlurche aus Rio Grande do Sul, Brasilien. Blätter für Aquarien- und Terrarienkunde 38: 287–290. Google Scholar Meuche I., Linsenmair K.E., Pröhl H. 2011. Female territoriality in the strawberry poison frog (Oophaga pumilio). Copeia 2011: 351–356. DOI BioOne, Google Scholar Mijares-Urrutia A., La Marca E. 1997. Tadpoles of the genus Nephelobates La Marca 1994 (Amphibia Anura Dendrobatidae), from Venezuela. Tropical Zoology 10: 133–142. DOI Crossref, Google Scholar Mijares-Urrutia A., Arends R.A. 1999a. Un nuevo Mannophryne (Anura: Dendrobatidae) del Estado Falcón, con comentarios sobre la conservacion del género en el noroeste de Venezuela. Carribean Journal of Science 35: 231–237. Google Scholar Mijares-Urrutia A., Arends R.A. 1999b. A new Mannophryne (Anura: Dendrobatidae) from western Venezuela, with comments on the generic allocation of Colostethus larandinus. Herpetologica 55: 106–114. Google Scholar Mijares-Urrutia A., La Marca E. 1997. Tadpoles of the genus Nephelobates La Marca 1994 (Amphibia Anura Dendrobatidae), from Venezuela. Tropical Zoology 10: 133–142. DOI Crossref, Google Scholar Mina A.E., Ponti A.K., Woodcraft N.L., Johnson E.E., Saporito R.A. 2015. Variation in alkaloid-based microbial defenses of the dendrobatid poison frog Oophaga pumilio. Chemoecology 25: 169–178. DOI Crossref, Google Scholar Miranda Ribeiro A. de. 1920. O genero Telmatobius já foi constatado no Brasil? Revista do Museu Paulista 12: 261–278. Google Scholar Miranda Ribeiro A. de. 1923. Os hylodideos do Museu Paulista. Revista do Museu Paulista 13: 825–846. Google Scholar Mivart S.G. 1869. On the classification of the anurous batrachians. Proceedings of the Zoológical Society of London 1869: 280–295. DOI Google Scholar Modak N., Dahanukar N., Gosavi N., Padhye A.D. 2015. Indirana salelkari, a new species of leaping frog (Anura: Ranixalidae) from Western Ghats of Goa, India. Journal of Threatened Taxa 7: 7493–7509. DOI Crossref, Google Scholar Montanarin A., Kaefer I.L., Lima A.P. 2011. Courtship and mating behaviour of the brilliant-thighed frog Allobates femoralis from central Amazonia: implications for the study of a species complex. Ethology Ecology & Evolution 23: 141–150. DOI Crossref, Google Scholar Morales V.R. 1992. Dos especies nuevas de Dendrobates (Anura: Dendrobatidae) para Perú. Caribbean Journal of Science 28: 191–199. Google Scholar Morales V.R. 1994. Taxonomia sobre algunos Colostethus (Anura: Dendrobatidae) de Sudamerica, con descripción de dos especies nuevas. Revista Española de Herpetologia 8: 95–103. Google Scholar Morales V.R. 2002. Sistemática y biogeografía del grupo trilineatus (Amphibia, Anura, Dendrobatidae, Colostethus), con descripción de once nuevas especies. Publicaciones de la Asociación de Amigos de Doñana 13: 1–59. Google Scholar Morales V.R., Schulte R. 1993. Dos especies nuevas de Colostethus (Anura, Dendrobatidae) en las vertientes de la Cordillera Oriental del Peru y del Ecuador. Alytes 11: 97–106. Google Scholar Moran L., Cardozo-Urdaneta A., Sánchez-Mercado A. 2016. Ampliación de la distribución de Mannophryne lamarcai Mijares-Urrutia & Arends, 1999 (Anura: Aromobatidae) en la Serranía de Ziruma, Estado Falcon, Venezuela. Cuadernos de Herpetología 30: 79–80. Google Scholar Mueses-Cisneros J.J., Cepeda-Quilindo B., Moreno-Quintero V. 2008. Una nueva especie de Epipedobates (Anura: Dendrobatidae) del suroccidente de Colombia. Papéis Avulsos de Zoologia 48: 1–10. DOI Google Scholar Müller L. 1923. Neue oder seltene Reptilien und Batrachier der zoologischen Sammlung des bayerischen Staates. Zoologischer Anzeiger 57: 38–42. Google Scholar Muñoz-Ortiz A., Velásquez-Álvarez Á.A., Guarnizo C.E., Crawford A.J. 2015. Of peaks and valleys: testing the roles of orogeny and habitat heterogeneity in driving allopatry in midelevation frogs (Aromobatidae: Rheobates) of the northern Andes. Journal of Biogeography 42: 193–205. DOI Crossref, Google Scholar Myers C.W. 1982. Spotted poison frogs: descriptions of three new Dendrobates from western Amazonia, and resurrection of a lost species from “Chiriqui.” American Museum Novitates 2721: 1–23. Google Scholar Myers C.W. 1987. New generic names for some neotropical poison frogs (Dendrobatidae). Papéis Avulsos de Zoologia 36: 301–306. Google Scholar Myers C.W. 1991. Distribution of the dendrobatid frog Colostethus Chocóensis and description of a related species occurring macrosympatrically. American Museum Novitates 3010: 1–15. Google Scholar Myers C.W., Burrowes P.A. 1987. A new poison frog (Dendrobates) from Andean Colombia, with notes on a lowland relative. American Museum Novitates 2899: 1–17. Google Scholar Myers C.W., Daly J.W. 1976a. Preliminary evaluation of skin toxins and vocalizations in taxonomic and evolutionary studies of poisondart frogs (Dendrobatidae). Bulletin of the American Museum of Natural History 157: 173–262. Google Scholar Myers C.W., Daly J.W. 1976b. A new species of poison frog (Dendrobates) from Andean Ecuador, including an analysis of its skin toxins. Occasional Papers of the Museum of Natural History, The University of Kansas 59: 1–12. Google Scholar Myers C.W., Daly J.W. 1979. A name for the poison frog of Cordillera Azul, eastern Peru, with notes on its biology and skin toxins (Dendrobatidae). American Museum Novitates 2674: 1–24. Google Scholar Myers C.W., Daly J.W. 1980. Taxonomy and ecology of Dendrobates bombetes, a new Andean poison frog with new skin toxins. American Museum Novitates 2692: 1–23. Google Scholar Myers C.W., Donnelly M.A. 1997. A tepui herpetofauna on a granitic mountain (Tamacuari) in the borderland between Venezuela and Brazil: Report from the Phipps Tapirapecó Exped. American Museum Novitates 3213: 1–71. Google Scholar Myers C.W., Donnelly M.A. 2001. Herpetofauna of the Yutajé-Corocoro massif, Venezuela: Second report from the Robert G. Goelet American Museum-Terramar Expedition to the northwestern tepuis. Bulletin of the American Museum of Natural History 261: 1–85. DOI BioOne, Google Scholar Myers C.W., Duellman W.E. 1982. A new species of Hyla from Cerro Colorado, and other tree frog records and geographical notes from western Panama. American Museum Novitates 2752: 1–32. Google Scholar Myers C.W., Grant T. 2009. Anomaloglossus confusus, a new Ecuadorian frog formerly masquerading as “Colostethus” Chocóensis (Dendrobatoidea: Aromobatidae). American Museum Novitates 3659: 1–12. BioOne, Google Scholar Myers C.W., Daly J.W., Malkin B. 1978. A dangerously toxic new frog (Phyllobates) used by Embera indians of western Colombia, with discussion of blowgun fabrication and dart poisoning. Bulletin of the American Museum of Natural History 161: 307–366. Google Scholar Myers C.W., Daly J.W., Martínez V. 1984. An arboreal poison frog (Dendrobates) from western Panama. American Museum Novitates 2783: 1–20. Google Scholar Myers C.W., Paolillo O.A., Daly J.W. 1991. Discovery of a defensively malodorous and nocturnal frog in the family Dendrobatidae: Phylogenetic significance of a new genus and species from the Venezuelan Andes. American Museum Novitates 3002: 1–33. Google Scholar Myers C.W., Rodríguez L.O., Icochea J. 1998. Epipedobates simulans, a new cryptic species of poison frog from southeastern Peru, with notes on E. macero and E. petersi (Dendrobatidae). American Museum Novitates 3238: 1–20. Google Scholar Myers C.W., Ibáñez D R., Grant T., Jaramillo C.A. 2012. Discovery of the frog genus Anomaloglossus in Panama, with descriptions of two new species from the Chagres Highlands (Dendrobatoidea: Aromobatidae). American Museum Novitates 3763: 1–20. DOI BioOne, Google Scholar Nabhan A.R., Sarkar I.N. 2012. The impact of taxon sampling on phylogenetic inference: a review of two decades of controversy. Briefings in Bioinformatics 13: 122–134. DOI Crossref, PubMed, Google Scholar Nair A., Gopalan S. V, George S., Kumar K.S., Teacher A.G.F., Merilä J. 2012. Endemic Indirana frogs of the Western Ghats biodiversity hotspot. Annales Zoologici Fennici 49: 257–286. Link, Google Scholar Nieden F. 1911. Verzeichnis der bei Amani in Deutschostafrika vorkommenden Reptilien und Amphibien. Sitzungsberichte der Gesellschaft Naturforschender Freunde zu Berlin 1910: 441–452. Google Scholar Nixon K.C. 1999. The parsimony ratchet, a new method for rapid parsimony analysis. Cladistics 15: 407–414. DOI Crossref, Google Scholar Noble G.K. 1921. Five new species of Salientia from South America. American Museum Novitates 29: 1–7. Google Scholar Noble G.K. 1923. New batrachians from the Tropical Research Station, British Guiana. Zoológica 3: 288–299. Google Scholar Noble G.K. 1926. The pectoral girdle of the brachycephalid frogs. American Museum Novitates 230: 1–14. Google Scholar Noble G.K. 1931. The Biology of the Amphibia. McGraw-Hill. DOI Google Scholar Noonan B.P., Comeault A.A. 2009. The role of predator selection on polymorphic aposematic poison frogs. Biology Letters 5: 51–54. DOI Crossref, PubMed, Google Scholar Nowakowski A.J., Otero Jiménez B., Allen M., Diaz-Escobar M., Donnelly M.A. 2013. Landscape resistance to movement of the poison frog, Oophaga pumilio, in the lowlands of northeastern Costa Rica. Animal Conservation 16: 188–197. DOI Crossref, Google Scholar Nowakowski A.J., Dewoody J.A., Fagan M.E., Willoughby J.R., Donnelly M.A. 2015. Mechanistic insights into landscape genetic structure of two tropical amphibians using field-derived resistance surfaces. Molecular Ecology 24: 580–595. DOI Crossref, PubMed, Google Scholar Ohler A., Dubois A. 2012. Validation of two familial nomina nuda of Amphibia Anura. Alytes 28: 162–167. Google Scholar Padhye A.D., Sayyed A., Jadhav A., Dahanukar N. 2013. Raorchestes ghatei, a new species of shrub frog (Anura: Rhacophoridae) from the Western Ghats of Maharashtra, India. Journal of Threatened Taxa 5: 4913–4931. DOI Crossref, Google Scholar Padhye A.D., Modak N., Dahanukar N. 2014. Indirana chiravasi, a new species of leaping frog (Anura: Ranixalidae) from Western Ghats of India. Journal of Threatened Taxa 6: 6293–6312. DOI Crossref, Google Scholar Padial J.M., De la Riva I. 2007. Taxonomy, the Cinderella of science, hidden by its evolutionary stepsister. Zootaxa 2: 1–2. Google Scholar Padial J.M., Grant T., Frost D.R. 2014. Molecular systematics of terraranas (Anura: Brachycephaloidea) with an assessment of the effects of alignment and optimality criteria. Zootaxa 3825: 1–132. DOI Crossref, PubMed, Google Scholar Páez-Vacas M.I., Coloma L.A., Santos J.C. 2010. Systematics of the Hyloxalus bocagei complex (Anura: Dendrobatidae), description of two new cryptic species, and recognition of H. maculosus. Zootaxa 75: 1–75. Google Scholar Paluh D.J., Hantak M.M., Saporito R.A. 2014. A test of aposematism in the dendrobatid poison frog Oophaga pumilio: the importance of movement in clay model experiments. Journal of Herpetology 48: 249–254. DOI BioOne, Google Scholar Paluh D.J., Kenison E.K., Saporito R. a. 2015. Frog or fruit? The importance of color and shape to bird predators in clay model experiments. Copeia 103: 58–63. DOI BioOne, Google Scholar Parker H.W. 1940. The Percy Sladen Trust Expedition to Lake Titicaca in 1937. XII. Amphibia. Transactions of the Linnean Society of London 1: 203–216. Crossref, Google Scholar Pašukonis A., Trenkwalder K., Ringler M., Ringler E., Mangione R., Steininger J., … Hödl W. 2016. The significance of spatial memory for water finding in a tadpole-transporting frog. Animal Behaviour 116: 89–98. DOI Crossref, PubMed, Google Scholar Pauly G.B., Hillis D.M., Cannatella D.C. 2004. The history of a Nearctic colonization: molecular phylogenetics and biogeography of the Nearctic toads (Bufo). Evolution 58: 2517–2535. DOI BioOne, Google Scholar Peloso P.L.V., Faivovich J., Grant T., Gasparini J.L., Haddad C.F.B. 2012. An extraordinary new species of Melanophryniscus (Anura, Bufonidae) from southeastern Brazil. American Museum Novitates 3762: 1–31. DOI BioOne, Google Scholar Pereyra M.O., Womack M.C., Barrionuevo J.S., Blotto B.L., Baldo D., Targino M., … Faivovich J. 2016. The complex evolutionary history of the tympanic middle ear in frogs and toads (Anura). Scientific Reports 6: 34130. DOI Crossref, PubMed, Google Scholar Pérez-Peña P.E., Chavez G., Twomey E., Brown J.L. 2010. Two new species of Ranitomeya (Anura: Dendrobatidae) from eastern Amazonian Peru. Zootaxa 23: 1–23. Google Scholar Peters W.C.H. 1872. Über die von Spix in Brasilien gesammelten Batrachier des Königl. Naturalienkabinets zu München. Monatsberichte der Königlichen Preussischen Akademie des Wissenschaften zu Berlin 1872: 196–227. Google Scholar Peters W.C.H. 1873. Über eine neue