Regenerative therapies for intervertebral disc ... - Universiteit Utrecht [PDF]

Regenerative therapies for intervertebral disc degeneration a translational approach to serve man and dog

Nicole Willems

Regenerative therapies for intervertebral disc regeneration Nicole Willems PhD thesis, Utrecht University, Faculty of Veterinary Medicine, The Netherlands ISBN: 978-90-393-6546-5 Cover: Anjolieke Dertien and Nicole Willems Layout: Nicole Willems Printing: Gildeprint, Enschede Copyright © 2016 N. Willems. All rights reserved. No part of this thesis may be reproduced, stored in a retrieval system of any nature or transmitted in any form or by any means, without prior written consent of the author. The copyright of the articles that have been published has been transferred to the respective journals. This thesis was printed with financial support of Anna Fonds|NOREF, Boehringer-Ingelheim, Zoetis B.V., Royal Canin Nederland B.V., Scil animal care company, HES (Veterinair), Merial B.V., and Phytotreat B.V.

Regenerative therapies for intervertebral disc degeneration a translational approach to serve man and dog

Regeneratieve therapieën voor tussenwervelschijfdegeneratie Een translationele benadering om de mens en de hond te dienen (met een samenvatting in het Nederlands)

Proefschrift

ter verkrijging van de graad van doctor aan de Universiteit Utrecht op gezag van de rector magnificus, prof. dr. G.J. van der Zwaan ingevolge het besluit van het college voor promoties in het openbaar te verdedigen op dinsdag 17 mei 2016 des middags te 12.45 uur

door Nicole Willems geboren op 22 februari 1980 te Oude-Tonge

Promotoren: Prof. dr. B.P. Meij Prof. dr. W.J.A. Dhert Copromotoren: Dr. M.A. Tryfonidou Dr. L.B. Creemers

This research forms part of the Project P2.01 IDiDAS of the research program of the BioMedical Materials institute, co-funded by the Dutch Ministry of Economic Affairs, Agriculture and Innovation. The financial contribution of the Dutch Arthritis Foundation is gratefully acknowledged (IDiDAS and LLP22).

Contents

Chapter 1 Chapter 2

Chapter 3 Chapter 4

Chapter 5 Chapter 6 Chapter 7 Chapter 8 Addendum

General introduction, outline and aims of this thesis Safety of intradiscal injection and biocompatibility of polyester amide (PEA) microspheres in a canine model predisposed to intervertebral disc degeneration Intradiscal application of rhBMP-7 does not induce regeneration in a canine model of spontaneous intervertebral disc degeneration Biocompatibility and intradiscal application of a thermoreversible celecoxib-loaded poly-N-isopropylacrylamide MgFe-layered double hydroxide (pNIPAAM MgFe-LDH) hydrogel in a canine model Inflammatory profiles in canine intervertebral disc degeneration Pedicle screw-rod fixation: a feasible treatment for dogs with severe degenerative lumbosacral stenosis Temporary segmental distraction as a treatment for a dog with degenerative lumbosacral stenosis General discussion

7 43

193

Summary List of abbreviations Dutch summary/Nederlandse samenvatting Acknowledgements/Dankwoord Curriculum vitae

211 217 221 227 235

65 95

129 155 177

This thesis is based on the following publications: F.C. Bach, N. Willems, L.C. Penning, K. Ito, B.P. Meij, M.A. Tryfonidou. Potential regenerative treatment strategies for intervertebral disc degeneration in dogs. BMC Veterinary Research 2014, 10:3. L.B. Creemers, H. Yang, R. van Ee, K. Timmer, E. Craenmehr, J. Huang, C. Öner, W. Dhert, N. Willems, G. Grinwis, M. Tryfonidou, N. Papen-Botterhuis. A novel injectable thermoresponsive and cytocompatible gel of poly (N-isopropylacrylamide) with layered double hydroxides facilitates siRNA delivery into chondrocytes in 3D culture. Acta Biomaterialia 2015, 23:214.

N. Willems, H. Yang, M.L.P. Langelaan, A.R. Tellegen, G.C.M. Grinwis, H.C. Kranenburg, F.M. Riemers, S.G.M. Plomp, W.J.A. Dhert, N.E. Papen-Botterhuis, B.P. Meij, L.B. Creemers, M.A. Tryfonidou. Biocompatibility and intradiscal application of celecoxib-loaded MgFe LDH-pNIPAAM hydrogels in a canine spontaneous intervertebral disc degeneration model. Arthritis Research & Therapy 2015, 17:214. N. Willems, F.C. Bach, S.G.M. Plomp, M.H.P. van Rijen, J. Wolfswinkel, G.C.M. Grinwis, C. Bos, G.J. Strijkers, W.J.A. Dhert, B.P. Meij, L.B. Creemers, M.A. Tryfonidou. Intradiscal application of rhBMP-7 does not induce regeneration in a canine model of spontaneous intervertebral disc degeneration. Arthritis Research & Therapy 2015, 17:137.

N. Willems, G. Mihov, G.C.M. Grinwis, M. van Dijk, D. Schumann, C. Bos, G.J. Strijkers, W.J.A. Dhert, B.P. Meij, L.B. Creemers, M.A. Tryfonidou. Safety of intradiscal injection and biocompatibility of polyester amide (PEA) microspheres in a canine model predisposed to intervertebral disc degeneration. Journal of Biomedical Materials Research Part B: Applied Biomaterials 2015, doi: 10.1002/jbm.b.33579

A.R. Tellegen, N. Willems, M.A. Tryfonidou, B.P. Meij. Pedicle screw-rod fixation. A feasible treatment for dogs with severe degenerative lumbosacral stenosis. BMC Veterinary Research 2015; 11: 299. N. Willems, A.R. Tellegen, N. Bergknut, L.B. Creemers, J. Wolfswinkel, C. Freudigmann, K. Benz, G.C.M. Grinwis, M.A. Tryfonidou, B.P. Meij. Inflammatory profiles in canine intervertebral disc degeneration. BMC Veterinary Research 2016; 12:10.

Chapter 1 General introduction, outline, and aims of this thesis

Part of this chapter has been published as:

Potential regenerative treatment strategies for intervertebral disc degeneration in dogs Frances C. Bach, Nicole Willems, Louis C. Penning, Keita Ito, Björn P. Meij, Marianna A. Tryfonidou BMC Veterinary Research 2014, 10:3

8 | Chapter 1

Low back pain and intervertebral disc (IVD) degeneration Low back pain (LBP) is one of the leading causes of disability in the Western world, and is associated with high socio-economic costs due to increased morbidity of afflicted individuals, decreased productivity and increased health care costs. Approximately 84% of all people will experience an episode of LBP at some point in their lifetime; 50% of them at 1-3 a young (18 – 44 years) or middle (45 – 64 years) age. In the Netherlands, the annual costs of LBP were estimated at € 3.5 billion in 2007, with 12% direct and 88% indirect costs 4, 5 respectively. After an initial period of LBP, in 44 – 78% of the patients a pain relapse has 6 been described, and in 26 – 37% relapses of work absence. LBP can fluctuate over time with frequent recurrences and exacerbations, and 10% of the patients develop chronic persistent or recurrent pain, and generate approximately 80% of health care costs. Although the exact etiology of LBP remains still unclear, it has been described to be 7-9 strongly linked to intervertebral disc (IVD) degeneration. Current treatments Conservative treatment As the exact pathogenesis of IVD degeneration is still poorly understood, current treatments are mostly symptomatic, and have not been shown to allow for repair of the IVD thus far. Many clinical trials of variable methodologic quality have evaluated the 10 therapy for nonspecific LBP. Cyclooxygenase-2 (COX-2) selective anti-inflammatory drugs (COX-2 inhibitors), muscle relaxants, physical therapy, spinal manipulation, and maintenance of ordinary activity have been shown to be effective for short-term pain relief in acute LBP and in patients with suspected disc herniation, without the cauda 11-13 Some of the patients with disc equina syndrome or progressive neurologic deficits. herniation and radicular pain can benefit from epidural corticosteroid injections. In chronic LBP, various interventions, i.e. antidepressants, weak opioids, COX-2 inhibitors, cognitive behavioral therapy, supervised exercise therapy, brief educational interventions, back schools, and multidisciplinary (bio-psycho-social) treatment, have been shown to 2, 14-19 provide short-term effects on pain and function. Surgical treatment If pain persists despite conservative management, diagnostic imaging and subsequent surgical intervention can be considered. IVD degeneration can be assessed with several imaging modalities such as conventional radiography, computed tomography (CT), and discography. Thanks to the development of magnetic resonance imaging (MRI), this is nowadays the best diagnostic modality to detect changes of the IVD. In patients with lumbar disc herniation, the herniated disc fragment is removed by a minimally invasive 20 procedure: a microdiscectomy. In patients with chronic symptomatic IVD degeneration, 21, 22 To date, surgical fusion to treat spinal fusion was the only surgical option for decades.

General introduction, outline, and aims of this thesis | 9

chronic LBP remains a controversial issue. Four randomized controlled trials have 23-26 compared lumbar fusion to conservative treatment with conflicting results. Furthermore, fusion of a lower spinal segment alters the biomechanics of the rest of the spine, and predisposes patients to degenerative changes in the adjacent motion 27 segments. In an effort to improve results of fusion and to reduce the occurrence of adjacent segment degeneration, total disc replacement techniques that preserve motion 28 of the spine, have been developed and studied extensively. Nevertheless, clinical 21, 29-31 Unfortunately, in many outcomes were equivalent to those with spinal fusion. 32 patients, neither conservative nor surgical treatment results in a satisfying outcome. In order to design optimal strategies to biologically repair the IVD, it is important to know the healthy and diseased IVD. The healthy IVD IVDs are fibrocartilaginous structures embedded between the vertebral bodies, and provide stability and flexibility to the spinal column, by absorbing and transmitting 33 mechanical loads. Each IVD is composed of a central well-hydrated proteoglycan-rich gel, the nucleus pulposus (NP), that is surrounded by concentric lamellae of alternating oblique collagen fibers, the annulus fibrosus (AF), and connected to the vertebral bodies 33-35 The composition of the NP changes as the IVD by cartilaginous endplates (EP). matures: the number of large vacuolated cells of presumably notochordal origin decreases, whereas the number of smaller chondrocyte-like cells (CLCs) increases. As a 36 result of the changes in cell types, the extracellular matrix (ECM) also changes. The major proteoglycan in the NP is aggrecan, which is embedded in a network of collagen type II 34 and elastin fibers. Proteoglycans consist of a protein backbone with negatively charged glycosaminoglycan (GAG) side chains. The most common side chains are the anionic chondroitin sulfate and keratan sulfate, that are covalently bound to the core protein. Hyaluronic acid forms non-covalently linked complexes with proteoglycans, creating large negatively charged complexes that attract cations. This leads to water absorption and 34, 35 The fibers in the outer part of enables the NP to withstand large compressive forces. the AF primarily consist of collagen type I, and are interconnected via elastic fibers, providing a firm network that is able to resist tensile forces and prevent separation of 33 lamellae during compressive loading. The inner part of the AF is poorly organized and contains both collagen type I and II, and proteoglycans. Collagen fibers (Sharpey fibers) continue from the AF to the rims of the vertebral bodies, to the longitudinal ligaments anteriorly and posteriorly, and to the cartilaginous EP superiorly and inferiorly. The 37 cartilage EPs lock into the osseous EPs via calcified cartilage. At birth the cartilaginous EPs and the peripheral AF are highly vascularized, while with aging a decrease in vascularization in both structures is described. The adult IVD becomes the largest avascular structure in the body, and relies on diffusion of nutrients from capillary blood

10 | Chapter 1

vessels in the subchondral bone through the cartilaginous EP, and to a lesser extent through vessels in the periphery of the AF. Innervation of the healthy adult IVD is provided by the sympathetic chain and the recurrent sinovertebral nerve, and is restricted to the 38 outer layers of the AF. IVD degeneration During the process of IVD degeneration, the ECM in the IVD deteriorates as a result of 34, 39-45 Mechanisms that may mechanical trauma, injuries, smoking, obesity, and aging. contribute to this deterioration include inadequate nutrient supply, reduced cell viability, 46-49 IVD degeneration is characterized by cell senescence, and programmed cell death. elevated levels of inflammatory cytokines, increased proteoglycan (aggrecan) and collagen 35, 37, 50 Matrix type II degradation in the NP, and alterations in IVD cell phenotypes. metalloproteinases (MMP1, MMP-2, MMP-3, MMP-8, MMP-9), and aggrecenases (a disintegrin and a metalloprotease with thrombospondin motifs (ADAMTS)-1, ADAMTS-4, ADAMTS-5, ADAMTS-9, and ADAMTS-15) are thought to play a fundamental role in the 51-54 Due to the loss degradation of collagens and proteoglycans within the ECM of the IVD. in proteoglycans, the IVD loses its hydrostatic properties, promoting structural wear of the IVD. Consequently, the normal function and stability of the motion segment, comprising the IVD, facet joints, and the adjacent vertebral bodies, changes, resulting in decreased disc height, osteophyte formation, facet joint arthritis, and deformation of vertebral 34, 55 These structural changes and instability are strongly associated with painful bodies. pathologies, i.e. sciatica, disc herniation, and spinal stenosis. However, a majority of individuals over 30 years of age have some structural degenerative changes of one or more IVDs on MRI, but do not experience pain. Most probably pain is evoked when a structural deficit is accompanied by a secondary event, such as leakage of NP material through AF fissures, that results in attraction of immune cells and triggers a nociceptive 50, 56, 57 response in the AF and/or the dorsal longitudinal ligament. Role of inflammatory molecules in IVD degeneration Thus far it is unclear if IVD degeneration starts with the aforementioned molecular 58, 59 and/or if changes in the ECM of the NP and AF that trigger the inflammatory response, structural deficits in the NP and the AF, i.e. clefts, tears, herniation, enable recruitment of 60, 61 Chemotactic mechanisms may play a crucial role in immune cells to the IVD (Figure 1). IVD degeneration and repair, as AF cells can be recruited by chemokines, and chemokine 62, 63 Although a physiological receptors have been identified on both NP and AF cells. inflammatory response to sterile tissue injury primarily serves to promote tissue repair, an excessive inflammatory response with detrimental effects on tissue integrity, might 50 contribute to the pathogenesis of IVD degeneration.

General introduction, outline, and aims of this thesis | 11

Figure 1. Schematic representation of the inflammatory response within the intervertebral disc (IVD). Causes of IVD degeneration are likely to be both genetic and environmental (initiating factors). IVD degeneration is mediated by increased levels of pro-inflammatory molecules secreted by nucleus pulposus (NP) and annulus fibrosus (AF) cells. Several inflammatory mediators (including TNF-ɲ͕ />-ϭɴ͕ W'2) can trigger a range of pathogenic responses in the NP and AF resulting in a catabolic environment. Molecular and biochemical changes in the ECM of the NP and AF further enhance inflammation, which in combination with structural deficits in the NP and AF enable recruitment and infiltration of the IVD by macrophages, neutrophils, and T cells.

12 | Chapter 1

Regardless of predisposing factor(s) or age, IVD degeneration is thought to be influenced by increased levels of pro-inflammatory molecules secreted by NP and AF cells, as well as 60, 64-67 Several of these molecules have the macrophages, T cells, and neutrophils. capability to trigger a range of pathogenic responses in NP and AF cells, and have been suggested to play a role in the catabolic processes in degenerated IVDs. Increased expression of IL-ϭɴand a disturbance of the balance between the activating receptor of interleukin 1 (IL-1R), and the IL-1 receptor antagonist (IL-1Ra), has been demonstrated in 64, 68 Tumor necrosis factor alpha (TNF-ɲ) and IL-1 induced degenerated IVD tissue. 64, 69, 70 Furthermore, elevated levels upregulation of matrix degrading enzymes by NP cells. of IL-1 and prostaglandin E2 (PGE2) have been associated with aging and degeneration of 64, 71 In NP cells, PGE2 negatively affected matrix integrity by inhibiting the IVD. proteoglycan synthesis, possibly mediated by a decrease in insulin growth factor 1 and an 71 increase in matrix degrading enzymes. Higher expression levels of interferon gamma (IFN-ɶ), IL-6, and IL-17 have been described in degenerated human IVDs compared with 60 non-degenerated control IVDs. In response to elevated TNF-ɲ ĂŶĚ IL-ϭɴ ůĞǀĞůƐ, the expression of the chemoattractive protein chemokine (C-C motif) 3 (CCL3) in NP cells 72 correlated positively with the grade of IVD degeneration. Furthermore, expression of CCL2, CCL7 and IL-8 increased concordant with histological degenerative changes in the 67 NPs of degenerated IVDs. Herniated degenerative IVD tissue has been demonstrated to spontaneously produce increased amounts of MMP-2, MMP-3, and MMP9, nitric oxide, PGE2 and IL-6, and 73-76 TNF-ɲ͕ and IL-8 levels increased gene expression levels of IL-1, IL-8, and TNF-ɲin vitro. were significantly higher in herniated IVDs compared with those in degenerated IVDs, 65 while no significant differences were observed in the expression of IL-1ɴĂŶĚ/>-6 levels. In another study, IFN-ɶ, IL-4, IL-6, IL-12, and IL-17 levels were significantly higher in herniated IVDs compared with those in non-degenerated IVDs, whereas IFN-ɶ ĂŶĚ />-6 levels were higher in herniated IVDs compared with those in degenerated IVDs. These data suggest that the inflammatory reaction in herniated IVDs is distinct from that 60 observed in degenerated IVDs. In addition, concentration of cytokines and cytokine 74 profiles might also differ for different types of disc herniation. Pain associated with IVD degeneration is believed to be related to ingrowth of small nonmyelinated nerve fibers into the usually aneural areas of the IVD, and nociceptive stimulation of the surrounding neural elements due to IVD dysfunction. The release of cytokines, particularly IL-1ɴ͕ ŚĂƐ ďĞĞŶ ƐŚŽǁŶ ƚŽ induce significant increases in nerve growth factor (NGF) and vascular endothelial growth factor, which could stimulate 65, 77 Furthermore, NGF is innervation and vascularization in the degenerated IVD. 77 produced by newly formed microvessels, deriving from adjacent vertebral bodies. In

General introduction, outline, and aims of this thesis | 13

turn, increased levels of pro-inflammatory cytokines, e.g. TNF- ɲ͕ can contribute to pain in 50 patients with IVD disease. Ex vivo and in vivo animal models to study human IVD degeneration Commonly used in vitro cell culture models in IVD research include 2D monolayers, 3D 78 high density culture and alginate beads. A major disadvantage of these systems is that cells are removed from their native tissue environment during cell isolation, which might affect cell behavior. Hence, organ culture bioreactor systems have been developed to mimic the in vivo situation. IVD explants, including NP, AF and EPs can be kept alive under 79 loading conditions for several weeks with preservation of tissue integrity. Despite these valuable alternatives and their contribution to a reduction in animal experiments, these models have clear limitations regarding the complex biology underlying IVD degeneration. Several animal models in IVD degeneration research have been developed to investigate the etiopathogenesis and treatment of the degenerative process, and to perform safety 80 studies, prescribed and dictated by regulatory bodies. Frequently used small animal models include rodent and rabbit models, and large animal models are dog, sheep, and goat models. In most animal models IVD degeneration is induced surgically or chemically. Only few animals develop spontaneous IVD 80, 81 There are many degeneration, i.e. sand rats, pintail mice, baboons, and dogs. differences in size, cell type, biochemical and biomechanical properties between human and animal IVDs, and the ideal translational model remains undetermined. Although induced IVD degeneration can result in a useful acute model of disc degeneration, it is likely that pathological pathways differ from the chronic condition of IVD degeneration in humans. Variations in anatomical dimensions between species, (e.g. size, shape, adjacent spinal tissues) obviously affect the biomechanical behavior of the spinal segments and make a direct comparison problematic. The presence of notochordal cells (NCs) differs between various species and has been suggested to initiate results that are more 82 favorable in promoting regeneration and repair. In humans, cows, sheep, and horses these cells disappear with aging, while in pigs, rabbits, mice, and rats, they persist up to 83, 84 Interestingly, in humans and chondrodystrophic dogs, the loss of NCs from adulthood. the NP occurs before early signs of degeneration, and it remains unclear if their 85 disappearance might play a role in initiating IVD degeneration. The dog as a patient The dog is the only large animal model with naturally occurring IVD degeneration, which is also clinically treated for IVD disease in its role as a companion animal. In chondrodystrophic (CD) dog breeds (e.g. dachshund), endochondral ossification of the long bones is disrupted, resulting in disproportional short limbs. Chondrodystrophy is

14 | Chapter 1

believed to be closely linked to the occurrence of IVD degeneration with concurrent loss 86 of NCs at all IVD levels. By 1 year of age, this transformation is complete in 75% of the cervical, 100% of the thoracic, and 93.8% of the lumbar IVDs, and ultimately affects all 87-89 In contrast to CD dogs, in non-chondrodystrophic (NCD) dogs IVDs remain IVDs. 90, 91 Degeneration of IVDs associated healthy with high numbers of NCs until late in life. with loss of NCs in NCD dogs occurs at predisposed sites, i.e. the caudal cervical and 87, 92 Lifetime prevalence of IVD degenerative lumbosacral (LS) spine, at 6 to 8 years of age. 93 diseases in CD and NCD dog breeds are calculated at 20% and 7%, respectively. CD dogs are predisposed to explosive extrusion of the NP (Hansen type I) of degenerated lumbosacral and caudal cervical IVDs, and NP extrusion of degenerated thoracolumbar 94-97 90, 98 Hansen type II annular protrusion does occur in CD dogs, but less commonly. IVDs. The overall case fatality rate (rate of mortality to incidence rate of IVD-related diseases) in 93 CD and NCD dogs is 25% and 65%, respectively. As in humans, canine IVD degeneration is associated with cervical and (low) back pain and neurologic deficits. Current treatments for IVD disease in painful dogs focus on alleviating pain and include analgesics (e.g. anti-inflammatory drugs, opioids, gabapentin), muscle relaxants, and physical therapy. In dogs with neurological deficits, or in dogs that do not respond to conservative treatment, diagnostic imaging is indicated, e.g. CT or MRI, and surgical 90, 91, 99 Aim of the surgery is to decompress affected neural intervention is recommended. thoracolumbar and cervical IVDs, mainly between 3 and 7 years of age. NCD dogs are predisposed to protrusion of the AF (Hansen type II) of degenerated structures. Several direct decompression procedures are routinely performed in veterinary practice, such as dorsal laminectomy in dogs with degenerative lumbosacral stenosis (DLSS), hemilaminectomy in dogs with thoracolumbar IVD disease, or a ventral slot-procedure in 90, 91, 100 Indirect decompression techniques have also been dogs with cervical IVD disease. described, e.g. distraction-stabilization-fusion in dogs with DLSS and caudal cervical spondylomyelopathy. In the last few decades pedicle screw-rod fixation (PSRF) in canine patients have gained interest to treat lumbosacral spinal stenosis, instability and 101 degenerative disc disease. Nevertheless, long-term side-effects of medication, spinal 97, 102 Similar to instability, and recurrence of IVD disease are commonly described in dogs. the situation in human medicine, current therapies in dogs do not restore functionality of the degenerative IVD, and a clear need exists for development of regenerative therapies. The dog as a translational animal model A collaboration between biomedical researchers and veterinary surgeons may be beneficial to both humans and dogs. Dogs are an interesting species in IVD research, as they can be divided into CD and NCD breeds, based on their physical appearance. Similar to IVD degeneration in humans, NCs in the NP of CD dogs are gradually replaced by CLCs

General introduction, outline, and aims of this thesis | 15

early in life. As a result, already by one year of age, the NP of CD dogs contains primarily CLCs, while NCs remain the predominant cell type in the NP of NCD dogs during their 87, 103, 104 A few in vivo studies investigating regenerative therapies for the IVD have lifetime. 105-108 been performed in laboratory dogs with experimentally induced IVD degeneration. Interestingly, dogs with spontaneously occurring IVD degeneration have not been used in such in vivo studies thus far. Beagle dogs (CD breed), represent a uniform population with naturally occurring IVD degeneration, and can be useful in testing regenerative strategies for early and intermediate stage IVD degeneration. Companion dogs, that naturally develop IVD degeneration and disease, may serve as appropriate candidates for preclinical trials of innovative treatments for intermediate or late stage IVD degeneration. Clinical outcomes can be evaluated by physical examination, diagnostic and quantitative imaging, completed questionnaires by owners, and gait analysis. Canine patients will probably benefit from such trials in future, as these innovative therapies would otherwise not be available in veterinary medicine, while biomedical researchers can profit from the outcome of a representative animal model, testing the feasibility of regenerative treatments, prior to conducting clinical trials in human patients. Intrinsic IVD regeneration Evidence is increasing that the IVD itself is populated with resident progenitor cells in the NP, AF, and endplate in young and aged IVDs of different mammals (human, dog, 109-116 It is suggested that the resident stem cells within the macaque, minipig, rat, mouse). IVD are remnants of the multipotent mesoderm cells (notochord) during 117, 118 However, it has recently been shown that other stem cells migrate embryogenesis. from specific niches localized in the outer AF borders with the ligament zone and the 110 perichondrium, towards the inner parts of the IVD. Limited numbers of intravenously delivered bone marrow derived mesenchymal stem cells (MSCs) were also shown to be 119 suggesting MSCs originating from the vertebral bone able to migrate to the IVD, marrow might also serve as a resource of IVD stem cells. During IVD degeneration, the intrinsic repair capacity might be inadequate, or might be disturbed by inflammatory 60, 64-67 Even more so, in vitro and/or catabolic processes that accelerate ECM degradation. differentiation of IVD derived stem cells was shown to induce to expression of neural or 112, 120 endothelial markers, facilitating vascularization and innervation of the IVD.

16 | Chapter 1

Current regenerative approaches The current clinical therapeutic limitations, in combination with a rapid increase in understanding of the etiopathological background of IVD degeneration, stimulated many researchers to investigate novel regenerative therapies (Figure 2). Regenerative treatments aim at intervention at an early stage of IVD degeneration, and comprise restoration of the homeostasis of the ECM, control of inflammation, and prevention of 121 angio- and neurogenesis. Intradiscal delivery of exogenous growth factors, genes, and cells, either alone or in combination, are promising regenerative approaches. To optimize cell activity, viability, preservation, and differentiation down the desired mesenchymal lineages, regenerative strategies also focus on optimal cell carriers and delivery systems, such as biomaterials. Thus far, novel regenerative therapies have been tested in animal models with induced IVD degeneration, but not in animal models with spontaneous IVD degeneration that more closely resembles the biological condition in humans.

Figure 2. A midsagittal histologic section (picrosirius red/alcian blue) of a healthy (upper left), and a degenerated human IVD (upper right). The healthy IVD consists of a nucleus pulposus (NP) rich in collagen type II and proteoglycans (blue stain), and a well-organized fibrocartilaginous annulus fibrosus. The degenerated IVD consists of a NP rich in collagen type I (red stain), a highly disorganized AF, and is reduced in height. Intradiscal delivery of growth factors, anti-inflammatory factors, biomaterials, and cells, and (temporary) biomechanical adjustment of a spinal segment, either alone or in combination, seem promising regenerative strategies for IVD repair.

General introduction, outline, and aims of this thesis | 17

A relatively new approach to cartilage regeneration, that originates from the field of 122, 123 This surgical technique is based on the hypothesis osteoarthritis, is joint distraction. that osteoarthritic cartilage has some regenerative capacity when the damaged cartilage is mechanically unloaded by means of an external fixation frame. In this way further wear and tear is prevented, while the intermittent synovial fluid pressure, essential for the 124 nutrition of the cartilage, is preserved. The exact mechanisms that lead to cartilage regeneration in the distracted joint space are not known, but are currently being investigated. Because of the large similarities between articular cartilage and the IVD, 125, 126 several studies have focussed on the effects of segmental distraction in IVD disease. Growth factors Several growth factors have been shown to effectively promote cell production and cell proliferation of IVD cells in vitro as well as in vivo. Bone morphogenetic proteins (BMPs) are members of the transforming growth factor beta superfamily. Transforming growth factor beta (TGF-ɴͿŝƐŽŶĞŽĨƚŚĞĨŝƌƐƚĂƉƉůŝĞĚŐƌŽǁƚŚĨĂĐƚŽƌƐ that was shown to stimulate 65, 127, 128 In a mouse IVD compression model TGF-ɴ ƐƚŝŵƵůĂƚĞĚ IVD cell proliferation. proliferation of AF cells, which also showed an increased gene expression of aggrecan and 129 collagen II. Importantly, response to TGF-ɴ ǁĂƐ ŽďƐĞƌǀĞĚ ŽŶůLJ ĂĨƚĞƌ ĂĚŵŝŶŝƐƚƌĂƚŝŽŶ ŽĨ multiple injections, indicating a need for sustained delivery. In vitro and in vivo studies have indicated that BMP-2 and BMP-7, also members of the 130-135 BMP-2 TGF-ɴ ƐƵƉĞƌĨĂŵŝůLJ͕ are upregulated with aging and with induced IVD injury. was shown to enhance matrix production and increase gene expression of collagen type II 136-140 IVD cells from 6-month-old and 3and aggrecan in rat, rabbit and human IVD cells. year-old rabbits that were treated with BMP-2 showed increased synthesis of GAGs and increased gene expression of aggrecan, collagen type I and II. Interestingly, this effect was 141 more pronounced in adult rabbit cells compared with the adolescent IVD cells. Similar results were demonstrated in alginate-encapsulated bovine NP cells that were co-cultured 142 with transduced bovine cartilage cells expressing BMP-2. Results on the regenerative effects of BMP-2 on degenerated IVDs in vivo are conflicting. Intradiscal injection of adeno-associated virus serotype 2-BMP in a rabbit annular puncture model resulted in slowing the course of injury-induced degeneration. However, in another rabbit annular puncture model no regenerative effects were reported after injection of transfected IVDs 143 In a rabbit annular tear model, BMP-2 protein provoked cells expressing BMP-2. acceleration of IVD degeneration, and osteogenic responses were observed near the 144 vertebral endplates. BMP-7 (also known as osteogeneic protein-1) has been widely studied for its regenerative effects on degenerated IVDs. In vitro, BMP-7 has been shown to enhance ECM production

18 | Chapter 1

145-151

of rabbit, bovine, and human IVD cells. Recombinant human (rh)BMP-7 was demonstrated to restore disc height and increase the proteoglycan content in a rabbit 152, 153 and to have anti-catabolic effects in a rat IVD compression annular puncture model, 154 model. In a canine model of allogenic IVD transplantation, NP cells expressing hBMP-7 prevented degeneration of the transplanted IVD at 6 months follow-up compared with 155 non-transfected NP cells. In growth and differentiation factor 5 (GDF-5; also known as BMP-14) deficient (GDF -/-) mice, reduced levels of GAGs, and downregulation of type II collagen and aggrecan genes 156 Stimulation of bovine NP and AF cells with rhGDF-5, in the IVDs were reported. 157 enhanced cell proliferation, and proteoglycan and collagen synthesis and accumulation. In vivo, a single injection with rhGDF-5 into the NP was shown to improve disc height, MRI 157 and histological grading scores in a rabbit annular puncture model. Sustained release of rhGDF-5 from PLGA microspheres also resulted in restoration of disc height, increased GAG and DNA content, and significantly increased mRNA levels of collagen type II in a rat 158 Several clinical trials in which a single dose of rhGDF is annular puncture model. intradiscally injected are ongoing (NCT01158924, NCT01182337, NCT01124006, NCT00813813), however, outcome data have not been published yet. Various in vitro studies have proven that insulin-like growth factor-1 (IGF-1) promotes cell 128, 159, 160 Platelet derived growth factor (PDGF), basic proliferation and matrix synthesis. fibroblast growth factor (bFGF), and epidermal growth factor enhanced IVD cell 128, 159 IGF-1 and PDGF were also shown to reduce the percentage of proliferation. 161, 162 Only minor effects on cell proliferation of apoptotic human AF and in rat NP cells. IGF-1 and basic fibroblast growth factor in a mouse IVD compression model were 129 reported. Platelet-rich plasma (PRP), a natural carrier of multiple growth factors has also been 163 introduced in the field of IVD regeneration. Multiple growth factors and other proteins 164 in this therapeutic cocktail are thought to be synergistic. In several in vitro studies PRP 165-168 was shown to induce proliferation of NP and AF cells, and differentiation of NP cells. A few preclinical studies in rat and rabbit annular puncture models show promising data 169-171 Nevertheless, on regeneration of the IVD by a single intradiscal injection of PRP. further studies are required to confirm the efficacy and safety of intradiscal application of PRP, considering the potential undesired effects of vascularization, ossification and 172 inflammation.

General introduction, outline, and aims of this thesis | 19

Cell-based therapies Since there are relatively few cells in the degenerated IVD, i.e. less than 1% of the total disc volume, and cell viability is impaired, stimulation of the residing cells may be 121, 173 Supplementation of functional cell populations may insufficient to achieve repair. overcome this problem. Cells used in IVD tissue engineering should be able to survive within the local environment, and produce a functional matrix, which is similar to the 174 Thus far, cell-based treatment strategies have mainly focussed on NP original tissue. cells, articular chondrocytes, and MSCs have found their way to the clinic. Disc derived chondrocytes and articular chondrocytes Transplantation of autologous and allogeneic NP and/or AF cells into the IVD has been 107, 175-177 A few clinical trials have shown to retard IVD degeneration in various species. been performed using cell-based therapies for IVD repair. In the Euro DISC study, cultureexpanded autologous IVD cells harvested during discectomy in humans, were transplanted via a minimal invasive percutaneous injection. Two-year follow-up data demonstrated a significant pain reduction, preservation of disc height, and maintained hydration of 106 adjacent segments in the cell treated group compared with the discectomy only group. However, this study was not placebo-controlled, therefore results should be interpreted with care. In the NuQu phase I safety study, allogeneic juvenile knee chondrocytes were percutaneously injected into degenerated lumbar IVDs of 15 human patients and evaluated after 12 months. Pain scores significantly improved, and the majority of radiological parameters improved or remained unchanged. An ongoing phase II clinical 178 trial will assess the safety and efficacy of this approach. Mesenchymal stem cells (MSCs) MSCs are emerging as leading cellular therapy for several diseases, since they can easily be isolated from a variety of tissues, e.g. bone marrow, adipose and synovial tissue, and can 179 differentiate into different cell types, including chondrocytes. Several in vivo studies in rabbit, rat, and goat models have demonstrated that bone marrow derived MSCs (BMSCs) are able to maintain their viability, proliferate, and obtain an IVD-like phenotype after 180-183 Intradiscal delivery of BMSCs and adipose derived stem implantation into the IVD. cells (ASCs) has been shown to promote regeneration in an experimentally induced IVD 105, 108 Furthermore, human MSCs survived after implantation degeneration models in dogs. into porcine models, and expressed typical chondrocyte markers, suggestive of 184 differentiation toward IVD-like cells. Several clinical trials (phase I and II studies) with autologous and allogeneic MSCs are currently being performed (NCT01860417; NCT02338271; NCT01290367).