Schildkrötenart, Cinosternon Effeldtii und einige andere neue oder weniger bekannte Amphibien. Monatsberichte der Königlichen Preussischen Akademie des Wissenschaften zu Berlin 1873: 603–618. Google Scholar Pettitt B.A., Bourne G.R., Bee M.A. 2012. Quantitative acoustic analysis of the vocal repertoire of the golden rocket frog (Anomaloglossus beebei). The Journal of the Acoustical Society of America 131: 4811–20. DOI Crossref, PubMed, Google Scholar Pettitt B.A., Bourne G.R., Bee M.A. 2013. Advertisement call variation in the golden rocket frog (Anomaloglossus beebei): evidence for individual distinctiveness. Ethology 119: 244–256. DOI Crossref, Google Scholar Philippi R.A. 1902. Suplemento a Los Batraquios Chilenos Descritos En La Historia Física I Política de Chile de Don Claudio Gay. Libreria Alemana de Jose Ivens, Santiago de Chile. Google Scholar Pickett K.M., Randle C. 2005. Strange bayes indeed: uniform topological priors imply non-uniform clade priors. Molecular Phylogenetics and Evolution 34: 203–211. DOI Crossref, PubMed, Google Scholar Poelman E.H., Dicke M. 2007. Offering offspring as food to cannibals: oviposition strategies of Amazonian poison frogs (Dendrobates ventrimaculatus). Evolutionary Ecology 21: 215–227. Crossref, Google Scholar Poelman E.H., Dicke M. 2008. Space use of Amazonian poison frogs: testing the reproductive resource defense hypothesis. Journal of Herpetology 42: 270–278. DOI BioOne, Google Scholar Poelman E.H., Verkade J.C., Wijngaarden R.P.A. Van, Félix-novoa C. 2010. Descriptions of the tadpoles of two poison frogs, Ameerega parvula and Ameerega bilinguis (Anura: Dendrobatidae) from Ecuador. Journal of Herpetology 44: 409–417. DOI BioOne, Google Scholar Pombal Jr J.P., Feio R.N., Haddad C.F.B. 2002. A new species of torrent frog genus Hylodes (Anura: Leptodactylidae) from southeastern Brazil. Herpetologica 58: 462–471. DOI BioOne, Google Scholar Poynton J.C. 1963. Descriptions of southern African amphibians. Annals of the Natal Museum 15: 319–332. Google Scholar Prigioni C.M., Langone J.A. 2000. Una nueva especie de Melanophryniscus Gallardo, 1961, de Argentina y Paraguay (Amphibia, Anura, Bufonidae). Comunicaciones Zoológicas del Museo de Historia Natural de Montevideo 195: 1–12. Google Scholar Pyburn W.F. 1981. A new poison-dart frog (Anura: Dendrobatidae) from the forest of southeastern Colombia. Proceedings of the Biological Society of Washington 94: 67–75. Google Scholar Pyron R.A. 2014. Biogeographic analysis reveals ancient continental vicariance and recent oceanic dispersal in amphibians. Systematic Biology 63: 779–797. DOI Crossref, PubMed, Google Scholar Pyron R.A., Wiens J.J. 2011. A large-scale phylogeny of Amphibia including over 2,800 species, and a revised classification of extant frogs, salamanders, and caecilians. Molecular Phylogenetics and Evolution 61: 543–583. DOI Crossref, PubMed, Google Scholar Quiguango-Ubillús A., Coloma L.A. 2008. Notes on behaviour, communication and reproduction in captive Hyloxalus toachi (Anura: Dendrobatidae), an endangered Ecuadorian frog. International Zoo Yearbook 42: 78–89. DOI Crossref, Google Scholar Radhakrishnan C., Dinesh K.P., Ravichandran M.S. 2007. A new species of Nyctibatrachus Boulenger (Amphibia: Anura: Nyctibatrachidae) from the Eravikulam National Park, Kerala, India. Zootaxa 1595: 31–31. Google Scholar Rambaut A. 2016. FigTree, Version 1.4.3. Available from: http://tree.bio.ed.ac.uk/software/figtree. Google Scholar Randle C., Pickett K.M. 2010. The conflation of ignorance and knowledge in the inference of clade posteriors. Cladistics 25: 550–559. DOI Crossref, Google Scholar Reichenow A. 1874. Eine Sammlung Lurche und Kriechthiere von Westafrika. Archiv für Naturgeschichte. Archiv für Naturgeschichte. Berlin 40: 287–298. Crossref, Google Scholar Richards-Zawaki C.L., Cummings M.E. 2010. Intraspecific reproductive character displacement in a polymorphic poison dart frog, Dendrobates pumilio. Evolution 259–267. DOI PubMed, Google Scholar Richards-Zawacki C.L., Yeager J., Bart H.P.S. 2013. No evidence for differential survival or predation between sympatric color morphs of an aposematic poison frog. Evolutionary Ecology 27: 783–795. DOI Crossref, Google Scholar Ringler M., Ursprung E., Hödl W. 2009. Site fidelity and patterns of short- and long-term movement in the brilliant-thighed poison frog Allobates femoralis (Aromobatidae). Behavioral Ecology and Sociobiology 63: 1281–1293. DOI Crossref, Google Scholar Ringler E., Pašukonis A., Hödl W., Ringler M. 2013. Tadpole transport logistics in a Neotropical poison frog: indications for strategic planning and adaptive plasticity in anuran parental care. Frontiers in Zoology 10: 67. DOI Crossref, PubMed, Google Scholar Ringler E., Pašukonis A., Fitch W.T., Huber L., Hödl W., Ringler M. 2015. Flexible compensation of uniparental care: Female poison frogs take over when males disappear. Behavioral Ecology 26: 1219–1225. DOI Crossref, PubMed, Google Scholar Rivero J.A. 1961. Salientia of Venezuela. Bulletin of the Museum of Comparative Zoology 126: 1–207. Google Scholar Rivero J.A. 1971. Un nuevo e interesante Dendrobates (Amphibia, Salientia) del Cerro Yapacana de Venezuela. Kasmera 3: 390–397. Google Scholar Rivero J.A. 1980. Notas sobre los anfibios de Venezuela III. Nuevos Colostethus de los Andes venezolanos. Memoria de la Sociedad de Ciencias Naturales La Salle 38: 95–111. Google Scholar Rivero J.A. 1984. Una nueva especie de Colostethus (Amphibia, Dendrobatidae) de la Cordillera de la Costa, con anotaciones sobre otros Colostethus, de Venezuela. Brenesia 22: 51–56. Google Scholar Rivero J.A. 1991a. New Colostethus (Amphibia, Dendrobatidae) from South America. Breviora 493: 1–28. Google Scholar Rivero J.A. 1991b. New Ecuadorean [sic] Colostethus (Amphibia, Dendrobatidae) in the collection of National Museum of Natural History, Smithsonian Institution. Caribbean Journal of Science 27: 1–22. Google Scholar Rivero J.A., Granados-Díaz H. 1990. Nuevos Colostethus (Amphibia, Dendrobatidae) del Departamento de Cauca, Colombia. Caribbean Journal of Science 25: 148–152. Google Scholar Rivero J.A., Serna M.A. 1986. Dos nuevas especies de Colostethus (Amphibia, Dendrobatidae). Caldasia 15: 525–531. Google Scholar Rivero J.A., Serna M.A. 1991. Tres nuevas especies de Colostethus (Anphibia [sic], Dendrobatidae) de Colombia. Trianea 4: 481–495. Google Scholar Rivero J.A., Serna M.A. 2000. Nuevos Colostethus (Amphibia, Dendrobatidae) del Departamento de Antioquia, Colombia, con la descripción del renacuajo de Colostethus fraterdanieli. Revista de Ecología Latinoamericana 2: 45–58. Google Scholar Roberts J.L., Brown J.L., von May R., Arizabal W., Presar A., Symula R., … Summers K. 2006. Phylogenetic relationships among poison frogs of the genus Dendrobates (Dendrobatidae): a molecular perspective from increased taxon sampling. Herpetological Journal 16: 377–385. Google Scholar Rödel M.