20 | Chapter 1

Biomaterials Biomaterials are commonly used as cell carriers, however, they can also improve the effectiveness of bioactive agents, e.g. growth factors, and pharmaceutical agents, by sustained release. Biomaterials are recognized for their biocompatibility, biofunctionality, and bioresorbability, and they can be delivered into the IVD via minimally invasive 185 procedures (Figure 3). By encapsulating bioactive substances in a biomaterial, the loaded compound can be protected, and bioavailability and stability can be increased. Furthermore, higher loading doses of pharmaceutical agents can be achieved, without causing local and systemic side effects, as they are released locally, and over a longer period of time.

Figure 3. Schematic representation of a transverse cross-section through a vertebra, showing delivery of two types of biomaterials, i.e. microspheres and a hydrogel into the intervertebral disc (IVD) via a minimally invasive injection procedure.

Hydrogels as cell carriers Hydrogels represent an important class of biomaterials, and have been employed for a range of biomedical applications. Hydrogels are networks of hydrophilic polymers, and have the capacity to absorb large amounts of water or biological fluids. Crosslinkages in

General introduction, outline, and aims of this thesis | 21

these networks can be based on covalent (e.g. photo-crosslinked), or on physical (e.g. 186 hydrophobic) interactions. Formation of a hydrogel delivery system upon injection of combinations of reactive compounds, can avoid procedures that may harm the cells and bioactive substances (e.g. photo crosslinking). Different mild crosslinking chemistries, e.g. Schiff’s base chemistry, and Michael-type reactions, can be used under physiological conditions to form networks and encapsulate cells within the gel. In studies concerning these type of hydrogels, cell viability of mesenchymal progenitor (MPCs) and stem cells, 187-191 NP, and AF cells and proteoglycan production were retained in vitro. Natural hydrogels Hydrogels consisting of natural polymers, e.g. collagen and hyaluronic acid (HA), are commonly used as cell carriers to retain transplanted cells at the site of injection. They show analogy with the disc microenvironment, which facilitates survival of the transplanted cells, or even promotes matrix production. Protease solubilized collagen ® (Atelocollagen ) has been shown to be less immunogenic compared with other carriers, and to enable cell proliferation, matrix synthesis and differentiation of MSCs in a rabbit 180 induced degeneration model. HA in combination with ASCs has been shown to maintain IVD morphology and disc height on MRI, in a canine induced degeneration model, 107 suggestive of preservation of cell viability and production of ECM matrix. An HA-based ® hydrogel (Durolane ) induced the highest cell proliferation of human MSCs, chondrocytes, and IVDs in vitro. Interestingly, intradiscal injection of this HA-based hydrogel in a porcine degeneration model, either with or without human MSCs or chondrocytes, resulted in bone formation in the IVD at 6 months follow-up, indicating its unsuitability for use in 192 vivo. In an ovine chemonucleolysis model, IVD degeneration scores and disc height index (DHI) significantly improved, when injected with an HA carrier containing MPCs, 193 compared with non-injected and HA-injected IVDs. Currently, two clinical trials are being performed, in which HA is used as a carrier for autologous MPCs (NCT02338271; NCT01290367). Synthetic hydrogels Polyethylene glycol (PEG) is a synthetic polyether which is rarely used as a stand-alone hydrogel in regenerative strategies because of their bio-inert nature. However, in combination with adhesive peptides or other hydrogels they do support cell adhesion and 194 tissue formation. PEG hydrogels are not naturally degradable, unless combined with synthetic or natural components such as poly lactic acid (PLA) or enzyme-sensitive 194, 195 Recently, a PEG-crosslinked serum albumin/HA hydrogel was shown to peptides. support cell viability and chondrogenic differentiation of articular chondrocytes, IVD cells 196, 197 In a and MSCs, and to have anti-angiogenic properties in vitro and in vivo. nucleotomy-induced IVD degeneration model in sheep, this hydrogel was combined with

22 | Chapter 1

197

IVD cells, and was shown to enhance the process of endogenous repair. A prospective randomized clinical trial was started in humans to evaluate the clinical applicability, safety and efficacy of this hydrogel combined with autologous IVD chondrocytes in the repair of a herniated disc with an indication for an elective sequestrectomy (NCT01640457). In situ forming hydrogels using thermoresponsive systems Physically crosslinked hydrogels can be formed via non-covalent interactions in response to a change in temperature. Injectable thermoreversible hydrogels are of great interest in the field of regenerative repair of the IVD, as formation in situ occurs in a mild way, without the need of chemical reactions, and moulding of the hydrogel into the exact shape of the defect is easy. Natural (e.g. chitosan, alginate) as well as synthetic polymers, (e.g. poly-N-isopropylacrylamide (pNIPAAM)) gels are frequently used. These gels can serve as delivery systems because of their ease of control and preparation, and practical application; they can easily be injected into the IVD as a fluid, and undergo a phase transition to an insoluble state with increasing temperature, diminishing the risk of extrusion or leakage from the IVD. Several thermoreversible hydrogels, e.g. HA-pNIPAAM, and chitosan-glycerophosphate (C/GP), supported differentiation of human MSCs toward the IVD phenotype without the need for growth factor supplementation in vitro and ex 198, 199 NP cells embedded in a C/GP thermosensitive hydrogel produced proteoglycans vivo. that were retained in the chitosan-matrix, whereas AF cells did not survive the hydrogel 200 formation process. Biomaterials as sustained delivery agents Bioactive substances can be incorporated into hydrogels by simple mixing, or encapsulated in microspheres, allowing accurate and sustained delivery of the active 201 compounds via intradiscal injection. To avoid problems with variability of production, 174, 202 networks can be mechanical properties and degradation rates of natural polymers, completed or created with synthetic polymers, e.g. PLA, PEG, or polyglycolic acid, resulting in formation of hydrogels or microspheres that can easily be tuned and reproduced, and degrade in a controlled fashion. Thus far only limited studies in vitro and in vivo are available on sustained release in the IVD, targeting different aspects (e.g. inflammation, imbalance anabolism/catabolism) of IVD degeneration. Hydrogels A ferulic acid (FA) loaded chitosan-gelatin-glycerophosphate (C/G/GP) hydrogel has been shown to provide sustained release of FA, resulting in a reduction in cell apoptosis, and 203, 204 Biodegradable gelatin anabolic effects on gene expression and protein levels in vitro. hydrogel microparticles loaded with platelet rich plasma were shown to suppress

General introduction, outline, and aims of this thesis | 23

progression of IVD degeneration, maintain disc height, and increase expression of anabolic 205, 206 genes in an induced IVD degeneration model in rabbits. Microspheres The release medium of IL-1Ra encapsulated in poly lactic-co-glycolic acid (PLGA) microspheres attenuated degradative effects of IL-ϭɴ ŝŶ ďŽǀŝŶĞ EW ĐĞůů ĐŽŶƐƚƌƵĐƚƐ͘ However, decreased efficacy of the encapsulated protein was demonstrated at later time intervals, most likely due to a diminished concentration of released IL-1Ra with time 207 and/or potential reduced bioactivity. Sustained release rhGDF-5 from PLGA microspheres was associated with restoration of disc height, increased GAG and DNA content, and increased mRNA levels of collagen type II, in punctured IVDs in a rat tail degeneration model. As a single injection with rhGDF-5 was not included in this study, the added value of sustained delivery could not be 158 demonstrated. Positively charged PLGA microspheres loaded with dexamethasone combined with negatively charged nanoparticles loaded with bFGF-embedded heparin/poly(l-lysine) 208 showed in vitro growth of MSCs and chondrogenic differentiation. Injection of these microspheres combined with TGF-ɴ3-embedded heparin/poly(l-lysine) nanoparticles, and seeded with ASCs in a rat IVD degeneration model, resulted in a significant increase in proteoglycan production compared with controls, and a restored disc height of 70% of the 209 healthy controls. No additive effects of the seeded ASCs were shown, indicating results were mediated by stimulation of cells in situ. Ceramic capsules loaded with corticosteroids significantly reduced cellular degeneration in a rat model, when placed adjacent to the injured IVD, and the authors suggested a beneficial effect of corticosteroids on 210 remodelling of the IVD. Joint distraction As stated before, in many patients neither conservative nor surgical treatment results in a 211 satisfying outcome. A promising technique in peripheral osteoarthritic (OA) joints that 212 preserves function without major surgery is distraction. Distraction of a joint by using an external fixator has been shown to decrease mechanical stresses on cartilage, and to initiate repair by chondrocytes. Although the IVD and articular cartilage morphologically 213 seem very different, they are remarkably similar at a biochemical level. Furthermore, in parallel to OA joint cartilage, the IVD is also subjected to mechanical stress. Distraction of both the IVD and the facet joints can be established by using a PSRF construct that can be placed with a minimally invasive surgical technique. In human cadavers lumbar distraction 214 appeared to predictably reduce NP pressure. This type of construct has been used

24 | Chapter 1

extensively in spinal fusion to provide biomechanical stability to obtain fusion, to 215 decompress neural structures and to correct deformities. However, spinal fusion alters the biomechanics of the spinal column, and it is thought that the loss of motion at the fused level leads to increased motion and load at the unfused segments, resulting in 216-218 Placing a fixation device only temporarily to provide adjacent segment disease (ASD). distraction, might avoid development of ASD, but allow biological repair of the IVD. Several studies focused on the dynamic and biochemical effect of temporary joint distraction in the treatment for IVD degeneration by using a rabbit dynamic distraction 219-222 In this model, signs of tissue repair were demonstrated at a biological, model. 219, 223 cellular and biomechanical level after 28 and 56 days of external disc distraction. Also, regeneration of the ECM in the NP and EPs was described, as well as regeneration of 221 Furthermore, rehydration of the IVD, stimulation of ECM vascular channels in the EPs. gene expression, and increased numbers of BMP-2 and collagen type II positive cells were 222 shown. Although, these results demonstrate the potential benefit of temporary IVD distraction on the regenerative capacities of the IVD, further studies are warranted before this technique can be applied in clinical practice. Clinical imaging of IVD regeneration Regenerative therapies are shifting towards prevention and intervention at early stages, and accurate, objective, and non-invasive assessment of the condition of the matrix, and the effectiveness of treatment in in vivo studies is required. The most frequently used MRI 224 techniques for imaging spinal structures are T1-weighted (T1W) and T2W images. High intensity areas in T1W images indicate a high fat concentration. This fat acts as a natural contrast medium, and structures bordered by fat are clearly outlined. The bright signal intensity of water predominates in T2W images and is highly significantly correlated with the water and proteoglycan content, and hence negatively correlated with the extent of 225 IVD degeneration. The Pfirrmann classification system is the most widely used system to grade human IVD degeneration on T2W images in research and clinical 226-228 The system evaluates T2W signal intensity, IVD structure, distinction applications. 229 between NP and AF, and disc height. Conventional imaging techniques have limited capabilities in revealing subtle changes at the ECM level and therefore novel techniques have been developed. T2W images provide only qualitative data, whereas with quantitative techniques, e.g. T2 mapping, relaxation times are calculated, that provide 228, 230 The T2 relaxation time is characterized by a time information about tissue structure. constant (T2) representing the decay of the transverse magnetization towards zero after a radiofrequency pulse. T2 relaxation time correlates positively with hydration and 231, 232 Several studies negatively with the composition of the collagen network structure. have demonstrated decreased T2 relaxation times in the NP from sagittal maps, when 228, 233-235 Pfirrmann scores increased.

General introduction, outline, and aims of this thesis | 25

A technique that has gained interest because of its supposed capacity to identify early ĚĞŐĞŶĞƌĂƚŝŽŶďLJƚŚĞůŽƐƐŽĨƉƌŽƚĞŽŐůLJĐĂŶƐŝƐdϭʌ͘dϭʌ͕ƚŚĞƚŝŵĞĐŽŶƐƚĂŶƚƚŚĂƚŝƐŽďƚĂŝŶĞĚ by spin-lock MRI, is similar to T2 in that it is sensitive to interactions of water with 224, 236, 237 However, ƚŚĞ ƐƉŝŶ ůŽĐŬŝŶŐ ŵĂŬĞƐ dϭʌ ŵŽƌĞ ƐĞŶƐŝƚŝǀĞ ƚŽ macromolecules. different relaxation mechanisms, such as low frequency proton exchange. This leads to an enhanced dynamic range of dϭʌcompared with T2, and enables the detection of changes 238, 239 dϭʌrelaxation time has been shown to be directly correlated to in proteoglycans. 240-243 DĞĂŶ dϭʌ proteoglycan content and (inversely) to degenerative grades in the IVD. values in the NP have been demonstrated to be signifiĐĂŶƚůLJ ŚŝŐŚĞƌ ĐŽŵƉĂƌĞĚ ǁŝƚŚ dϭʌ 244 values in the AF. /ŶƚĞƌĞƐƚŝŶŐůLJ͕ĂƐŝŐŶŝĨŝĐĂŶƚĐŽƌƌĞůĂƚŝŽŶďĞƚǁĞĞŶdϭʌǀĂůƵĞƐĂŶĚĐůŝŶŝĐĂů symptoms has been reported. Nevertheless, further studies are warranted, as this study 243 was performed in only 16 patients. In nuclear magnetic resonance spectroscopy (MRS), molecular groups that carry hydrogen nuclei can be visualized, as the exact frequency at which a proton resonates depends on 224 the chemical bonds the atoms form . MRS studies in IVDs ex vivo have shown to be able to detect a decrease in proteoglycan content in the NP and an increase in collagen 245, 246 Feasibility of the quantification of degradation levels with increased degeneration. 247 water and proteoglycan content in vivo by MRS was already demonstrated, and future developments may allow in vivo evaluation of other metabolite resonances, increasing the possibility of exploring the chemical condition of the IVD.

26 | Chapter 1

Outline and aims of this thesis The main aim of this thesis is to develop innovative treatments to regenerate early degenerated IVDs in order to regain function and thereby prevent or delay further medical intervention. Therefore, bioactive substances are delivered intradiscally, either alone, or in combination with injectable sustained release systems, and are evaluated in a canine model predisposed to spontaneous IVD degeneration. Furthermore, distraction of the lumbosacral junction is investigated in an in vivo pilot study. Aim 1: determine the safety of intradiscal injection and biocompatibility of PEAMs in a canine IVD degeneration model. Rationale: Within the IDiDAS project (New Early Therapies for Intervertebral Disc Diseases. Drug Delivery and Augmentation through Smart Polymeric Biomaterials), which forms part of the research program of the Biomedical Materials institute (BMM), two injectable sustained release systems, i.e. polyester amide microspheres (PEAMs) and pNIPAAM MgFe-LDH hydrogel have been developed for intradiscal application. Extensive studies demonstrated sustained release and bioactivity of small molecules of these sustained release systems in vitro. Approach: The safety of intradiscal injection and biocompatibility of PEAMs is investigated in a canine early IVD degeneration model in chapter 2. Safety of this treatment is assessed by magnetic resonance imaging in vivo and at a biochemical, biomolecular, and histopathological level post mortem. Safe intradiscal application will support further in vitro and in vivo studies on degradation and release profiles of PEAMs loaded with bioactive substances, including growth factors. Aim 2: Evaluate the efficacy and safety of intradiscal application of rhBMP-7 in a canine IVD degeneration model. Rationale: Studies in rabbit models with induced IVD degeneration demonstrated a regenerative effect of only one single injection of rhBMP-7 on the IVD. Approach: As a first step to translate a treatment strategy based on growth factors towards a clinical application, in chapter 3 we investigate whether a single injection of rhBMP-7 will be safe and have similar effects in an animal model with spontaneous IVD degeneration. Based on the most effective and safe dose, follow-up studies can concentrated on developing controlled release systems for the sustained delivery of rhBMP-7.

General introduction, outline, and aims of this thesis | 27

Aim 3: Evaluate the efficacy and safety of sustained delivery of an anti-inflammatory drug by an intradiscally injected hydrogel in a canine IVD degeneration model. Rationale: As inflammation is thought to play an important role in the process of IVD degeneration and disease, sustained release of an anti-inflammatory drug is investigated to suppress inflammation and to restore IVD homeostasis. In vitro studies showed prolonged inhibition of inflammation when applying a pNIPAAM MgFe-LDH hydrogel loaded with a specific COX-2 inhibitor, celecoxib (CXB), compared with a CXB bolus formulation. Approach: First, safety and efficacy of sustained release of a low dose of CXB from this hydrogel is evaluated after intradiscal injection in the canine spontaneous IVD degeneration model. After confirming safety, a dose-response study is performed to determine the optimal loading dose of CXB (chapter 4). Aim 4: Investigate inflammatory profiles in canine intervertebral disc degeneration. Rationale: The clinical representation of IVD disease in veterinary medicine is diverse. Chondrodystrophic and non-chondrodystrophic dogs present with clinical IVD disease at different spinal locations and at different ages. Approach: In order to select canine patients that will benefit most of sustained release of CXB, we determine inflammatory mediators and matrix components in IVD samples that were collected during surgical treatment from CD and NCD dogs with and without clinical signs in chapter 5. Aim 5: Assess long-term outcome of treatment of dogs with degenerative lumbosacral stenosis (DLSS) treated with pedicle screw-rod fixation (PSRF) Rationale: Surgical management is the treatment of choice for dogs and humans with refractory symptoms of degenerative lumbar stenosis. Although the safety and efficacy of PSRF for the treatment of DLSS in large breed dogs has been established, long-term results and evaluation of spinal fusion were not reported thus far. Approach: In chapter 6 we assess the long-term outcome of treatment in dogs with severe DLSS. These dogs were referred to our University Hospital for Companion Animals specifically for this surgery because of failure from a previous decompressive surgery, or as a last resort treatment. In these patients the rigid PSRF construct is used in a permanent way to provide stability and promote spinal fusion. However, this type of construct can also provide temporary distraction of the IVD in patients with early clinical signs of DLSS, with the aim to regenerate the degenerated IVD. Therefore, in chapter 7 we evaluated the safety and efficacy of temporary IVD distraction by using PSRF in a canine patient with DLSS, in order to regenerate and repair the LS IVD.

28 | Chapter 1

References 1. 2.

3.

4. 5. 6. 7.

8. 9. 10. 11. 12.

13. 14. 15.

16. 17.

18. 19.

Andersson GB. Epidemiological features of chronic low-back pain. Lancet 1999 Aug 14;354(9178):581-5. Airaksinen O, Brox JI, Cedraschi C, Hildebrandt J, Klaber-Moffett J, Kovacs F, Mannion AF, Reis S, Staal JB, Ursin H, Zanoli G, COST B13 Working Group on Guidelines for Chronic Low Back Pain. Chapter 4. european guidelines for the management of chronic nonspecific low back pain. Eur Spine J 2006 Mar;15 Suppl 2:S192-300. Murray CJ, Vos T, Lozano R, et al. Disability-adjusted life years (DALYs) for 291 diseases and injuries in 21 regions, 1990-2010: A systematic analysis for the global burden of disease study 2010. Lancet 2012 Dec 15;380(9859):2197-223. Lambeek LC, van Tulder MW, Swinkels IC, Koppes LL, Anema JR, van Mechelen W. The trend in total cost of back pain in the netherlands in the period 2002 to 2007. Spine (Phila Pa 1976) 2011 Jun;36(13):1050-8. Cherkin DC, Deyo RA, Loeser JD, Bush T, Waddell G. An international comparison of back surgery rates. Spine (Phila Pa 1976) 1994 Jun 1;19(11):1201-6. Hestbaek L, Leboeuf-Yde C, Manniche C. Low back pain: What is the long-term course? A review of studies of general patient populations. Eur Spine J 2003 Apr;12(2):149-65. de Schepper EI, Damen J, van Meurs JB, Ginai AZ, Popham M, Hofman A, Koes BW, Bierma-Zeinstra SM. The association between lumbar disc degeneration and low back pain: The influence of age, gender, and individual radiographic features. Spine (Phila Pa 1976) 2010 Mar 1;35(5):531-6. DePalma MJ, Ketchum JM, Saullo T. What is the source of chronic low back pain and does age play a role? Pain Med 2011 Feb;12(2):224-33. Luoma K, Riihimaki H, Luukkonen R, Raininko R, Viikari-Juntura E, Lamminen A. Low back pain in relation to lumbar disc degeneration. Spine (Phila Pa 1976) 2000 Feb 15;25(4):487-92. van Tulder MW, Koes B, Malmivaara A. Outcome of non-invasive treatment modalities on back pain: An evidence-based review. Eur Spine J 2006 Jan;15 Suppl 1:S64-81. Hadler NM, Curtis P, Gillings DB, Stinnett S. A benefit of spinal manipulation as adjunctive therapy for acute low-back pain: A stratified controlled trial. Spine (Phila Pa 1976) 1987 Sep;12(7):702-6. Malmivaara A, Hakkinen U, Aro T, Heinrichs ML, Koskenniemi L, Kuosma E, Lappi S, Paloheimo R, Servo C, Vaaranen V. The treatment of acute low back pain--bed rest, exercises, or ordinary activity? N Engl J Med 1995 Feb 9;332(6):351-5. Berry H, Hutchinson DR. A multicentre placebo-controlled study in general practice to evaluate the efficacy and safety of tizanidine in acute low-back pain. J Int Med Res 1988 Mar-Apr;16(2):75-82. Salerno SM, Browning R, Jackson JL. The effect of antidepressant treatment on chronic back pain: A metaanalysis. Arch Intern Med 2002 Jan 14;162(1):19-24. Katz N, Ju WD, Krupa DA, Sperling RS, Bozalis Rodgers D, Gertz BJ, Gimbel J, Coleman S, Fisher C, Nabizadeh S, Borenstein D, Vioxx Chronic Low Back Pain Study Group. Efficacy and safety of rofecoxib in patients with chronic low back pain: Results from two 4-week, randomized, placebo-controlled, parallel-group, doubleblind trials. Spine (Phila Pa 1976) 2003 May 1;28(9):851,8; discussion 859. Schnitzer TJ. Update on guidelines for the treatment of chronic musculoskeletal pain. Clin Rheumatol 2006;25 Suppl 1:S22-9. Kole-Snijders AM, Vlaeyen JW, Goossens ME, Rutten-van Molken MP, Heuts PH, van Breukelen G, van Eek H. Chronic low-back pain: What does cognitive coping skills training add to operant behavioral treatment? results of a randomized clinical trial. J Consult Clin Psychol 1999 Dec;67(6):931-44. Glomsrod B, Lonn JH, Soukup MG, Bo K, Larsen S. "Active back school", prophylactic management for low back pain: Three-year follow-up of a randomized, controlled trial. J Rehabil Med 2001 Jan;33(1):26-30. Haldorsen EM, Kronholm K, Skouen JS, Ursin H. Multimodal cognitive behavioral treatment of patients sicklisted for musculoskeletal pain: A randomized controlled study. Scand J Rheumatol 1998;27(1):16-25.

General introduction, outline, and aims of this thesis | 29

20.

21.

22. 23.

24.

25.

26.

27. 28. 29.

30.

31. 32.

33. 34. 35. 36.

Arts MP, Peul WC, Koes BW, Thomeer RT, Leiden-The Hague Spine Intervention Prognostic Study (SIPS) Group. Management of sciatica due to lumbar disc herniation in the netherlands: A survey among spine surgeons. J Neurosurg Spine 2008 Jul;9(1):32-9. van den Eerenbeemt KD, Ostelo RW, van Royen BJ, Peul WC, van Tulder MW. Total disc replacement surgery for symptomatic degenerative lumbar disc disease: A systematic review of the literature. Eur Spine J 2010 Aug;19(8):1262-80. Bogduk N, Andersson G. Is spinal surgery effective for back pain? F1000 Med Rep 2009 Jul 27;1:10.3410/M1-60. Brox JI, Sorensen R, Friis A, Nygaard O, Indahl A, Keller A, Ingebrigtsen T, Eriksen HR, Holm I, Koller AK, Riise R, Reikeras O. Randomized clinical trial of lumbar instrumented fusion and cognitive intervention and exercises in patients with chronic low back pain and disc degeneration. Spine (Phila Pa 1976) 2003 Sep 1;28(17):1913-21. Fairbank J, Frost H, Wilson-MacDonald J, Yu LM, Barker K, Collins R, Spine Stabilisation Trial Group. Randomised controlled trial to compare surgical stabilisation of the lumbar spine with an intensive rehabilitation programme for patients with chronic low back pain: The MRC spine stabilisation trial. BMJ 2005 May 28;330(7502):1233. Fritzell P, Hagg O, Wessberg P, Nordwall A, Swedish Lumbar Spine Study Group. 2001 volvo award winner in clinical studies: Lumbar fusion versus nonsurgical treatment for chronic low back pain: A multicenter randomized controlled trial from the swedish lumbar spine study group. Spine (Phila Pa 1976) 2001 Dec 1;26(23):2521,32; discussion 2532-4. Froholdt A, Reikeraas O, Holm I, Keller A, Brox JI. No difference in 9-year outcome in CLBP patients randomized to lumbar fusion versus cognitive intervention and exercises. Eur Spine J 2012 Dec;21(12):2531-8. Ghiselli G, Wang JC, Bhatia NN, Hsu WK, Dawson EG. Adjacent segment degeneration in the lumbar spine. J Bone Joint Surg Am 2004 Jul;86-A(7):1497-503. Schizas C, Kulik G, Kosmopoulos V. Disc degeneration: Current surgical options. Eur Cell Mater 2010 Oct 16;20:306-15. Zigler JE, Delamarter RB. Five-year results of the prospective, randomized, multicenter, food and drug administration investigational device exemption study of the ProDisc-L total disc replacement versus circumferential arthrodesis for the treatment of single-level degenerative disc disease. J Neurosurg Spine 2012 Dec;17(6):493-501. Guyer RD, McAfee PC, Banco RJ, Bitan FD, Cappuccino A, Geisler FH, Hochschuler SH, Holt RT, Jenis LG, Majd ME, Regan JJ, Tromanhauser SG, Wong DC, Blumenthal SL. Prospective, randomized, multicenter food and drug administration investigational device exemption study of lumbar total disc replacement with the CHARITE artificial disc versus lumbar fusion: Five-year follow-up. Spine J 2009 May;9(5):374-86. Berg S, Tullberg T, Branth B, Olerud C, Tropp H. Total disc replacement compared to lumbar fusion: A randomised controlled trial with 2-year follow-up. Eur Spine J 2009 Oct;18(10):1512-9. Deyo RA, Dworkin SF, Amtmann D, Andersson G, Borenstein D, Carragee E, Carrino J, Chou R, Cook K, Delitto A, Goertz C, Khalsa P, Loeser J, Mackey S, Panagis J, Rainville J, Tosteson T, Turk D, Von Korff M, Weiner DK. Report of the NIH task force on research standards for chronic low back pain. Phys Ther 2015 Feb;95(2):e1-e18. Raj PP. Intervertebral disc: Anatomy-physiology-pathophysiology-treatment. Pain Pract 2008 JanFeb;8(1):18-44. Adams MA, Roughley PJ. What is intervertebral disc degeneration, and what causes it? Spine (Phila Pa 1976) 2006 Aug 15;31(18):2151-61. Roughley PJ. Biology of intervertebral disc aging and degeneration: Involvement of the extracellular matrix. Spine (Phila Pa 1976) 2004 Dec 1;29(23):2691-9. Risbud MV, Shapiro IM. Notochordal cells in the adult intervertebral disc: New perspective on an old question. Crit Rev Eukaryot Gene Expr 2011;21(1):29-41.

30 | Chapter 1

37. 38. 39.

40. 41. 42. 43. 44. 45. 46. 47.

48. 49. 50. 51.

52.

53.

54. 55. 56. 57. 58.

Roberts S, Evans H, Trivedi J, Menage J. Histology and pathology of the human intervertebral disc. J Bone Joint Surg Am 2006 Apr;88 Suppl 2:10-4. Urban JP, Smith S, Fairbank JC. Nutrition of the intervertebral disc. Spine (Phila Pa 1976) 2004 Dec 1;29(23):2700-9. Eskola PJ, Lemmela S, Kjaer P, Solovieva S, Mannikko M, Tommerup N, Lind-Thomsen A, HusgafvelPursiainen K, Cheung KM, Chan D, Samartzis D, Karppinen J. Genetic association studies in lumbar disc degeneration: A systematic review. PLoS One 2012;7(11):e49995. MacGregor AJ, Andrew T, Sambrook PN, Spector TD. Structural, psychological, and genetic influences on low back and neck pain: A study of adult female twins. Arthritis Rheum 2004 Apr 15;51(2):160-7. Setton LA, Chen J. Mechanobiology of the intervertebral disc and relevance to disc degeneration. J Bone Joint Surg Am 2006 Apr;88 Suppl 2:52-7. Adams MA, McMillan DW, Green TP, Dolan P. Sustained loading generates stress concentrations in lumbar intervertebral discs. Spine (Phila Pa 1976) 1996 Feb 15;21(4):434-8. Shiri R, Karppinen J, Leino-Arjas P, Solovieva S, Viikari-Juntura E. The association between smoking and low back pain: A meta-analysis. Am J Med 2010 Jan;123(1):87.e7,87.35. Shiri R, Karppinen J, Leino-Arjas P, Solovieva S, Viikari-Juntura E. The association between obesity and low back pain: A meta-analysis. Am J Epidemiol 2010 Jan 15;171(2):135-54. Buckwalter JA. Aging and degeneration of the human intervertebral disc. Spine (Phila Pa 1976) 1995 Jun 1;20(11):1307-14. Roberts S, Urban JP, Evans H, Eisenstein SM. Transport properties of the human cartilage endplate in relation to its composition and calcification. Spine (Phila Pa 1976) 1996 Feb 15;21(4):415-20. Gruber HE, Ingram JA, Norton HJ, Hanley EN,Jr. Senescence in cells of the aging and degenerating intervertebral disc: Immunolocalization of senescence-associated beta-galactosidase in human and sand rat discs. Spine (Phila Pa 1976) 2007 Feb 1;32(3):321-7. Aguiar DJ, Johnson SL, Oegema TR. Notochordal cells interact with nucleus pulposus cells: Regulation of proteoglycan synthesis. Exp Cell Res 1999 Jan 10;246(1):129-37. Ding F, Shao ZW, Xiong LM. Cell death in intervertebral disc degeneration. Apoptosis 2013 Jul;18(7):777-85. Risbud MV, Shapiro IM. Role of cytokines in intervertebral disc degeneration: Pain and disc content. Nat Rev Rheumatol 2014 Jan;10(1):44-56. Crean JK, Roberts S, Jaffray DC, Eisenstein SM, Duance VC. Matrix metalloproteinases in the human intervertebral disc: Role in disc degeneration and scoliosis. Spine (Phila Pa 1976) 1997 Dec 15;22(24):2877-84. Pockert AJ, Richardson SM, Le Maitre CL, Lyon M, Deakin JA, Buttle DJ, Freemont AJ, Hoyland JA. Modified expression of the ADAMTS enzymes and tissue inhibitor of metalloproteinases 3 during human intervertebral disc degeneration. Arthritis Rheum 2009 Feb;60(2):482-91. Bachmeier BE, Nerlich A, Mittermaier N, Weiler C, Lumenta C, Wuertz K, Boos N. Matrix metalloproteinase expression levels suggest distinct enzyme roles during lumbar disc herniation and degeneration. Eur Spine J 2009 Nov;18(11):1573-86. Le Maitre CL, Freemont AJ, Hoyland JA. Localization of degradative enzymes and their inhibitors in the degenerate human intervertebral disc. J Pathol 2004 Sep;204(1):47-54. Freemont AJ. The cellular pathobiology of the degenerate intervertebral disc and discogenic back pain. Rheumatology (Oxford) 2009 Jan;48(1):5-10. Freemont AJ, Peacock TE, Goupille P, Hoyland JA, O'Brien J, Jayson MI. Nerve ingrowth into diseased intervertebral disc in chronic back pain. Lancet 1997 Jul 19;350(9072):178-81. Brisby H. Pathology and possible mechanisms of nervous system response to disc degeneration. J Bone Joint Surg Am 2006 Apr;88 Suppl 2:68-71. Vaday GG, Lider O. Extracellular matrix moieties, cytokines, and enzymes: Dynamic effects on immune cell behavior and inflammation. J Leukoc Biol 2000 Feb;67(2):149-59.

General introduction, outline, and aims of this thesis | 31

59. 60.

61.

62.

63.

64. 65.

66.

67.

68. 69.

70.

71. 72.

73.

74. 75.