-O. 1995. Phrynobatrachus francisci im Comoé-Nationalpark, Elfenbeinküste: Lebensräume, Aktivität und Nahrung in der ausgehenden Trockenzeit. Salamandra 31: 79–92. Google Scholar Rodrigues P.C., Aguiar O., Serpieri F., Lima A.P., Uetanebaro M., Recco-Pimentel S.M. 2011. Chromosome analysis of five Brazilian species of poison frogs (Anura: Dendrobatidae). Journal of Genetics 90: 31–37. DOI Crossref, PubMed, Google Scholar Rodríguez L.O., Myers C.W. 1993. A new poison frog from Manu National Park, southeastern Peru (Dendrobatidae, Epipedobates). American Museum Novitates 3068: 1–15. Google Scholar Rojas-Runjaic F.J.M., Infante-Rivero E.E., Barrio-Amorós C.L. 2011. A new frog of the genus Aromobates (Anura, Dendrobatidae) from Sierra de Perija, Venezuela. Zootaxa 2919: 37–50. Google Scholar Rojas B. 2014. Strange parental decisions: fathers of the dyeing poison frog deposit their tadpoles in pools occupied by large cannibals. Behavioral Ecology and Sociobiology 68: 551–559. DOI Crossref, Google Scholar Rojas D., Stow A., Amézquita A., Simões P.I., Lima A.P. 2015. No predatory bias with respect to colour familiarity for the aposematic Adelphobates galactonotus (Anura: Dendrobatidae). Behaviour 152: 1–21. DOI Crossref, Google Scholar Rueda-Almonacid J.V., Rada M., Sánchez-Pacheco S.J., VelásquezÁlvarez Á.A., Quevedo A. 2006. Two new and exceptional poison dart frogs of the genus Dendrobates (Anura: Dendrobatidae) from the Northeastern Flank of the cordillera Central of Colombia. Zootaxa 54: 39–54. Google Scholar Ruiz-Carranza P.M., Ramírez-Pinilla M.P. 1992. Una nueva especie de Minyobates (Anura: Dendrobatidae) de Colombia. Lozania 61: 1–16. Google Scholar Ruthven A.G., Gaige H.T. 1915. The breeding habits of Prostherapis subpunctatus Cope. Occasional Papers of the Museum of Zoology, University of Michigan 10: 1–5. Google Scholar Sá F.P., Canedo C., Lyra M.L., Haddad C.F.B. 2015. A new species of Hylodes (Anura, Hylodidae) and its secretive underwater breeding behavior. Herpetologica 71: 58–71. DOI BioOne, Google Scholar Sabagh L.T., Mello R.D.S., Rocha C.F.D. 2012. Food niche overlap between two sympatric leaf-litter frog species from Central Amazonia. Zoologia 29: 95–98. DOI Crossref, Google Scholar Sánchez D.A. 2013. Larval morphology of dart-poison frogs (Anura: Dendrobatoidea: Aromobatidae and Dendrobatidae). Zootaxa 3637: 569–591. DOI PubMed, Google Scholar Sankoff D. 1975. Minimal mutation trees of sequences. SIAM Journal on Applied Mathematics 28: 35–42. DOI Crossref, Google Scholar Sankoff D., Rousseau P. 1975. Locating the vertices of a Steiner tree in an arbitrary metric space. Mathematical Programming 9: 240–246. Crossref, Google Scholar Santos J.C., Cannatella D.C. 2011. Phenotypic integration emerges from aposematism and scale in poison frogs. Proceedings of the National Academy of Sciences USA 108: 6175–6180. DOI Crossref, PubMed, Google Scholar Santos J.C., Coloma L.A., Cannatella D.C. 2003. Multiple, recurring origins of aposematism and diet specialization in poison frogs. Proceedings of the National Academy of Sciences USA 100: 21335–21100. DOI Crossref, Google Scholar Santos J.C., Coloma L.A., Summers K., Caldwell J.P., Ree R., Cannatella D.C. 2009. Amazonian amphibian diversity is primarily derived from Late Miocene Andean lineages. PLOS Biology 7: 1–14. DOI Crossref, Google Scholar Santos J.C., Baquero M., Barrio-Amorós C., Coloma L.A., Erdtmann L.K., Lima A.P., Cannatella D.C. 2014. Aposematism increases acoustic diversification and speciation in poison frogs. Proceedings of the Royal Society B: Biological Sciences 281: 20141761. DOI Crossref, PubMed, Google Scholar Saporito R.A., Donnelly M.A., Garraffo H.M., Spande T.F., Daly J.W. 2006. Geographic and seasonal variation in alkaloid-based chemical defenses of Dendrobates pumilio from Bocas del Toro, Panama. Journal of Chemical Ecology 32: 795–814. DOI Crossref, PubMed, Google Scholar Saporito R.A., Donnelly M.A., Jain P., Garraffo H.M., Spande T.F., Daly J.W. 2007a. Spatial and temporal patterns of alkaloid variation in the poison frog Oophaga pumilio in Costa Rica and Panama over 30 years. Toxicon 50: 757–778. DOI Crossref, PubMed, Google Scholar Saporito R.A., Donnelly M.A., Norton R.A., Garraffo H.M., Spande T.F., Daly J.W. 2007b. Oribatid mites as a major dietary source for alkaloids in poison frogs. Proceedings of the National Academy of Sciences USA 104: 8885–8890. DOI Crossref, PubMed, Google Scholar Saporito R.A., Zuercher R., Roberts M., Gerow K.G., Donnelly M.A. 2007c. Experimental evidence for aposematism in the dendrobatid poison frog Oophaga pumilio. Copeia 2007: 1006–1011. BioOne, Google Scholar Saporito R.A., Spande T.F., Garraffo H.M., Donnelly M.A. 2009. Arthropod alkaloids in poison frogs: A review of the “dietary hypothesis.” Heterocycles 79: 277–297. DOI. Crossref, Google Scholar Saporito R.A., Isola M., Maccachero V.C., Condon K., Donnelly M.A. 2010. Ontogenetic scaling of poison glands in a dendrobatid poison frog. Journal of Zoology 1–8. DOI Google Scholar Savage J.M. 1968. The dendrobatid frogs of Central America. Copeia 1968: 745–776. Crossref, Google Scholar Savage J.M., Heyer W.R. 1967. Variation and distribution in the treefrog genus Phyllomedusa in Costa Rica, Central America. Beiträge zur Neotropischen Fauna 5: 111–131. Crossref, Google Scholar Savage J.M., Heyer W.R. 1997. Digital webbing formulae for anurans: A refinement. Herpetological Review 28: 131. Google Scholar Savage J.M., Myers C.W., Frost D.R., Grant T. 2007. Dendrobatidae Cope, 1865 (1850) (Amphibia, Anura): proposed conservation. Bulletin of Zoológical Nomenclature 64: 255–260. Google Scholar Schick S., Zimkus B.M., Channing A., Köhler J., Lötters S. 2010. Systematics of ‘little brown frogs’ from East Africa: recognition of Phrynobatrachus scheffleri and description of a new species from the Kakamega Forest, Kenya (Amphibia: Phrynobatrachidae). Salamandra 46: 24–36. Google Scholar Schmidt O. 1857. Diagnosen neuer Frosche des zoologischen Cabinets zu Krakau. Sitzungsberichte der Kaiserlichen Akademie der Wissenschaften, Mathematisch-Naturwissenschaftliche Classe 24: 10–15. Google Scholar Schneider J.G. 1799. Historiae Amphibiorum Naturalis et Literariae, Fasciculus Crimus Continens Ranas, Calamitas, Bufones, Salamandras et Hydros. Friedrich Frommann, Jena. Google Scholar Schulte L.M. 2014. Feeding or avoiding? Facultative egg feeding in a Peruvian poison frog (Ranitomeya variabilis). Ethology Ecology & Evolution 26: 58–68. DOI Crossref, Google Scholar Schulte L.M., Lötters S. 2014. A danger foreseen is a danger avoided: How chemical cues of different tadpoles influence parental decisions of a Neotropical poison frog. Animal Cognition 17: 267–275. DOI Crossref, PubMed, Google Scholar Schulte R. 1986. Eine neue Dendrobates-Art aus Ostperu (Amphibia: Salientia: Dendrobatidae). Sauria 8: 11–20. Google Scholar Schulte R. 1989. Nueva especie de rana venenosa del genero Epipedobates registrada en la Cordillera Oriental, departamento de San Martin. Boletin de Lima 63: 41–46. Google Scholar Schulte R. 1990. Redescubrimiento y redefinición de Dendrobates mysteriosus (Myers 1982) de la Cordillera del Cóndor. Boletin de Lima 70: 57–68. Google Scholar Schulte R. 1999. Pfeilgiftfrösche. Arteneil Peru. INIBICO, Waiblingen. Google Scholar Scott E. 2005. A phylogeny of ranid frogs (Anura: Ranoidea: Ranidae), based on a simultaneous analysis of morphological and molecular data. Cladistics 21: 507–574. DOI Crossref, Google Scholar Serrano-Rojas S.J., Whitworth A., Villacampa J., von May R., Gutiérrez R.C., Padial J.M., Chaparro J.C. 2017. A new species of poison-dart frog (Anura: Dendrobatidae) from Manu province, Amazon region of southeastern Peru, with notes on its natural history, bioacoustics, phylogenetics, and recommended conservation status. Zootaxa 4221: 71–94. DOI Crossref, Google Scholar Seshadri K.S., Gururaja K.V., Aravind N.A. 2012. A new species of Raorchestes (Amphibia: Anura: Rhacophoridae) from mid-elevation evergreen forests of the southern Western Ghats, India. Zootaxa 3410: 19–34. DOI Google Scholar Shreve B. 1935. On a new teiid and Amphibia from Panama, Ecuador, and Paraguay. Occasional Papers of the Boston Society of Natural History 8: 209–218. DOI Google Scholar Silva H.R., Benmaman P. 2008. Uma nova especie de Hylodes Fitzinger da Serra da Mantiqueira, Minas Gerais, Brasil (Anura: Hylodidae). Revista Brasileira de Zoologia 25: 89–99. Crossref, Google Scholar Silverstone P.A. 1971. Status of certain frogs of the genus Colostethus, with descriptions of new species. Los Angeles County Museum Contributions in Science 215: 1–8. Google Scholar Silverstone P.A. 1975a. A revision of the poison-arrow frogs of the genus Dendrobates Wagler. Natural History Museum of Los Angeles County Science Bulletin 21: 1–55. Google Scholar Silverstone P.A. 1975b. Two new species of Colostethus (Amphibia: Anura: Dendrobatidae) from Colombia. Los Angeles County Museum Contributions in Science 268: 1–10. Google Scholar Silverstone P.A. 1976. A revision of the poison-arrow frogs of the genus Phyllobates Bibron in Sagra (family Dendrobatidae). Natural History Museum of Los Angeles County Science Bulletin 27: 1–53. Google Scholar Simmons M.P. 2012a. Radical instability and spurious branch support by likelihood when applied to matrices with non-random distributions of missing data. Molecular Phylogenetics and Evolution 62: 472–84. DOI Crossref, PubMed, Google Scholar Simmons M.P. 2012b. Misleading results of likelihood-based phylogenetic analyses in the presence of missing data. Cladistics 28: 208–222. DOI Crossref, Google Scholar Simmons M.P., Goloboff P.A. 2013. An artifact caused by undersampling optimal trees in supermatrix analyses of locally sampled characters. Molecular Phylogenetics and Evolution 69: 265–275. DOI Crossref, PubMed, Google Scholar Simmons M.P., Norton A.P. 2013. Quantification and relative severity of inflated branch-support values generated by alternative methods: an empirical example. Molecular Phylogenetics and Evolution 67: 277–296. DOI Crossref, PubMed, Google Scholar Simões P.I. 2016. A new species of nurse-frog (Aromobatidae, Allobates) from the Madeira River basin with a small geographic range. Zootaxa 4083: 501–525. DOI Crossref, PubMed, Google Scholar Simões P.I., Lima A.P. 2012. The tadpole of Allobates sumtuosus (Morales, ‘2000’ 2002) (Anura: Aromobatidae) from its type locality at Reserva Biológica do Rio Trombetas, Pará, Brazil. Zootaxa 3499: 86–88. Google Scholar Simões P.I., Lima A.P., Farias I.P. 2010. The description of a cryptic species related to the pan-Amazonian frog Allobates femoralis (Boulenger 1883) (Anura: Aromobatidae). Zootaxa 28: 1–28. Google Scholar Simões P.I., Kaefer I.L., Farias I.P., Lima A.P. 2013a. An integrative appraisal of the diagnosis and distribution of Allobates sumtuosus (Morales, 2002) (Anura, Aromobatidae). Zootaxa 3746: 401–421. DOI Crossref, PubMed, Google Scholar Simões P.I., Sturaro M.J., Peloso P.L.V., Lima A.P. 2013b. A new diminutive species of Allobates Zimmermann and Zimmermann, 1988 (Anura, Aromobatidae) from the northwestern Rio Madeira-Rio Tapajos interfluve, Amazonas, Brazil. Zootaxa 3609: 251–273. DOI Crossref, PubMed, Google Scholar Smith A. 1849. Illustrations of the Zoology of South Africa, Vol. III, Appendix. Smith, Elder and Co., London. Google Scholar Smith H.M., Grant C. 1958. The proper names for some Cuban snakes: an analysis of dates of publication of Ramon de la Sagra's Historia Natural de Cuba, and of Fitzinger's Systema Reptilium. Herpetologica 14: 215–222. Google Scholar Solano F. 2014. Melanins: skin pigments and much more-types, structural models, biological functions, and formation routes. New Journal of Science 2014: 1–28. DOI Crossref, Google Scholar Spix J.B.v. 1824. Animalia nova sive species novae lacertarum quas in itinere per Brasiliam antis MDCCCXVIIMDCCCXX jussu et auspicius Maximiliani Josephi I Bavariae Regis suscepto collegit et descripsit Dr. J.B. de