Noble PW. Hyaluronan and its catabolic products in tissue injury and repair. Matrix Biol 2002 Jan;21(1): 25-9. Shamji MF, Setton LA, Jarvis W, So S, Chen J, Jing L, Bullock R, Isaacs RE, Brown C, Richardson WJ. Proinflammatory cytokine expression profile in degenerated and herniated human intervertebral disc tissues. Arthritis Rheum 2010 Jul;62(7):1974-82. Kokubo Y, Uchida K, Kobayashi S, Yayama T, Sato R, Nakajima H, Takamura T, Mwaka E, Orwotho N, Bangirana A, Baba H. Herniated and spondylotic intervertebral discs of the human cervical spine: Histological and immunohistological findings in 500 en bloc surgical samples. laboratory investigation. J Neurosurg Spine 2008 Sep;9(3):285-95. Hegewald AA, Neumann K, Kalwitz G, Freymann U, Endres M, Schmieder K, Kaps C, Thome C. The chemokines CXCL10 and XCL1 recruit human annulus fibrosus cells. Spine (Phila Pa 1976) 2012 Jan 15;37(2):101-7. Phillips KL, Cullen K, Chiverton N, Michael AL, Cole AA, Breakwell LM, Haddock G, Bunning RA, Cross AK, Le Maitre CL. Potential roles of cytokines and chemokines in human intervertebral disc degeneration: Interleukin-1 is a master regulator of catabolic processes. Osteoarthritis Cartilage 2015 Jul;23(7):1165-77. Le Maitre CL, Freemont AJ, Hoyland JA. The role of interleukin-1 in the pathogenesis of human intervertebral disc degeneration. Arthritis Res Ther 2005;7(4):R732-45. Lee S, Moon CS, Sul D, Lee J, Bae M, Hong Y, Lee M, Choi S, Derby R, Kim BJ, Kim J, Yoon JS, Wolfer L, Kim J, Wang J, Hwang SW, Lee SH. Comparison of growth factor and cytokine expression in patients with degenerated disc disease and herniated nucleus pulposus. Clin Biochem 2009 Oct;42(15):1504-11. Weiler C, Nerlich AG, Bachmeier BE, Boos N. Expression and distribution of tumor necrosis factor alpha in human lumbar intervertebral discs: A study in surgical specimen and autopsy controls. Spine (Phila Pa 1976) 2005 Jan 1;30(1):44,53; discussion 54. Phillips KL, Chiverton N, Michael AL, Cole AA, Breakwell LM, Haddock G, Bunning RA, Cross AK, Le Maitre CL. The cytokine and chemokine expression profile of nucleus pulposus cells: Implications for degeneration and regeneration of the intervertebral disc. Arthritis Res Ther 2013;15(6):R213. Le Maitre CL, Hoyland JA, Freemont AJ. Catabolic cytokine expression in degenerate and herniated human intervertebral discs: IL-1beta and TNFalpha expression profile. Arthritis Res Ther 2007;9(4):R77. Seguin CA, Pilliar RM, Roughley PJ, Kandel RA. Tumor necrosis factor-alpha modulates matrix production and catabolism in nucleus pulposus tissue. Spine (Phila Pa 1976) 2005 Sep 1;30(17): 1940-8. Walter BA, Purmessur D, Likhitpanichkul M, Weinberg A, Cho SK, Qureshi SA, Hecht AC, Iatridis JC. Inflammatory kinetics and efficacy of anti-inflammatory treatments on human nucleus pulposus cells. Spine (Phila Pa 1976) 2015 Apr 14;40:455 - 963. Vo NV, Sowa GA, Kang JD, Seidel C, Studer RK. Prostaglandin E2 and prostaglandin F2alpha differentially modulate matrix metabolism of human nucleus pulposus cells. J Orthop Res 2010 Oct;28(10):1259-66. Wang J, Tian Y, Phillips KL, Chiverton N, Haddock G, Bunning RA, Cross AK, Shapiro IM, Le Maitre CL, Risbud MV. Tumor necrosis factor alpha- and interleukin-1beta-dependent induction of CCL3 expression by nucleus pulposus cells promotes macrophage migration through CCR1. Arthritis Rheum 2013 Mar;65(3):832-42. Kang JD, Georgescu HI, McIntyre-Larkin L, Stefanovic-Racic M, Evans CH. Herniated cervical intervertebral discs spontaneously produce matrix metalloproteinases, nitric oxide, interleukin-6, and prostaglandin E2. Spine (Phila Pa 1976) 1995 Nov 15;20(22):2373-8. Ahn SH, Cho YW, Ahn MW, Jang SH, Sohn YK, Kim HS. mRNA expression of cytokines and chemokines in herniated lumbar intervertebral discs. Spine (Phila Pa 1976) 2002 May 1;27(9):911-7. Kang JD, Georgescu HI, McIntyre-Larkin L, Stefanovic-Racic M, Donaldson WF,3rd, Evans CH. Herniated lumbar intervertebral discs spontaneously produce matrix metalloproteinases, nitric oxide, interleukin-6, and prostaglandin E2. Spine (Phila Pa 1976) 1996 Feb 1;21(3):271-7.

32 | Chapter 1

76.

77.

78. 79.

80. 81. 82.

83. 84.

85. 86. 87. 88.

89. 90. 91. 92. 93.

94. 95. 96.

Burke JG, Watson RW, McCormack D, Dowling FE, Walsh MG, Fitzpatrick JM. Intervertebral discs which cause low back pain secrete high levels of proinflammatory mediators. J Bone Joint Surg Br 2002 Mar;84(2):196-201. Freemont AJ, Watkins A, Le Maitre C, Baird P, Jeziorska M, Knight MT, Ross ER, O'Brien JP, Hoyland JA. Nerve growth factor expression and innervation of the painful intervertebral disc. J Pathol 2002 Jul;197(3):286-92. Bach FC, Willems N, Penning LC, Ito K, Meij BP, Tryfonidou MA. Potential regenerative treatment strategies for intervertebral disc degeneration in dogs. BMC Vet Res 2014 Jan 4;10:3,6148-10-3. Gantenbein B, Illien-Junger S, Chan SC, Walser J, Haglund L, Ferguson SJ, Iatridis JC, Grad S. Organ culture bioreactors--platforms to study human intervertebral disc degeneration and regenerative therapy. Curr Stem Cell Res Ther 2015;10(4):339-52. Alini M, Eisenstein SM, Ito K, Little C, Kettler AA, Masuda K, Melrose J, Ralphs J, Stokes I, Wilke HJ. Are animal models useful for studying human disc disorders/degeneration? Eur Spine J 2008 Jan;17(1):2-19. Lotz JC. Animal models of intervertebral disc degeneration: Lessons learned. Spine (Phila Pa 1976) 2004 Dec 1;29(23):2742-50. Rodrigues-Pinto R, Richardson SM, Hoyland JA. An understanding of intervertebral disc development, maturation and cell phenotype provides clues to direct cell-based tissue regeneration therapies for disc degeneration. Eur Spine J 2014 Sep;23(9):1803-14. Hunter CJ, Matyas JR, Duncan NA. Cytomorphology of notochordal and chondrocytic cells from the nucleus pulposus: A species comparison. J Anat 2004 Nov;205(5):357-62. Miyazaki T, Kobayashi S, Takeno K, Meir A, Urban J, Baba H. A phenotypic comparison of proteoglycan production of intervertebral disc cells isolated from rats, rabbits, and bovine tails; which animal model is most suitable to study tissue engineering and biological repair of human disc disorders? Tissue Eng Part A 2009 Dec;15(12):3835-46. Hunter CJ, Matyas JR, Duncan NA. The notochordal cell in the nucleus pulposus: A review in the context of tissue engineering. Tissue Eng 2003 Aug;9(4):667-77. Bray JP, Burbidge HM. The canine intervertebral disk: Part one: Structure and function. J Am Anim Hosp Assoc 1998 Jan-Feb;34(1):55-63. Hansen HJ. A pathologic-anatomical study on disc degeneration in dog, with special reference to the socalled enchondrosis intervertebralis. Acta Orthop Scand Suppl 1952;11:1-117. Ghosh P, Taylor TK, Braund KG, Larsen LH. A comparative chemical and histochemical study of the chondrodystrophoid and nonchondrodystrophoid canine intervertebral disc. Vet Pathol 1976;13(6): 414-27. Braund KG, Ghosh P, Taylor TK, Larsen LH. Morphological studies of the canine intervertebral disc. the assignment of the beagle to the achondroplastic classification. Res Vet Sci 1975 Sep;19(2):167-72. Brisson BA. Intervertebral disc disease in dogs. Vet Clin North Am Small Anim Pract 2010 Sep;40(5):829-58. Meij BP, Bergknut N. Degenerative lumbosacral stenosis in dogs. Vet Clin North Am Small Anim Pract 2010 Sep;40(5):983-1009. Hansen HJ. Comparative views of the pathology of disk degeneration in animals. Lab Invest 1959 NovDec;8:1242-65. Bergknut N, Egenvall A, Hagman R, Gustas P, Hazewinkel HA, Meij BP, Lagerstedt AS. Incidence of intervertebral disk degeneration-related diseases and associated mortality rates in dogs. J Am Vet Med Assoc 2012 Jun 1;240(11):1300-9. Schmied O, Golini L, Steffen F. Effectiveness of cervical hemilaminectomy in canine hansen type I and type II disc disease: A retrospective study. J Am Anim Hosp Assoc 2011 Sep-Oct;47(5):342-50. Cudia SP, Duval JM. Thoracolumbar intervertebral disk disease in large, nonchondrodystrophic dogs: A retrospective study. J Am Anim Hosp Assoc 1997 Sep-Oct;33(5):456-60. Macias C, McKee WM, May C, Innes JF. Thoracolumbar disc disease in large dogs: A study of 99 cases. J Small Anim Pract 2002 Oct;43(10):439-46.

General introduction, outline, and aims of this thesis | 33

97.

98.

99. 100.

101. 102.

103.

104.

105.

106.

107. 108. 109.

110. 111.

112.

113. 114.

Suwankong N, Meij BP, Voorhout G, de Boer AH, Hazewinkel HA. Review and retrospective analysis of degenerative lumbosacral stenosis in 156 dogs treated by dorsal laminectomy. Vet Comp Orthop Traumatol 2008;21(3):285-93. Levine JM, Levine GJ, Kerwin SC, Hettlich BF, Fosgate GT. Association between various physical factors and acute thoracolumbar intervertebral disk extrusion or protrusion in dachshunds. J Am Vet Med Assoc 2006 Aug 1;229(3):370-5. da Costa RC. Cervical spondylomyelopathy (wobbler syndrome) in dogs. Vet Clin North Am Small Anim Pract 2010 Sep;40(5):881-913. Sharp NJH, Wheeler SJ. Thoracolumbar and lumbosacral disease, in sharp N.J.H., wheeler, S.J. (eds): Small animal spinal disorders. diagnosis and surgery. In: N. J. H. Sharp, S. J. Wheeler, editors. 2nd ed. Edinburgh: Elsevier Mosby; 2005. p 121-209. Smolders LA, Voorhout G, van de Ven R, Bergknut N, Grinwis GC, Hazewinkel HA, Meij BP. Pedicle screwrod fixation of the canine lumbosacral junction. Vet Surg 2012 Aug;41(6):720-32. Levine JM, Levine GJ, Johnson SI, Kerwin SC, Hettlich BF, Fosgate GT. Evaluation of the success of medical management for presumptive thoracolumbar intervertebral disk herniation in dogs. Vet Surg 2007 Jul;36(5):482-91. Bergknut N, Rutges JP, Kranenburg HC, Smolders LA, Hagman R, Smidt HJ, Lagerstedt AS, Penning LC, Voorhout G, Hazewinkel HA, Grinwis GC, Creemers LB, Meij BP, Dhert WJ. The dog as an animal model for intervertebral disc degeneration? Spine (Phila Pa 1976) 2012 Mar 1;37(5):351-8. Smolders LA, Bergknut N, Grinwis GC, Hagman R, Lagerstedt AS, Hazewinkel HA, Tryfonidou MA, Meij BP. Intervertebral disc degeneration in the dog. part 2: Chondrodystrophic and non-chondrodystrophic breeds. Vet J 2013 Mar;195(3):292-9. Ganey T, Hutton WC, Moseley T, Hedrick M, Meisel HJ. Intervertebral disc repair using adipose tissuederived stem and regenerative cells: Experiments in a canine model. Spine (Phila Pa 1976) 2009 Oct 1;34(21):2297-304. Meisel HJ, Siodla V, Ganey T, Minkus Y, Hutton WC, Alasevic OJ. Clinical experience in cell-based therapeutics: Disc chondrocyte transplantation A treatment for degenerated or damaged intervertebral disc. Biomol Eng 2007 Feb;24(1):5-21. Hohaus C, Ganey TM, Minkus Y, Meisel HJ. Cell transplantation in lumbar spine disc degeneration disease. Eur Spine J 2008 Dec;17 Suppl 4:492-503. Hiyama A, Mochida J, Iwashina T, Omi H, Watanabe T, Serigano K, Tamura F, Sakai D. Transplantation of mesenchymal stem cells in a canine disc degeneration model. J Orthop Res 2008 May;26(5):589-600. Risbud MV, Guttapalli A, Tsai TT, Lee JY, Danielson KG, Vaccaro AR, Albert TJ, Gazit Z, Gazit D, Shapiro IM. Evidence for skeletal progenitor cells in the degenerate human intervertebral disc. Spine (Phila Pa 1976) 2007 Nov 1;32(23):2537-44. Henriksson HB, Brisby H. Development and regeneration potential of the mammalian intervertebral disc. Cells Tissues Organs 2013;197(1):1-13. Sakai D, Nakamura Y, Nakai T, Mishima T, Kato S, Grad S, Alini M, Risbud MV, Chan D, Cheah KS, Yamamura K, Masuda K, Okano H, Ando K, Mochida J. Exhaustion of nucleus pulposus progenitor cells with ageing and degeneration of the intervertebral disc. Nat Commun 2012;3:1264. Feng G, Yang X, Shang H, Marks IW, Shen FH, Katz A, Arlet V, Laurencin CT, Li X. Multipotential differentiation of human anulus fibrosus cells: An in vitro study. J Bone Joint Surg Am 2010 Mar;92(3): 675-85. Huang YC, Leung VY, Lu WW, Luk KD. The effects of microenvironment in mesenchymal stem cell-based regeneration of intervertebral disc. Spine J 2013 Mar;13(3):352-62. Liu LT, Huang B, Li CQ, Zhuang Y, Wang J, Zhou Y. Characteristics of stem cells derived from the degenerated human intervertebral disc cartilage endplate. PLoS One 2011;6(10):e26285.

34 | Chapter 1

115.

116.

117. 118.

119.

120.

121. 122.

123. 124.

125. 126.

127. 128. 129. 130. 131.

132. 133.

Huang S, Leung VY, Long D, Chan D, Lu WW, Cheung KM, Zhou G. Coupling of small leucine-rich proteoglycans to hypoxic survival of a progenitor cell-like subpopulation in rhesus macaque intervertebral disc. Biomaterials 2013 Sep;34(28):6548-58. Erwin WM, Islam D, Eftekarpour E, Inman RD, Karim MZ, Fehlings MG. Intervertebral disc-derived stem cells: Implications for regenerative medicine and neural repair. Spine (Phila Pa 1976) 2013 Feb 1;38(3):211-6. Wang F, Shi R, Cai F, Wang YT, Wu XT. Stem cell approaches to intervertebral disc regeneration obstacles from the disc microenvironment. Stem Cells Dev 2015 Jul 31. Choi KS, Cohn MJ, Harfe BD. Identification of nucleus pulposus precursor cells and notochordal remnants in the mouse: Implications for disk degeneration and chordoma formation. Dev Dyn 2008 Dec;237(12):3953-8. Sakai D, Nishimura K, Tanaka M, Nakajima D, Grad S, Alini M, Kawada H, Ando K, Mochida J. Migration of bone marrow-derived cells for endogenous repair in a new tail-looping disc degeneration model in the mouse: A pilot study. Spine J 2015 Jun 1;15(6):1356-65. Navone SE, Marfia G, Canzi L, Ciusani E, Canazza A, Visintini S, Campanella R, Parati EA. Expression of neural and neurotrophic markers in nucleus pulposus cells isolated from degenerated intervertebral disc. J Orthop Res 2012 Sep;30(9):1470-7. Benneker LM, Andersson G, Iatridis JC, Sakai D, Hartl R, Ito K, Grad S. Cell therapy for intervertebral disc repair: Advancing cell therapy from bench to clinics. Eur Cell Mater 2014 May 6;27:5-11. Wiegant K, Intema F, van Roermund PM, Barten-van Rijbroek AD, Doornebal A, Hazewinkel HA, Lafeber FP, Mastbergen SC. Evidence of cartilage repair by joint distraction in a canine model of osteoarthritis. Arthritis Rheumatol 2015 Feb;67(2):465-74. Waller C, Hayes D, Block JE, London NJ. Unload it: The key to the treatment of knee osteoarthritis. Knee Surg Sports Traumatol Arthrosc 2011 Nov;19(11):1823-9. van Valburg AA, van Roy HL, Lafeber FP, Bijlsma JW. Beneficial effects of intermittent fluid pressure of low physiological magnitude on cartilage and inflammation in osteoarthritis. an in vitro study. J Rheumatol 1998 Mar;25(3):515-20. Wilke HJ, Drumm J, Haussler K, Mack C, Steudel WI, Kettler A. Biomechanical effect of different lumbar interspinous implants on flexibility and intradiscal pressure. Eur Spine J 2008 Aug;17(8):1049-56. Buric J, Pulidori M. Long-term reduction in pain and disability after surgery with the interspinous device for intervertebral assisted motion (DIAM) spinal stabilization system in patients with low back pain: 4-year follow-up from a longitudinal prospective case series. Eur Spine J 2011 Aug;20(8):1304-11. Wang SL, Yu YL, Tang CL, Lv FZ. Effects of TGF-beta1 and IL-1beta on expression of ADAMTS enzymes and TIMP-3 in human intervertebral disc degeneration. Exp Ther Med 2013 Dec;6(6):1522-6. Thompson JP, Oegema TR,Jr, Bradford DS. Stimulation of mature canine intervertebral disc by growth factors. Spine (Phila Pa 1976) 1991 Mar;16(3):253-60. Walsh AJ, Bradford DS, Lotz JC. In vivo growth factor treatment of degenerated intervertebral discs. Spine (Phila Pa 1976) 2004 Jan 15;29(2):156-63. Murakami H, Yoon ST, Attallah-Wasif ES, Tsai KJ, Fei Q, Hutton WC. The expression of anabolic cytokines in intervertebral discs in age-related degeneration. Spine (Phila Pa 1976) 2006 Jul 15;31(16):1770-4. Sowa G, Vadala G, Studer R, Kompel J, Iucu C, Georgescu H, Gilbertson L, Kang J. Characterization of intervertebral disc aging: Longitudinal analysis of a rabbit model by magnetic resonance imaging, histology, and gene expression. Spine (Phila Pa 1976) 2008 Aug 1;33(17):1821-8. Than KD, Rahman SU, Vanaman MJ, Wang AC, Lin CY, Zhang H, La Marca F, Park P. Bone morphogenetic proteins and degenerative disk disease. Neurosurgery 2012 Apr;70(4):996,1002; discussion 1002. Omlor GW, Lorenz H, Engelleiter K, Richter W, Carstens C, Kroeber MW, Guehring T. Changes in gene expression and protein distribution at different stages of mechanically induced disc degeneration--an in vivo study on the new zealand white rabbit. J Orthop Res 2006 Mar;24(3):385-92.

General introduction, outline, and aims of this thesis | 35

134.

135.

136. 137.

138.

139.

140.

141.

142.

143. 144.

145.

146. 147.

148.

149.

Guehring T, Omlor GW, Lorenz H, Bertram H, Steck E, Richter W, Carstens C, Kroeber M. Stimulation of gene expression and loss of anular architecture caused by experimental disc degeneration--an in vivo animal study. Spine (Phila Pa 1976) 2005 Nov 15;30(22):2510-5. Sobajima S, Shimer AL, Chadderdon RC, Kompel JF, Kim JS, Gilbertson LG, Kang JD. Quantitative analysis of gene expression in a rabbit model of intervertebral disc degeneration by real-time polymerase chain reaction. Spine J 2005 Jan-Feb;5(1):14-23. Li J, Yoon ST, Hutton WC. Effect of bone morphogenetic protein-2 (BMP-2) on matrix production, other BMPs, and BMP receptors in rat intervertebral disc cells. J Spinal Disord Tech 2004 Oct;17(5):423-8. Tim Yoon S, Su Kim K, Li J, Soo Park J, Akamaru T, Elmer WA, Hutton WC. The effect of bone morphogenetic protein-2 on rat intervertebral disc cells in vitro. Spine (Phila Pa 1976) 2003 Aug 15;28(16):1773-80. Kim DJ, Moon SH, Kim H, Kwon UH, Park MS, Han KJ, Hahn SB, Lee HM. Bone morphogenetic protein-2 facilitates expression of chondrogenic, not osteogenic, phenotype of human intervertebral disc cells. Spine (Phila Pa 1976) 2003 Dec 15;28(24):2679-84. Gilbertson L, Ahn SH, Teng PN, Studer RK, Niyibizi C, Kang JD. The effects of recombinant human bone morphogenetic protein-2, recombinant human bone morphogenetic protein-12, and adenoviral bone morphogenetic protein-12 on matrix synthesis in human annulus fibrosis and nucleus pulposus cells. Spine J 2008 May-Jun;8(3):449-56. Lee KI, Moon SH, Kim H, Kwon UH, Kim HJ, Park SN, Suh H, Lee HM, Kim HS, Chun HJ, Kwon IK, Jang JW. Tissue engineering of the intervertebral disc with cultured nucleus pulposus cells using atelocollagen scaffold and growth factors. Spine (Phila Pa 1976) 2012 Mar 15;37(6):452-8. Fei QM, Jiang XX, Chen TY, Li J, Murakami H, Tsai KJ, Hutton WC. Changes with age and the effect of recombinant human BMP-2 on proteoglycan and collagen gene expression in rabbit anulus fibrosus cells. Acta Biochim Biophys Sin (Shanghai) 2006 Nov;38(11):773-9. Zhang Y, An HS, Thonar EJ, Chubinskaya S, He TC, Phillips FM. Comparative effects of bone morphogenetic proteins and sox9 overexpression on extracellular matrix metabolism of bovine nucleus pulposus cells. Spine (Phila Pa 1976) 2006 Sep 1;31(19):2173-9. Kong MH, Do DH, Miyazaki M, Wei F, Yoon SH, Wang JC. Rabbit model for in vivo study of intervertebral disc degeneration and regeneration. J Korean Neurosurg Soc 2008 Nov;44(5):327-33. Huang KY, Yan JJ, Hsieh CC, Chang MS, Lin RM. The in vivo biological effects of intradiscal recombinant human bone morphogenetic protein-2 on the injured intervertebral disc: An animal experiment. Spine (Phila Pa 1976) 2007 May 15;32(11):1174-80. Chen P, Vukicevic S, Sampath TK, Luyten FP. Bovine articular chondrocytes do not undergo hypertrophy when cultured in the presence of serum and osteogenic protein-1. Biochem Biophys Res Commun 1993 Dec 30;197(3):1253-9. Chubinskaya S, Kuettner KE. Regulation of osteogenic proteins by chondrocytes. Int J Biochem Cell Biol 2003 Sep;35(9):1323-40. Flechtenmacher J, Huch K, Thonar EJ, Mollenhauer JA, Davies SR, Schmid TM, Puhl W, Sampath TK, Aydelotte MB, Kuettner KE. Recombinant human osteogenic protein 1 is a potent stimulator of the synthesis of cartilage proteoglycans and collagens by human articular chondrocytes. Arthritis Rheum 1996 Nov;39(11):1896-904. Imai Y, Miyamoto K, An HS, Thonar EJ, Andersson GB, Masuda K. Recombinant human osteogenic protein1 upregulates proteoglycan metabolism of human anulus fibrosus and nucleus pulposus cells. Spine (Phila Pa 1976) 2007 May 20;32(12):1303,9; discussion 1310. Kawakami M, Matsumoto T, Hashizume H, Kuribayashi K, Chubinskaya S, Yoshida M. Osteogenic protein-1 (osteogenic protein-1/bone morphogenetic protein-7) inhibits degeneration and pain-related behavior induced by chronically compressed nucleus pulposus in the rat. Spine (Phila Pa 1976) 2005 Sep 1;30(17):1933-9.

36 | Chapter 1

150. 151.

152.

153.

154. 155.

156.

157.

158.

159. 160.

161. 162. 163. 164. 165.

166. 167.

Wei A, Brisby H, Chung SA, Diwan AD. Bone morphogenetic protein-7 protects human intervertebral disc cells in vitro from apoptosis. Spine J 2008 May-Jun;8(3):466-74. Takegami K, Thonar EJ, An HS, Kamada H, Masuda K. Osteogenic protein-1 enhances matrix replenishment by intervertebral disc cells previously exposed to interleukin-1. Spine (Phila Pa 1976) 2002 Jun 15;27(12):1318-25. An HS, Takegami K, Kamada H, Nguyen CM, Thonar EJ, Singh K, Andersson GB, Masuda K. Intradiscal administration of osteogenic protein-1 increases intervertebral disc height and proteoglycan content in the nucleus pulposus in normal adolescent rabbits. Spine (Phila Pa 1976) 2005 Jan 1;30(1):25,31; discussion 31-2. Masuda K, Imai Y, Okuma M, Muehleman C, Nakagawa K, Akeda K, Thonar E, Andersson G, An HS. Osteogenic protein-1 injection into a degenerated disc induces the restoration of disc height and structural changes in the rabbit anular puncture model. Spine (Phila Pa 1976) 2006 Apr 1;31(7):742-54. Chubinskaya S, Kawakami M, Rappoport L, Matsumoto T, Migita N, Rueger DC. Anti-catabolic effect of OP1 in chronically compressed intervertebral discs. J Orthop Res 2007 Apr;25(4):517-30. Chaofeng W, Chao Z, Deli W, Jianhong W, Yan Z, Cheng X, Hongkui X, Qing H, Dike R. Nucleus pulposus cells expressing hBMP7 can prevent the degeneration of allogenic IVD in a canine transplantation model. J Orthop Res 2013 Sep;31(9):1366-73. Li H, Tao Y, Liang C, Han B, Li F, Chen G, Chen Q. Influence of hypoxia in the intervertebral disc on the biological behaviors of rat adipose- and nucleus pulposus-derived mesenchymal stem cells. Cells Tissues Organs 2013;198(4):266-77. Chujo T, An HS, Akeda K, Miyamoto K, Muehleman C, Attawia M, Andersson G, Masuda K. Effects of growth differentiation factor-5 on the intervertebral disc--in vitro bovine study and in vivo rabbit disc degeneration model study. Spine (Phila Pa 1976) 2006 Dec 1;31(25):2909-17. Yan J, Yang S, Sun H, Guo D, Wu B, Ji F, Zhou D. Effects of releasing recombinant human growth and differentiation factor-5 from poly(lactic-co-glycolic acid) microspheres for repair of the rat degenerated intervertebral disc. J Biomater Appl 2013 Dec 10;29(1):72-80. Pratsinis H, Kletsas D. PDGF, bFGF and IGF-I stimulate the proliferation of intervertebral disc cells in vitro via the activation of the ERK and akt signaling pathways. Eur Spine J 2007 Nov;16(11):1858-66. Osada R, Ohshima H, Ishihara H, Yudoh K, Sakai K, Matsui H, Tsuji H. Autocrine/paracrine mechanism of insulin-like growth factor-1 secretion, and the effect of insulin-like growth factor-1 on proteoglycan synthesis in bovine intervertebral discs. J Orthop Res 1996 Sep;14(5):690-9. Gruber HE, Norton HJ, Hanley EN,Jr. Anti-apoptotic effects of IGF-1 and PDGF on human intervertebral disc cells in vitro. Spine (Phila Pa 1976) 2000 Sep 1;25(17):2153-7. Kuo YJ, Wu LC, Sun JS, Chen MH, Sun MG, Tsuang YH. Mechanical stress-induced apoptosis of nucleus pulposus cells: An in vitro and in vivo rat model. J Orthop Sci 2014 Mar;19(2):313-22. Kruger JP, Freymannx U, Vetterlein S, Neumann K, Endres M, Kaps C. Bioactive factors in platelet-rich plasma obtained by apheresis. Transfus Med Hemother 2013 Dec;40(6):432-40. Wang SZ, Chang Q, Lu J, Wang C. Growth factors and platelet-rich plasma: Promising biological strategies for early intervertebral disc degeneration. Int Orthop 2015 May;39(5):927-34. Chen WH, Lo WC, Lee JJ, Su CH, Lin CT, Liu HY, Lin TW, Lin WC, Huang TY, Deng WP. Tissue-engineered intervertebral disc and chondrogenesis using human nucleus pulposus regulated through TGF-beta1 in platelet-rich plasma. J Cell Physiol 2006 Dec;209(3):744-54. Pirvu TN, Schroeder JE, Peroglio M, Verrier S, Kaplan L, Richards RG, Alini M, Grad S. Platelet-rich plasma induces annulus fibrosus cell proliferation and matrix production. Eur Spine J 2014 Apr;23(4):745-53. Chen WH, Liu HY, Lo WC, Wu SC, Chi CH, Chang HY, Hsiao SH, Wu CH, Chiu WT, Chen BJ, Deng WP. Intervertebral disc regeneration in an ex vivo culture system using mesenchymal stem cells and plateletrich plasma. Biomaterials 2009 Oct;30(29):5523-33.

General introduction, outline, and aims of this thesis | 37

168.

169.

170.

171. 172. 173. 174. 175. 176. 177.

178. 179. 180.

181.

182.

183.

184.

185. 186. 187.

Akeda K, An HS, Pichika R, Attawia M, Thonar EJ, Lenz ME, Uchida A, Masuda K. Platelet-rich plasma (PRP) stimulates the extracellular matrix metabolism of porcine nucleus pulposus and anulus fibrosus cells cultured in alginate beads. Spine (Phila Pa 1976) 2006 Apr 20;31(9):959-66. Obata S, Akeda K, Imanishi T, Masuda K, Bae W, Morimoto R, Asanuma Y, Kasai Y, Uchida A, Sudo A. Effect of autologous platelet-rich plasma-releasate on intervertebral disc degeneration in the rabbit anular puncture model: A preclinical study. Arthritis Res Ther 2012 Nov 5;14(6):R241. Gullung GB, Woodall JW, Tucci MA, James J, Black DA, McGuire RA. Platelet-rich plasma effects on degenerative disc disease: Analysis of histology and imaging in an animal model. Evid Based Spine Care J 2011 Nov;2(4):13-8. Hu X, Wang C, Rui Y. An experimental study on effect of autologous platelet-rich plasma on treatment of early intervertebral disc degeneration. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi 2012 Aug;26(8):977-83. Sakai D, Grad S. Advancing the cellular and molecular therapy for intervertebral disc disease. Adv Drug Deliv Rev 2015 Apr;84:159-71. Bibby SR, Jones DA, Lee RB, Yu J, Urban JPG. The pathophysiology of the intervertebral disc. Joint Bone Spine 2001 Dec;68(6):537-42. Richardson SM, Mobasheri A, Freemont AJ, Hoyland JA. Intervertebral disc biology, degeneration and novel tissue engineering and regenerative medicine therapies. Histol Histopathol 2007 Sep;22(9):1033-41. Nomura T, Mochida J, Okuma M, Nishimura K, Sakabe K. Nucleus pulposus allograft retards intervertebral disc degeneration. Clin Orthop Relat Res 2001 Aug;(389)(389):94-101. Nishimura K, Mochida J. Percutaneous reinsertion of the nucleus pulposus. an experimental study. Spine (Phila Pa 1976) 1998 Jul 15;23(14):1531,8; discussion 1539. Gruber HE, Johnson TL, Leslie K, Ingram JA, Martin D, Hoelscher G, Banks D, Phieffer L, Coldham G, Hanley EN,Jr. Autologous intervertebral disc cell implantation: A model using psammomys obesus, the sand rat. Spine (Phila Pa 1976) 2002 Aug 1;27(15):1626-33. Coric D, Pettine K, Sumich A, Boltes MO. Prospective study of disc repair with allogeneic chondrocytes presented at the 2012 joint spine section meeting. J Neurosurg Spine 2013 Jan;18(1):85-95. Nombela-Arrieta C, Ritz J, Silberstein LE. The elusive nature and function of mesenchymal stem cells. Nat Rev Mol Cell Biol 2011 Feb;12(2):126-31. Sakai D, Mochida J, Yamamoto Y, Nomura T, Okuma M, Nishimura K, Nakai T, Ando K, Hotta T. Transplantation of mesenchymal stem cells embedded in atelocollagen gel to the intervertebral disc: A potential therapeutic model for disc degeneration. Biomaterials 2003 Sep;24(20):3531-41. Sakai D, Mochida J, Iwashina T, Watanabe T, Nakai T, Ando K, Hotta T. Differentiation of mesenchymal stem cells transplanted to a rabbit degenerative disc model: Potential and limitations for stem cell therapy in disc regeneration. Spine (Phila Pa 1976) 2005 Nov 1;30(21):2379-87. Sakai D, Mochida J, Iwashina T, Hiyama A, Omi H, Imai M, Nakai T, Ando K, Hotta T. Regenerative effects of transplanting mesenchymal stem cells embedded in atelocollagen to the degenerated intervertebral disc. Biomaterials 2006 Jan;27(3):335-45. Zhang Y, Drapeau S, Howard SA, Thonar EJ, Anderson DG. Transplantation of goat bone marrow stromal cells to the degenerating intervertebral disc in a goat disc injury model. Spine (Phila Pa 1976) 2011 Mar 1;36(5):372-7. Henriksson HB, Svanvik T, Jonsson M, Hagman M, Horn M, Lindahl A, Brisby H. Transplantation of human mesenchymal stems cells into intervertebral discs in a xenogeneic porcine model. Spine (Phila Pa 1976) 2009 Jan 15;34(2):141-8. Vert M. Not any new functional polymer can be for medicine: What about artificial biopolymers? Macromol Biosci 2011 Dec 8;11(12):1653-61. Hoffman AS. Hydrogels for biomedical applications. Adv Drug Deliv Rev 2012 Sep 14. Moss IL, Gordon L, Woodhouse KA, Whyne CM, Yee AJ. A novel thiol-modified hyaluronan and elastin-like polypetide composite material for tissue engineering of the nucleus pulposus of the intervertebral disc. Spine (Phila Pa 1976) 2011 Jun;36(13):1022-9.

38 | Chapter 1

188.

189.

190.

191. 192.

193.

194. 195. 196.

197.

198.

199. 200.

201. 202.

203. 204. 205.