Spix. Typis Franc. Seraph. Hubschmanni, Monachii. DOI Google Scholar Steel M., Pickett K.M. 2006. On the impossibility of uniform priors on clades. Molecular Phylogenetics and Evolution 39: 585–586. DOI Crossref, PubMed, Google Scholar Steindachner F. 1863. Uber einige neue Batrachier aus den Sammlungen des Wiener Museums. Sitzungsberichte der Kaiserlichen Akademie der Wissenschaften, Mathematisch-Naturwissenschaftliche Classe 48: 186–192. Google Scholar Steindachner F. 1864. Batrachologische Mittheilungen. Verhandlungen des Zoologisch-Botanischen Vereins in Wien 14: 239–288. Google Scholar Steindachner F. 1867. Reise der österreichischen Fregatte Novara um die Erde in den Jahren 1857, 1858, 1859 unter den Bafehlen des Commodore B. von Wullerstorf-Urbair. Zologischer Theil. Erster Band. Amphibien. K.K. Hof- und Staatsdruckerei, Wien. DOI Google Scholar Stuart S.N., Chanson J.S., Cox N.A., Young B.E., Rodrigues A.S.L., Fischman D.L., Waller R.W. 2004. Status and trends of amphibian declines and extinctions worldwide. Science 306: 1783–1786. DOI Crossref, PubMed, Google Scholar Stuckert A.M.M., Venegas P.J., Summers K. 2013. Experimental evidence for predator learning and Mullerian mimicry in Peruvian poison frogs (Ranitomeya, Dendrobatidae). Evolutionary Ecology 413–426. DOI Google Scholar Stuckert A.M.M., Saporito R.A., Venegas P.J., Summers K. 2014. Alkaloid defenses of co-mimics in a putative Müllerian mimetic radiation. BMC Evolutionary Biology 14: 76. DOI Crossref, PubMed, Google Scholar Stynoski J.L. 2009. Discrimination of offspring by indirect recognition in an egg-feeding dendrobatid frog, Oophaga pumilio. Animal Behaviour 78: 1351–1356. DOI Crossref, Google Scholar Stynoski J.L., Noble V.R. 2011. To beg or to freeze: multimodal sensory integration directs behavior in a tadpole. Behavioral Ecology and Sociobiology 66: 191–199. DOI Crossref, Google Scholar Stynoski J.L., Torres-Mendoza Y., Sasa-Marin M., Saporito R.A. 2014. Evidence of maternal provisioning of alkaloid-based chemical defenses in the strawberry poison frog Oophaga pumilio. Ecology 95: 587–593. Crossref, PubMed, Google Scholar Summers K. 2014. Sexual conflict and deception in poison frogs. Current Zoology 60: 37–42. Crossref, Google Scholar Tarvin R.D., Santos J.C., O'Connell L.A., Zakon H.H., Cannatella D.C. 2016. Convergent substitutions in a sodium channel suggest multiple origins of toxin resistance in poison frogs. Molecular Biology and Evolution 33: 1068–1081. DOI Crossref, PubMed, Google Scholar Tarvin R.D., Powell E.A., Santos J.C., Ron S.R., Cannatella D.C. 2017. The birth of aposematism: High phenotypic divergence and low genetic diversity in a young clade of poison frogs. Molecular Phylogenetics and Evolution 109: 283–295. DOI Crossref, PubMed, Google Scholar Taylor E.H. 1958. Additions to the known herpetological fauna of Costa Rica with comments on other species. No. III. The University of Kansas Science Bulletin 39: 3–40. Google Scholar Thibaudeau G., Altig R. 1999. Endotrophic anurans: development and evolution. Pp. 170–188, in McDiarmid R.W., Altig R. (Eds.), The Biology of Anuran Larvae. University of Chicago Press, Chicago. Google Scholar Tschudi J.J. von. 1838. Classification der Batrachier mit Berucksichtigung der fossilen Thiere dieser Abtheilung der Reptilien. Petitpierre, Neuchatel. Google Scholar Tsuji-Nishikido B.M., Kaefer I.L., Freitas F.C. De, Menin M., Lima A.P. 2012. Significant but not diagnostic: differentiation through morphology and calls in the Amazonian frogs Allobates nidicola and masniger. Herpetological Journal 22: 105–114. Google Scholar Tumulty J., Morales V.R., Summers K. 2014. The biparental care hypothesis for the evolution of monogamy: Experimental evidence in an amphibian. Behavioral Ecology 25: 262–270. DOI Crossref, Google Scholar Twomey E., Brown J.L. 2008a. Spotted poison frogs: rediscovery of a lost species and a new genus (Anura: Dendrobatidae) from northwestern Peru. Herpetologica 64: 121–137. BioOne, Google Scholar Twomey E., Brown J.L. 2008b. A partial revision of the Ameerega hahneli complex (Anura: Dendrobatidae) and a new cryptic species from the east-Andean versant of central Peru. Zootaxa 1757: 46–65. Google Scholar Twomey E., Brown J.L. 2009. Another new species of Ranitomeya (Anura: Dendrobatidae) from Amazonian Colombia. Zootaxa 2302: 48–60. Google Scholar Twomey E., Morales V.R., Summers K. 2008. The effect of kinship on intraspecific competition in larvae of the poison frog Ameerega bassleri (Anura, Dendrobatidae). Phyllomedusa 7: 121–126. DOI Crossref, Google Scholar Twomey E., Brown J.L., Amézquita A., Mejía-Vargas D. 2011. Andinobates Twomey, Brown, Amézquita & Mejia-Vargas, gen. nov. in Brown J.L., Twomey E., Amézquita A., Souza M.B. de, Caldwell J.P., Lötters S., … Summers K. Zootaxa 3083: 1–120. Google Scholar Vacher J.-P., Fouquet A., Holota H., Thébaud C. 2016. The complete mitochondrial genome of Anomaloglossus baeobatrachus (Amphibia: Anura: Aromobatidae). Mitochondrial DNA Part B 1: 338–340. DOI Crossref, Google Scholar Valderrama-Vernaza M., Ramírez-Pinilla M.P., Serrano-Cardozo V.H. 2009. Diet of the Andean frog Ranitomeya virolinensis (Athesphatanura: Dendrobatidae). Journal of Herpetology 43: 114–123. DOI BioOne, Google Scholar Van Bocxlaer I., Loader S.P., Roelants K., Biju S.D., Menegon M., Bossuyt F. 2010. Gradual adaptation toward a range-expansion phenotype initiated the global radiation of toads. Science 327: 679–682. DOI Crossref, PubMed, Google Scholar Vargas Galarce J.Y., La Marca E. 2007. A new species of collared frog (Amphibia: Anura: Aromobatidae: Mannophryne) from the Andes of Trujillo State, Venezuela. Herpetotropicos 3: 51–57. Google Scholar Varón A., Wheeler W.C. 2012. The tree alignment problem. BMC Bioinformatics 13: 293. DOI Crossref, PubMed, Google Scholar Varón A., Wheeler W.C. 2013. Local search for the generalized tree alignment. BMC Bioinformatics 14: 66. DOI Crossref, PubMed, Google Scholar Vaz-Silva W., Maciel N.M. 2011. A new cryptic species of Ameerega (Anura: Dendrobatidae) from Brazilian Cerrado. Zootaxa 68: 57–68. Google Scholar Veiga-Menoncello A.C.P., Lima A.P., Recco-Pimentel S.M. 2003a. Cytogenetic analysis of four central Amazonian species of Colostethus (Anura - Dendrobatidae) with a diploid complement of 22 