Mwale F, Iordanova M, Demers CN, Steffen T, Roughley P, Antoniou J. Biological evaluation of chitosan salts cross-linked to genipin as a cell scaffold for disk tissue engineering. Tissue Eng 2005 Jan-Feb; 11(1-2):130-40. Frith JE, Menzies DJ, Cameron AR, Ghosh P, Whitehead DL, Gronthos S, Zannettino AC, Cooper-White JJ. Effects of bound versus soluble pentosan polysulphate in PEG/HA-based hydrogels tailored for intervertebral disc regeneration. Biomaterials 2014 Jan;35(4):1150-62. Frith JE, Cameron AR, Menzies DJ, Ghosh P, Whitehead DL, Gronthos S, Zannettino AC, Cooper-White JJ. An injectable hydrogel incorporating mesenchymal precursor cells and pentosan polysulphate for intervertebral disc regeneration. Biomaterials 2013 Dec;34(37):9430-40. Collin EC, Grad S, Zeugolis DI, Vinatier CS, Clouet JR, Guicheux JJ, Weiss P, Alini M, Pandit AS. An injectable vehicle for nucleus pulposus cell-based therapy. Biomaterials 2011 Apr;32(11):2862-70. Henriksson HB, Hagman M, Horn M, Lindahl A, Brisby H. Investigation of different cell types and gel carriers for cell-based intervertebral disc therapy, in vitro and in vivo studies. J Tissue Eng Regen Med 2012 Oct;6(9):738-47. Ghosh P, Moore R, Vernon-Roberts B, Goldschlager T, Pascoe D, Zannettino A, Gronthos S, Itescu S. Immunoselected STRO-3+ mesenchymal precursor cells and restoration of the extracellular matrix of degenerate intervertebral discs. J Neurosurg Spine 2012 May;16(5):479-88. Zhu J. Bioactive modification of poly(ethylene glycol) hydrogels for tissue engineering. Biomaterials 2010 Jun;31(17):4639-56. Raeber GP, Lutolf MP, Hubbell JA. Molecularly engineered PEG hydrogels: A novel model system for proteolytically mediated cell migration. Biophys J 2005 Aug;89(2):1374-88. Scholz B, Kinzelmann C, Benz K, Mollenhauer J, Wurst H, Schlosshauer B. Suppression of adverse angiogenesis in an albumin-based hydrogel for articular cartilage and intervertebral disc regeneration. Eur Cell Mater 2010 Jul 13;20:24,36; discussion 36-7. Benz K, Stippich C, Fischer L, Mohl K, Weber K, Lang J, Steffen F, Beintner B, Gaissmaier C, Mollenhauer JA. Intervertebral disc cell- and hydrogel-supported and spontaneous intervertebral disc repair in nucleotomized sheep. Eur Spine J 2012 Sep;21(9):1758-68. Peroglio M, Eglin D, Benneker LM, Alini M, Grad S. Thermoreversible hyaluronan-based hydrogel supports in vitro and ex vivo disc-like differentiation of human mesenchymal stem cells. Spine J 2013 Nov;13(11):1627-39. Richardson SM, Hughes N, Hunt JA, Freemont AJ, Hoyland JA. Human mesenchymal stem cell differentiation to NP-like cells in chitosan-glycerophosphate hydrogels. Biomaterials 2008 Jan;29(1):85-93. Roughley P, Hoemann C, DesRosiers E, Mwale F, Antoniou J, Alini M. The potential of chitosan-based gels containing intervertebral disc cells for nucleus pulposus supplementation. Biomaterials 2006 Jan;27(3):388-96. Bikram M, West JL. Thermo-responsive systems for controlled drug delivery. Expert Opin Drug Deliv 2008 Oct;5(10):1077-91. Crevensten G, Walsh AJ, Ananthakrishnan D, Page P, Wahba GM, Lotz JC, Berven S. Intervertebral disc cell therapy for regeneration: Mesenchymal stem cell implantation in rat intervertebral discs. Ann Biomed Eng 2004 Mar;32(3):430-4. Cheng YH, Yang SH, Lin FH. Thermosensitive chitosan-gelatin-glycerol phosphate hydrogel as a controlled release system of ferulic acid for nucleus pulposus regeneration. Biomaterials 2011 Oct;32(29):6953-61. Cheng YH, Yang SH, Liu CC, Gefen A, Lin FH. Thermosensitive hydrogel made of ferulic acid-gelatin and chitosan glycerophosphate. Carbohydr Polym 2013 Feb 15;92(2):1512-9. Nagae M, Ikeda T, Mikami Y, Hase H, Ozawa H, Matsuda K, Sakamoto H, Tabata Y, Kawata M, Kubo T. Intervertebral disc regeneration using platelet-rich plasma and biodegradable gelatin hydrogel microspheres. Tissue Eng 2007 Jan;13(1):147-58.

General introduction, outline, and aims of this thesis | 39

206.

207.

208.

209.

210.

211. 212. 213. 214. 215.

216.

217.

218. 219.

220.

221.

222.

223.

Sawamura K, Ikeda T, Nagae M, Okamoto S, Mikami Y, Hase H, Ikoma K, Yamada T, Sakamoto H, Matsuda K, Tabata Y, Kawata M, Kubo T. Characterization of in vivo effects of platelet-rich plasma and biodegradable gelatin hydrogel microspheres on degenerated intervertebral discs. Tissue Eng Part A 2009 Dec;15(12):3719-27. Gorth DJ, Mauck RL, Chiaro JA, Mohanraj B, Hebela NM, Dodge GR, Elliott DM, Smith LJ. IL-1ra delivered from poly(lactic-co-glycolic acid) microspheres attenuates IL-1beta-mediated degradation of nucleus pulposus in vitro. Arthritis Res Ther 2012 Aug 3;14(4):R179. Liang CZ, Li H, Tao YQ, Zhou XP, Yang ZR, Xiao YX, Li FC, Han B, Chen QX. Dual delivery for stem cell differentiation using dexamethasone and bFGF in/on polymeric microspheres as a cell carrier for nucleus pulposus regeneration. J Mater Sci Mater Med 2012 Apr;23(4):1097-107. Liang CZ, Li H, Tao YQ, Peng LH, Gao JQ, Wu JJ, Li FC, Hua JM, Chen QX. Dual release of dexamethasone and TGF-beta3 from polymeric microspheres for stem cell matrix accumulation in a rat disc degeneration model. Acta Biomater 2013 Dec;9(12):9423-33. Ragab AA, Woodall JW,Jr, Tucci MA, Wingerter SA, Fosnaugh AW, Franklin LN, Benghuzzi HA. A preliminary report on the effects of sustained administration of corticosteroid on traumatized disc using the adult male rat model. J Spinal Disord Tech 2009 Oct;22(7):473-8. Deyo RA, Weinstein JN. Low back pain. N Engl J Med 2001 Feb 1;344(5):363-70. Lafeber FP, Intema F, Van Roermund PM, Marijnissen AC. Unloading joints to treat osteoarthritis, including joint distraction. Curr Opin Rheumatol 2006 Sep;18(5):519-25. Urban JP, Roberts S. Degeneration of the intervertebral disc. Arthritis Res Ther 2003;5(3):120-30. Gay RE, Ilharreborde B, Zhao KD, Berglund LJ, Bronfort G, An KN. Stress in lumbar intervertebral discs during distraction: A cadaveric study. Spine J 2008 Nov-Dec;8(6):982-90. Boden SD, Andersson GB, Fraser RD, Garfin SR, Goel VK, Hanley EN,Jr, Katz JN, Pope MH, Sonntag VK, Spratt KF. Selection of the optimal procedure to achieve lumbar spinal fusion. introduction. 1995 focus issue meeting on fusion. Spine (Phila Pa 1976) 1995 Dec 15;20(24 Suppl):166S. Kaito T, Hosono N, Mukai Y, Makino T, Fuji T, Yonenobu K. Induction of early degeneration of the adjacent segment after posterior lumbar interbody fusion by excessive distraction of lumbar disc space. J Neurosurg Spine 2010 Jun;12(6):671-9. Cheh G, Bridwell KH, Lenke LG, Buchowski JM, Daubs MD, Kim Y, Baldus C. Adjacent segment disease followinglumbar/thoracolumbar fusion with pedicle screw instrumentation: A minimum 5-year follow-up. Spine (Phila Pa 1976) 2007 Sep 15;32(20):2253-7. Ahn DK, Park HS, Choi DJ, Kim KS, Yang SJ. Survival and prognostic analysis of adjacent segments after spinal fusion. Clin Orthop Surg 2010 Sep;2(3):140-7. Kroeber M, Unglaub F, Guehring T, Nerlich A, Hadi T, Lotz J, Carstens C. Effects of controlled dynamic disc distraction on degenerated intervertebral discs: An in vivo study on the rabbit lumbar spine model. Spine (Phila Pa 1976) 2005 Jan 15;30(2):181-7. Guehring T, Unglaub F, Lorenz H, Omlor G, Wilke HJ, Kroeber MW. Intradiscal pressure measurements in normal discs, compressed discs and compressed discs treated with axial posterior disc distraction: An experimental study on the rabbit lumbar spine model. Eur Spine J 2006 May;15(5):597-604. Hee HT, Chuah YJ, Tan BH, Setiobudi T, Wong HK. Vascularization and morphological changes of the endplate after axial compression and distraction of the intervertebral disc. Spine (Phila Pa 1976) 2011 Apr 1;36(7):505-11. Guehring T, Omlor GW, Lorenz H, Engelleiter K, Richter W, Carstens C, Kroeber M. Disc distraction shows evidence of regenerative potential in degenerated intervertebral discs as evaluated by protein expression, magnetic resonance imaging, and messenger ribonucleic acid expression analysis. Spine (Phila Pa 1976) 2006 Jul 1;31(15):1658-65. Hee HT, Ismail HD, Lim CT, Goh JC, Wong HK. Effects of implantation of bone marrow mesenchymal stem cells, disc distraction and combined therapy on reversing degeneration of the intervertebral disc. J Bone Joint Surg Br 2010 May;92(5):726-36.

40 | Chapter 1

224.

225.

226. 227.

228. 229. 230.

231. 232.

233.

234.

235. 236.

237. 238. 239.

240.

241.

Brayda-Bruno M, Tibiletti M, Ito K, Fairbank J, Galbusera F, Zerbi A, Roberts S, Wachtel E, Merkher Y, Sivan SS. Advances in the diagnosis of degenerated lumbar discs and their possible clinical application. Eur Spine J 2014 Jun;23 Suppl 3:S315-23. Benneker LM, Heini PF, Anderson SE, Alini M, Ito K. Correlation of radiographic and MRI parameters to morphological and biochemical assessment of intervertebral disc degeneration. Eur Spine J 2005 Feb;14(1):27-35. Kettler A, Wilke HJ. Review of existing grading systems for cervical or lumbar disc and facet joint degeneration. Eur Spine J 2006 Jun;15(6):705-18. Rajasekaran S, Babu JN, Arun R, Armstrong BR, Shetty AP, Murugan S. ISSLS prize winner: A study of diffusion in human lumbar discs: A serial magnetic resonance imaging study documenting the influence of the endplate on diffusion in normal and degenerate discs. Spine (Phila Pa 1976) 2004 Dec 1;29(23): 2654-67. Watanabe A, Benneker LM, Boesch C, Watanabe T, Obata T, Anderson SE. Classification of intervertebral disk degeneration with axial T2 mapping. AJR Am J Roentgenol 2007 Oct;189(4):936-42. Pfirrmann CW, Metzdorf A, Zanetti M, Hodler J, Boos N. Magnetic resonance classification of lumbar intervertebral disc degeneration. Spine (Phila Pa 1976) 2001 Sep 1;26(17):1873-8. Tertti M, Paajanen H, Laato M, Aho H, Komu M, Kormano M. Disc degeneration in magnetic resonance imaging. A comparative biochemical, histologic, and radiologic study in cadaver spines. Spine (Phila Pa 1976) 1991 Jun;16(6):629-34. Marinelli NL, Haughton VM, Munoz A, Anderson PA. T2 relaxation times of intervertebral disc tissue correlated with water content and proteoglycan content. Spine (Phila Pa 1976) 2009 Mar 1;34(5):520-4. Trattnig S, Stelzeneder D, Goed S, Reissegger M, Mamisch TC, Paternostro-Sluga T, Weber M, Szomolanyi P, Welsch GH. Lumbar intervertebral disc abnormalities: Comparison of quantitative T2 mapping with conventional MR at 3.0 T. Eur Radiol 2010 Nov;20(11):2715-22. Marinelli NL, Haughton VM, Anderson PA. T2 relaxation times correlated with stage of lumbar intervertebral disk degeneration and patient age. AJNR Am J Neuroradiol 2010 Aug;31(7): 1278-82. Stelzeneder D, Welsch GH, Kovacs BK, Goed S, Paternostro-Sluga T, Vlychou M, Friedrich K, Mamisch TC, Trattnig S. Quantitative T2 evaluation at 3.0T compared to morphological grading of the lumbar intervertebral disc: A standardized evaluation approach in patients with low back pain. Eur J Radiol 2012 Feb;81(2):324-30. Takashima H, Takebayashi T, Yoshimoto M, Terashima Y, Tsuda H, Ida K, Yamashita T. Correlation between T2 relaxation time and intervertebral disk degeneration. Skeletal Radiol 2012 Feb;41(2):163-7. Lotz JC, Haughton V, Boden SD, An HS, Kang JD, Masuda K, Freemont A, Berven S, Sengupta DK, Tanenbaum L, Maurer P, Ranganathan A, Alavi A, Marinelli NL. New treatments and imaging strategies in degenerative disease of the intervertebral disks. Radiology 2012 Jul;264(1):6-19. Mwale F, Iatridis JC, Antoniou J. Quantitative MRI as a diagnostic tool of intervertebral disc matrix composition and integrity. Eur Spine J 2008 Dec;17 Suppl 4:432-40. Akella SV, Regatte RR, Wheaton AJ, Borthakur A, Reddy R. Reduction of residual dipolar interaction in cartilage by spin-lock technique. Magn Reson Med 2004 Nov;52(5):1103-9. Chaumette H, Grandclaude D, Brondeau J, Werbelow L, Canet D. Rotating-frame spin-lattice relaxation measurements (Tϭʌ) with weak spin-locking fields in the presence of homonuclear dipolar coupling. Molec Phys 2003;101(12):1919-26. Nguyen AM, Johannessen W, Yoder JH, Wheaton AJ, Vresilovic EJ, Borthakur A, Elliott DM. Noninvasive quantification of human nucleus pulposus pressure with use of T1rho-weighted magnetic resonance imaging. J Bone Joint Surg Am 2008 Apr;90(4):796-802. Johannessen W, Auerbach JD, Wheaton AJ, Kurji A, Borthakur A, Reddy R, Elliott DM. Assessment of human disc degeneration and proteoglycan content using T1rho-weighted magnetic resonance imaging. Spine (Phila Pa 1976) 2006 May 15;31(11):1253-7.

General introduction, outline, and aims of this thesis | 41

242.

243.

244. 245.

246.

247.

Auerbach JD, Johannessen W, Borthakur A, Wheaton AJ, Dolinskas CA, Balderston RA, Reddy R, Elliott DM. In vivo quantification of human lumbar disc degeneration using T(1rho)-weighted magnetic resonance imaging. Eur Spine J 2006 Aug;15 Suppl 3:S338-44. Blumenkrantz G, Zuo J, Li X, Kornak J, Link TM, Majumdar S. In vivo 3.0-tesla magnetic resonance T1rho and T2 relaxation mapping in subjects with intervertebral disc degeneration and clinical symptoms. Magn Reson Med 2010 May;63(5):1193-200. Blumenkrantz G, Li X, Han ET, Newitt DC, Crane JC, Link TM, Majumdar S. A feasibility study of in vivo T1rho imaging of the intervertebral disc. Magn Reson Imaging 2006 Oct;24(8):1001-7. Keshari KR, Lotz JC, Kurhanewicz J, Majumdar S. Correlation of HR-MAS spectroscopy derived metabolite concentrations with collagen and proteoglycan levels and thompson grade in the degenerative disc. Spine (Phila Pa 1976) 2005 Dec 1;30(23):2683-8. Zuo J, Saadat E, Romero A, Loo K, Li X, Link TM, Kurhanewicz J, Majumdar S. Assessment of intervertebral disc degeneration with magnetic resonance single-voxel spectroscopy. Magn Reson Med 2009 Nov;62(5):1140-6. Zuo J, Joseph GB, Li X, Link TM, Hu SS, Berven SH, Kurhanewitz J, Majumdar S. In vivo intervertebral disc characterization using magnetic resonance spectroscopy and T1rho imaging: Association with discography and oswestry disability index and short form-36 health survey. Spine (Phila Pa 1976) 2012 Feb 1;37(3): 214-21.