chromosomes. Hereditas 139: 189–198. DOI Crossref, PubMed, Google Scholar Veiga-Menoncello A.C.P., Lima A.P., Recco-Pimentel S.M. 2003b. Cytogenetics of two central Amazonian species of Colostethus (Anura, Dendrobatidae) with nidicolous tadpoles. Caryologia 56: 253–260. DOI Crossref, Google Scholar Vellard J. 1948. Batracios del Chaco Argentino. Acta Zoológica Lilloana 5: 137–174. Google Scholar Vences M., Glaw F., Zapp C. 1999. Stomach content analysis in Malagasy frogs of the genera Tomopterna, Aglyptodactylus, Boophis, and Mantidactylus (Anura: Ranidae). Herpetozoa 11: 109–116. Google Scholar Vences M., Kosuch J., Haddad C.F.B., La Marca E., Lötters S., Veith M. 2003. Convergent evolution of aposematic coloration in Neotropical poison frogs: a molecular phylogenetic perspective. Organisms Diversity and Evolution 3: 215–226. DOI Crossref, Google Scholar Verdade V.K., Rodrigues M.T. 2003. A new species of Cycloramphus (Anura, Leptodactylidae) from the Atlantic Forest, Brazil. Herpetologica 59: 513–518. DOI BioOne, Google Scholar Verdade V.K., Rodrigues M.T. 2007. Taxonomic review of Allobates (Anura, Aromobatidae) from the Atlantic Forest, Brazil. Journal of Herpetology 41: 566–580. DOI BioOne, Google Scholar Vigle G.O., Miyata K. 1980. A new species of Dendrobates (Anura: Dendrobatidae) from the lowland rain forests of western Ecuador. Breviora 459: 1–7. Google Scholar Vijayakumar S.P., Dinesh K.P., Prabhu M.V., Shanker K. 2014. Lineage delimitation and description of nine new species of bush frogs (Anura: Raorchestes, Rhacophoridae) from the Western Ghats Escarpment. Zootaxa 3893: 451–488. DOI Crossref, PubMed, Google Scholar von May R., Medina-Müller M., Donnelly M.A., Summers K. 2008. The tadpole of the bamboo-breeding poison frog Ranitomeya biolat (Anura: Dendrobatidae). Zootaxa 1857: 66–68. Google Scholar von May R., Medina-Müller M., Donnelly M.A., Summers K. 2009. Breeding-site selection by the poison frog Ranitomeya biolat in Amazonian bamboo forests: an experimental approach. Canadian Journal of Zoology 87: 453–4j63. DOI Crossref, Google Scholar Wagler J.G. 1830. Natürliches System der Amphibien: mit vorangehender Classification der Säugethiere und Vögel: ein Beitrag zur vergleichenden Zoologie. J.G. Cotta'scchen Buchhandlung, Munchen, Stuttgart und Tübingen. DOI Google Scholar Weber L.N., Verdade V.K., Oliveira R.D.E., Salles L., Fouquet A., Carvalho-e-Silva S.P. 2011. A new species of Cycloramphus Tschudi (Anura: Cycloramphidae) from the Parque Nacional da Serra dos Órgãos, Southeastern Brazil. Zootaxa 2737: 19–33. Google Scholar Weldon P.J. 2017. Poison frogs, defensive alkaloids, and sleepless mice: critique of a toxicity bioassay. Chemoecology 27(4): 123–126. DOI Crossref, Google Scholar Wells K.D. 1980. Evidence for growth of tadpoles during parental transport in Colostethus inguinalis. Journal of Herpetology 14: 428–430. DOI Crossref, Google Scholar Werner F. 1896. Beiträge zur Kenntniss der Reptilien und Batrachier von Centralamerika und Chile, sowie einiger seltenerer Schlangenarten. Verhandlungen des Zoologisch-Botanischen Vereins in Wien 46: 344–365. Google Scholar Werner F. 1899. Ueber Reptilien und Batrachier aus Columbien und Trinidad. Verhandlungen des ZoologischBotanischen Vereins in Wien 49: 470–484. Crossref, Google Scholar Weyenbergh H. 1875. Apuntes pequeños. Periódico Zoológico 1: 331–333. Google Scholar Wheeler W.C. 1996. Optimization alignment: the end of multiple sequence alignment in phylogenetics? Cladistics 12: 1–9. DOI Crossref, Google Scholar Wheeler W.C. 2003a. Iterative pass optimization of sequence data. Cladistics 19: 254–260. DOI Crossref, PubMed, Google Scholar Wheeler W.C. 2003b. Implied alignment: a synapomorphy-based multiple sequence alignment method. Cladistics 19: 261–268. DOI Crossref, PubMed, Google Scholar Wheeler W.C., Gladstein D.S. 1994. MALIGN: A multiple sequence alignment program. Journal of Heredity 85: 417–418. DOI Crossref, Google Scholar Wheeler W.C., Aagesen L., Arango C.P., Faivovich J., Grant T., D'Haese C.A., … Giribet G. 2006. Dynamic Homology and Phylogenetic Systematics: A Unified Approach Using POY. American Museum of Natural History, New York. Google Scholar Wheeler W.C., Lucaroni N., Hong L., Crowley L.M., Varón A. 2015. POY version 5: phylogenetic analysis using dynamic homologies under multiple optimality criteria. Cladistics 31: 189–196. DOI Crossref, Google Scholar Wickramasinghe L.J.M., Bandara I.N., Vidanapathirana D.R., Tennakoon K.H., Samarakoon S.R., Wickramasinghe N. 2015. Pseudophilautus dilmah, a new species of shrub frog (Amphibia: Anura: Rhacophoridae) from a threatened habitat Loolkandura in Sri Lanka. Journal of Threatened Taxa 7: 7089–7110. DOI Crossref, Google Scholar Wickramasinghe L.J.M., Vidanapathirana D.R., Rajeev M.D.G., Ariyarathne S.C., Chanaka A.W.A., … Wickramasinghe N. 2013. Eight new species of Pseudophilautus (Amphibia: Anura: Rhacophoridae) from Sripada World Heritage Site (Peak Wilderness), a local amphibian hotspot in Sri Lanka. Journal of Threatened Taxa 5: 3789–3920. DOI Crossref, Google Scholar Wilson K., Cotter S.C., Reeson a F., Pell J.K., Cotteer S.C. 2001. Melanism and disease resistance in insects. Ecology letters 4: 637–649. DOI Crossref, Google Scholar Wiens J.J. 2007. Book review: The Amphibian Tree of Life. Bulletin of the American Museum of Natural History, Number 297 82: 55–56. DOI Google Scholar Wiens J.J., Sukumaran J., Pyron R.A., Brown R.M. 2009. Evolutionary and biogeographic origins of high tropical diversity in old world frogs (Ranidae). Evolution 63: 1217–31. DOI BioOne, Google Scholar Wollenberg K.C., Veith M., Noonan B.P., Lötters S., Quattro J.M. 2006. Polymorphism versus species richness —systematics of large Dendrobates from the eastern Guiana Shield (Amphibia: Dendrobatidae). Copeia 2006: 623–629. DOI BioOne, Google Scholar Wong S., Parada H., Narins P.M. 2009. Heterospecific acoustic interference: effects on calling in the frog Oophaga pumilio in Nicaragua. Biotropica 41: 74–80. DOI Crossref, PubMed, Google Scholar Yang D.-T . 1983. A new species of the genus Platymantis (Amphibia: Ranidae). Acta Herpetologica Sinica/Liangqi baxing dongwu yanjiu. New Series. Chengdu 2: 53–56. Google Scholar Young B.E., Lips K.R., Reaser J.K., Ibáñez D R., Salas A.W., Cedeño J.R., … Romo D. 2001. Population declines and priorities for amphibian conservation in Latin America. Conservation Biology 15: 1213–1223. DOI Crossref, Google Scholar Yu G., Rao D., Zhang M., Yang J. 2009. Re-examination of the phylogeny of Rhacophoridae (Anura) based on mitochondrial and nuclear DNA. Molecular Phylogenetics and Evolution 50: 571–579. DOI Crossref, PubMed, Google Scholar Yústiz E. 1991. Un nuevo Colostethus (Amphibia: Dendrobatidae) en la Sierra de Barbacoas, Estado Lara, Venezuela. Bioagro 3: 145–148. Google Scholar Zachariah A., Cyriac V.P., Chandramohan B., Ansil B.R., Mathew J.K., Raju D. V, Abraham R.K. 2016. Two new species of Raorchestes (Anura: Rhacophoridae) from the Silent Valley National Park in the Nilgiri Hills of the Western Ghats, India. Salamandra 52: 63–76. Google Scholar Zimmermann H. 1989. Conservation studies on the ‘dart-poison’ frogs. International Zoo Yearbook 28: 31–38. DOI Crossref, Google Scholar Zimmermann H., Zimmermann E. 1988. Etho-Taxonomie und zoogeographische artengruppenbildung bei pfeilgiftfröschen (Anura: Dendrobatidae). Salamandra 24: 125–160. Google Scholar 1 Barrio-Amorós et al. (2010a: 47) included Anomaloglossus praderioi (La Marca, 1997) and A. roraima (La Marca, 1997) among the species for which Grant et al. (2006) “assumed the occurrence of an MLP”; however, Grant et al. (2006) figured the MLP of A. praderioi (p. 92, fig. 57) and stated explicitly that it was present in A. roraima (p. 121). 2 The excluded portion of the sequence is: CCCCTTAAAAACCCCTCCC AATAAAGGGCCCCCCCCCCGGATTTTCGGCCGGGTATAACCGGGG GGGGGGAAAACTTTTTAAGGAATGAAGCCCCCGGGGCCCGTTCC TTTTTTACCATGGAACTTATCTCCCGGAGAGCGG. 3 Grant et al. (2006: 166) incorrectly stated that Santos et al. (2003) had not provided locality data for the DNA sequence data they reported for Colostethus fugax. Although locality data were not included in the primary text of Santos et al. (2003), they were provided in supplementary online material. 4 Although Dubois (2017: 12) recently reported that “Cope (1866[a]: 130) erected the genus Colostethus for a single new species, […] Colostethus latinasus” (see also Dubois, 2017: 6), Cope explicitly identified Phyllobates latinasus Cope, 1863 as the type species of Colostethus. 5 Lötters et al. (2007) refrained from referring Ameerega andina and A. erythromos to either species group, and herein we refer these species to the newly resurrected genus Paruwrobates. The remaining species of Ameerega, A. labialis, was considered a nomen dubium referable to either Ameerega or Allobates. 6 Contrary to Dubois's (2017: 21) assertion, “most previous authors” have not credited Phyllobates to Dumeril and Bibron (1841) and instead correctly attributed the name to Bibron on the basis of Plate 29 bis (not Plate 29, as stated by Dubois, 2017) in the reptile section of the Atlas de Zoología of la Sagra's Historia Física, Política y Natural de la isla de Cuba (e.g., Cope, 1861; Boulenger, 1888; Dunn, 1957; Savage, 1968; Silverstone, 1975a, 1976; Myers et al., 1978; Frost, 1985; Myers, 1987; Lötters et al., 1997b), where the name was first published in the binomen Phyllobates bicolor. Although some early, preCode workers attributed Phyllobates to Dumeril and Bibron (1841), including Duméril and Bibron (1841) themselves and Boulenger (1882b), it was Dubois (1982, 1986) who re-introduced this erroneous interpretation a century later, and most subsequent workers relied on his opinion without question (e.g., Frost, 1999; Jungfer et al., 2000; Frost et al., 2006; Grant et al., 2006). In citing la Sagra's Atlas, authors should be aware of two potential difficulties. First, the date of publication has often been given as 1841 (e.g., Savage, 1968; Silverstone, 1976; Frost, 1985), but Dunn (1957) noted it was either 1840 or 1841 and Smith and Grant (1958; see also Savage et al., 2007) concluded it was published in 1840, which we follow here. Second, it was recently suggested (ICZN, 2009) that works by this author should be cited as “de la Sagra” instead of “Sagra,” as taxonomists usually have done. Nevertheless, in the Spanish edition of the work in question, the author refers to himself as “la Sagra” (e.g., la Sagra, 1838: 301; see also Cambron Infante, 1998), and we defer to his apparent preference. 7 Dubois et al. (2016) recently concluded that availability of the genus-group name Ranitomeya dates to Bauer (1985a), a paper Grant et al. (2006) dismissed as having been published anonymously for nomenclatural purposes. As Dubois et al. (2016: 33) correctly observed, “The paper [Bauer, 1985a] is signed LB but the meaning of this abbreviation is clearly given in the Bauer [1985b] paper which preceded it,” and on that basis Dubois et al. (2016) considered the name to be available. However, as is clear from the quote above, the interpretation that “LB” means “Luuc Bauer” and establishes authorship for nomenclatural purposes is an inference based on external evidence, i.e., evidence contained in a distinct paper and not in the paper itself. Recommendation 51D of the Code (ICZN, 1999) makes it clear that this is a case of “original anonymity.” Insofar as the name was published after 1950, as per Article 14 it is unavailable. Nevertheless, given that authorship for Bauer (1986) is established on p. 2 and both type species and characteristics purported to differentiate are provided (on pp. 1 and 11, respectively), Ranitomeya became available in this article and not in Bauer (1988), as Grant et al. (2006) asserted. 8 For example, Adelphobates quinquevittatus sequence DQ502066 (Grant et al., 2006) and EU342646 (Santos et al., 2009) were generated from the same individual deposited under voucher numbers OMNH 37016 (specimen) and LSUMZ 17471 (tissue), respectively. The sequences are identical except for a single T missing from position 2439 of EU342646, confirmed by TG as present in the chromatogram for DQ502066 9 Including “Colostethus” ruthveni. 10 DNA sequences of Ameerega shihuemoy were published after the current dataset was completed. BioOne is the product of innovative collaboration between scientific societies, libraries, academe and the private sector.

21 Dupont Circle NW, Suite 800, Washington, DC 20036 • Phone 202.296.1605 • Fax 202.872.0884 Copyright © 2018 BioOne All rights reserved

TERMS OF USE | PRIVACY POLICY