Chapter 2

Safety of intradiscal injection and biocompatibility of polyester amide (PEA) microspheres in a canine model predisposed to intervertebral disc degeneration Nicole Willems, George Mihov, Guy C.M. Grinwis, Maarten van Dijk, Detlef Schumann, Clemens Bos, Gustav J. Strijkers, Wouter J.A. Dhert, Björn P. Meij, Laura B. Creemers, Marianna A. Tryfonidou Journal of Biomedical Research Materials. Part B: Applied Biomaterials (2015) doi: 10.1002/jbm.b.33579

44 | Chapter 2

Abstract Introduction Repair of degenerated intervertebral discs (IVD) might be established via intradiscal delivery of biologic therapies. Methods Polyester amide polymers (PEA) were evaluated for in vitro cytotoxicity and in vivo biocompatibility, and thereafter intradiscal application of PEA microspheres (PEAMs) in a canine model predisposed to IVD degeneration at long-term (6 months) follow-up. Results PEA extracts did not induce cytotoxicity in mouse fibroblast cells (microscopy and XTT assay), while a slight foreign body reaction was demonstrated by histopathology after intramuscular implantation in rabbits. Intradiscal injection of a volume of 40 μl through 26 and 27G needles induced no degenerative changes in a canine model susceptible to IVD disease. Although sham-injected IVDs showed increased CAV1 expression compared with non-injected IVDs, which may indicate increased cell senescence, these findings were not supported by immunohistochemistry, biomolecular analysis of genes related to apoptosis, biochemical and histopathological results. PEAM-injected IVDs showed a significantly higher BAX/BCL2 ratio vs sham-injected IVDs suggestive of an anti-apoptotic effect of the PEAMs. These findings were not supported by other analyses (clinical signs, disc height index, T2 values, biomolecular and biochemical analyses, and IVD histopathology). Conclusion PEAs showed a good cytocompatibility and biocompatibility. PEAMs are considered safe sustained release systems for intradiscal delivery of biological treatments.

Intradiscal injection and biocompatibility of PEA microspheres | 45

Introduction Intervertebral disc (IVD) disease is common in dogs and humans and is associated with IVD degeneration. The process of spontaneous IVD degeneration in chondrodystrophic dogs is similar to that in man, resulting in a valuable animal model for canine and human 1 patients. Clinical signs, i.e. pain, neurological deficits, develop from an age of 3 – 7 years in these dogs. An aberrant cell-mediated response, associated with genetic predisposition, aging, mechanical overload, and an inadequate metabolite transport results in an dysbalance between anabolic and catabolic processes and consequently a dysfunctional 2 extracellular matrix (ECM). The nucleus pulposus (NP) and inner annulus fibrosus (AF), normally consisting of mainly collagen type II and large proteoglycan aggregates, change to tissues rich in collagen type I, with a decrease in the size and total amount of proteoglycans, while the fibrils of the outer AF become coarser and more susceptible to injury. These changes ultimately result in disturbance of the structural integrity and 2 biomechanical properties of the IVD. With increased knowledge on the pathogenesis and biological changes in the diseased IVD, treatment strategies focus on biological repair of 3 the IVD. As the IVD is the largest avascular structure of the body, direct intradiscal injection via a minimal invasive technique is an elegant way to deliver biological treatments, e.g. cells, growth factors or drugs, into the NP. Growth factors are characterized by short in vivo half-lives and chemical instability and to increase their bioavailability in vivo, bioactive substances can be encapsulated in biomaterials, e.g. 4 microspheres, hydrogels, that allow sustained release. In addition, higher loading doses can be achieved locally, without causing systemic side effects, and puncture of the IVD can be reduced to a minimum. A class of polyester amide polymers (PEAs) have gained interest as biodegradable polymers in the past decades, as they possess clear advantages 5,6 over aliphatic polyester-based biomaterials commonly used. The latter are rather hydrophobic, hydrolytically degradable, and most of them generate acidic products upon degradation. In contrast, PEAs are synthetic, amino-acid-based co-polymers, containing L-amino acids, aliphatic di-ĐĂƌďŽdžLJůŝĐ ĂĐŝĚƐ ĂŶĚ ɲ͕ʘ-diols, creating amphiphilicity, that enhances interactions with proteins and modification with bioactive molecules and 7, 8 Biodegradation of the polymers occurs via surface erosion, and can (lipophilic) drugs. 9, 10 PEAs can be manufactured by a be accomplished by endogenous enzymes. 8 polycondensation method and mechanical and thermal properties can be easily tuned. They have been successfully applied as a coating on coronary stents for sustained drug 11, 12 and were proven to meet the requirements of a biocompatible controlled release, 13, 14 To our knowledge, the intradiscal release system in the ocular environment. application of microspheres consisting of PEAs, has not been examined thus far, and seems a promising method to provide sustained release of bioactive substances over a prolonged period in the confined environment of the IVD.

46 | Chapter 2

Intradiscal application of therapeutics should be considered with care. In animal models of IVD degeneration, puncture of the IVD induces degeneration, and the gauge size of the 15-17 Also, a relatively high volume needle correlates with the extent of degeneration. applied intradiscally can cause an increase in hydrostatic pressure, a biomechanical cue 18, 19 Furthermore, in human patients, discography shown to induce IVD degeneration. injections have been associated with an increased risk of degeneration. As several ongoing clinical trials on intradiscal delivery of biologic therapies are performed (http://clinicaltrials.gov), it is important to assess possible side effects of intradiscal injection to pinpoint the boundary conditions. In vivo assessment of safety and efficacy of treatments in clinical trials is obviously limited to radiography and magnetic resonance imaging, which may not be sensitive enough to detect minor changes in the ECM that may have clinically relevant effects on the long term. Assessment of the effect of intradiscal injection at a biochemical, biomolecular, and histopathological level will provide much more information. Preferably this is done in a large animal model with spontaneous IVD degeneration, where underlying pathological processes match human IVD degeneration 1 providing valuable translational information. In order to assess the effects of intradiscal injection of a sham condition in IVDs in dogs predisposed to IVD degeneration, we evaluated magnetic resonance imaging (MRI), in combination with biochemical, biomolecular and histopathological data at long-term follow-up (6 months). Furthermore, after evaluating the biocompatibility and safety of intramuscular application of PEAs in rabbits, we also evaluated the long-term effects on IVD integrity of PEA microspheres (PEAMs) after intradiscal application (6 months). Materials and methods Ethics statement All procedures involving animals were approved and conducted according to US regulation (rabbits), and to Dutch regulation (dogs; experimental number: 2012.III.07.065). Synthesis of polyester amide polymers 13, 20 Briefly, the PEAs were synthesized according to a previously published method. polymer was prepared via polycondensation of 0.45 equivalents of di-p-toluenesulfonic acid salts of bis-(L-leucine)1,4-dianhydrosorbitol diester (1), 0.30 equivalents of bis-(L-ůĞƵĐŝŶĞͿɲ͕ʘ-hexanediol diester (2), 0.25 equivalents of lysine benzyl ester (3), and 1 equivalent of di-N-hydroxysuccinimide ester of sebacic acid (4) in anhydrous dimethylformamide and trimethylamine in a glass vessel with overhead stirrer under a nitrogen atmosphere. Employing pre-activated acid in the reaction allows polymerization at a relative low temperature (65 °C), resulting in a polycondensate free of by-products and predictable degradation components. The polymer with an average number molecular weight of 48 kDa was isolated from the reaction mixture in two precipitation

Intradiscal injection and biocompatibility of PEA microspheres | 47

steps. Preparation of PEA microspheres (PEAMs) ® A volume of 30 ml of 1% filtered polyvinyl alcohol (PVA) was stirred with an Ultra-Turrax (IKA Labortechnik, Staufen, Germany) equipped with a 25S – 10G stirring rod) at 4000 ƌƉŵ͘  ǀŽůƵŵĞ ŽĨ ϭϱϬ ʅů ŽĨ ϭϬй ƚƌĞŚĂůŽƐĞ in water was added to 8.5% polymer in dichloromethane (DCM) and vortexed for 30s at 13000 rpm. This emulsion was injected into the PVA solution and stirred at 4000 rpm. After 3 minutes the Ultra-Turrax was removed, a stirring bar was added and the emulsion was stirred for another 16 hours. After stirring, the PEAMs were allowed to sink to the bottom of the vial and the supernatant was removed. The PEAMs were washed three times with 20 ml of 0.04% ice® ® cold, filtered Tween 20. Following the final washing about 5 ml of 0.04% Tween 20 was added, and the PEAMs were lyophilized. The average diameter of the microspheres was ϰϬʅŵ͘ In vitro cytotoxicity polyester amide polymers For cytotoxicity testing, mouse L-929 fibroblast cells were cultured in high glucose Dulbecco’s modified Eagle’s medium (DMEM, Lonza, Verviers, Belgium) supplemented with 10% fetal bovine serum (FBS, Lonza), 1% penicillin/streptomycin (pen/strep), and 3 2 plated into 96-well plates at a density of 9 x 10 cells/cm . Autoclaved natural rubber and silicone served as a positive and a negative control, respectively. Extractions of 4 g 2 (surface ± 60 cm ) of gamma-irradiated polymer specimens were prepared in 20 ml cell culture medium (MEM Eagle with Earle’s BSS with L-glutamine, Lonza) 10% FBS + 1% pen/strep and subsequently incubated at 37 °C for 24 h in a humidified atmosphere (5% CO2). Cells were exposed to the PEA extracts or controls at 37 °C for 48 h (5% CO2). Cell viability was immediately recorded by microscopic examination of the cells and by 21 using the XTT assay. Cell viability assays were performed with three or more replicates. Biocompatibility of polyester amide polymers in rabbits Three healthy adult New Zealand White rabbits (Charles River, Wilmington, MA, USA) were fully anesthetized and six sterilized strips of PEAs of 1 x 1 x 10 mm in size were implanted into the paravertebral muscles under sterile conditions. Six strips of plastic served as a control. Rabbits were monitored daily for signs of distress or pain (e.g. lethargy, weight loss, automutilation, and abnormal posture) and injection sites were monitored for inflammation (e.g. swelling, redness, pain, and heat). After 2 weeks all animals were sacrificed. The implants were excised, macroscopically evaluated and fixed in 4% neutral buffered formaldehyde. Paraffin sections of 4 μm were stained with hematoxylin and eosin and histopathologically assessed for infiltration of inflammatory

48 | Chapter 2

cells, giant cells, necrosis, neovascularization, fatty infiltration, and the encapsulation of the biomaterial by a fibrotic capsule. Long term (6-month) effect of intradiscal injection on canine intervertebral discs This study was performed in seven intact male beagle dogs (Harlan) with a median age of 1.3 years (range 1.1 – 1.8) and a median weight of 11.7 kg (range 10.2 – 12.8). A boardcertified veterinary surgeon (BM) performed a general, orthopedic, and neurologic examination on all dogs. A blood sample was drawn from the jugular vein to assess white blood cell count and differentiation, to exclude systemic inflammation. T2-weighted images were obtained pre- (t0) and post-operatively at 6 (t6), 12 (t12), and 24 (t24) weeks under general anesthesia using a 1.5 Tesla scanner (Philips Healthcare, Best, The 22 Netherlands). All lumbar IVDs were assessed at all 4 time points according to the Pfirrmann score, by a veterinary radiologist that was blinded to treatment allocation on sagittal T2-weighted images. Only lumbar IVDs with a Pfirrmann score II were included in the study. All injections were performed by the same person (BM), and non-injected IVDs served as controls. Briefly, T12 – L5 were exposed and injected via a left lateral approach, and L6 – ^ϭǀŝĂĂĚŽƌƐĂůĂƉƉƌŽĂĐŚ͘ϭϬϬʅůŐĂƐƚŝŐŚƚƐLJƌŝŶŐĞ;ϳϲϱϲ-01 Model 1710 RN) was ƵƐĞĚƚŽŝŶũĞĐƚϰϬʅůŽĨĂƐŚĂŵĐŽŶƚĂŝŶŝŶŐϭйƐƵĐƌŽƐĞ͕ϭ͘ϮйŵĂŶŶŝƚŽů͕ϮϬŵDŐůLJĐŝŶĞ͕ĂŶĚ ® 0.05% Tween 20 through a 27G needle (25 mm, 12° beveled point; Hamilton Company h^͕ZĞŶŽ͕EĞǀĂĚĂ͕ h^Ϳ͘ ǀŽůƵŵĞŽĨ ϰϬʅůŽĨϭ͘ϯйWDƐŝŶ Ϭ͘ϵйEĂůŶĞĞĚĞĚƚŽ ďĞ injected through a 26G needle (25 mm, 12° beveled point; Hamilton) to avoid clogging by the microspheres (unpublished data).The choice for the sham was based on the intradiscal 22 injection of three other substances unrelated to this study. Location of the tip of the needle in the NP was estimated by the length of passage through the AF (1 cm), while constant resistance was encountered. Once the NP was encountered, resistance decreased and the volume could be easily injected. The needle was slowly pulled back to allow the AF puncture site to close, and the site was inspected for extrusion of the administered substance. 22

Disc height index (DHI) was calculated at all 4 time points on T2-weighted images. At all 4 time points, quantitative T2 maps were generated from a multi-echo imaging sequence with 8 echoes. For the analysis of T2 values in the NP, an oval-shaped region of interest (ROI) in the NP was manually placed on mid-sagittal IVD sections. ROIs were exported to, and analyzed with Wolfram Mathematica 10.0 (Wolfram Research, Champaign, IL, USA). T2 values were computed by calculating the mean signal intensity (S) in each ROI, and by -TE/T2 , fitting these intensity data to the following equation: S(TE) = S0 e using the Levenberg-Marquardt nonlinear least-squares method implemented in Mathematica. S0 denotes the equilibrium magnetization, whereas S(TE) indicates the signal as a function of echo time (TE).

Intradiscal injection and biocompatibility of PEA microspheres | 49

Sample collection, macroscopic grading, and histopathological grading of canine intervertebral discs Dogs were euthanized 6 months after intradiscal injection by way of sedation with dexmedetomidine followed by pentobarbital. The vertebral column (T12 – S1) was 22 harvested to generate nine spinal units. One part of the IVD tissue, containing both NP and AF, was snap frozen in liquid nitrogen and stored at -ϴϬȗ ĨŽƌ ďŝŽĐŚĞŵŝĐĂů ĂŶĚ biomolecular analyses. The other part was photographed (Olympus VR-340, Hamburg, Germany) for macroscopic evaluation, and fixed in 4% buffĞƌĞĚ ĨŽƌŵĂůĚĞŚLJĚĞĂƚϰȗ ĨŽƌ 2 weeks. Two independent investigators, blinded to the treatments, evaluated macroscopic images of the IVD segments according to the Thompson grading scheme. Samples were decalcified according to Kristensen in 35% formic acid and 6.8% sodium 23 formate. Paraffin sections (5 μm) stained with hematoxylin/eosin and with picrosirius red/alcian blue were histopathologically evaluated by two independent investigators, 24 blinded to the treatments, according to the grading scheme developed by Bergknut et al. Immunohistochemistry for caveolin-1 (monoclonal mouse anti-caveolin-1 antibody (Clone 2297, 610406, BD Biosciences) diluted 1:50 in PBS) was performed as described 25 previously. RNA isolation and quantitative polymerase chain reaction of the nucleus pulposus and the annulus fibrosus Transverse cryosections (60 μm) of the IVDs were collected and the NP and AF tissues were separated visually. One half was collected in 300μl RLT buffer containing ° ϭй ɴ-mercapto-ethanol (Qiagen, Venlo, The Netherlands) and stored at -80 C until biomolecular analyses. Total RNA was isolated from the NP and AF tissues by using the RNeasy Fibrous Tissue Mini Kit (Qiagen, Venlo, The Netherlands) according to the manufacturer’s instructions. The incubation period with proteinase K was reduced to five minutes increase RNA yield. After on-column DNase-I digestion (Qiagen RNase-free DNase kit), RNA was quantified by using a NanoDrop 1000 spectrophotometer (Isogen Life TM cDNA Synthesis Kit (Bio-Rad, Science, IJsselstein, The Netherlands). The iScript Veenendaal, The Netherlands) was used to synthesize cDNA. Quantitative PCR (qPCR) was performed using an iCycler CFX384 Touch termal cycler, and IQ SYBRGreen Super mix (BioRad)to assess the effects at gene expression levels with regards to: 1) ECM anabolism: aggrecan (ACAN), collagen type II (COL2A1), collagen type I (COL1A1); 2) ECM catabolism: a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS5), matrix metalloproteinase 13 (MMP13), tissue inhibitor of metalloproteinase 1 (TIMP1); 3) proliferation: cyclin-D1 (CCND1) and 4) apoptosis: caveolin-1 (CAV1), caspase 3 (CASP3), and B-cell lymphoma 2-associated X/B-cell lymphoma 2 (BAX/BCL2) ratio (Additional file 1). Relative expression levels were determined by normalizing the Ct value of each target gene by the mean Ct value of 4 reference genes, i.e. glyceraldehyde 3-phosphate

50 | Chapter 2

dehydrogenase (GAPDH), ribosomal protein S18 (RPS19), succinate dehydrogenase complex, subunit A, flavoprotein variant (SDHA), and hypoxanthine-guanine phosphoribosyltransferase (HPRT). Biochemical assays: glycosaminoglycan, collagen and DNA The other half of the cryosectioned NP and AF tissues was digested overnight in papain buffer (250 μg/ml papain (P3125-100 mg, Sigma-Aldrich) + 1.57 mg/ml cysteine HCL (C7880, Sigma-ůĚƌŝĐŚͿͿĂƚϲϬȗ͘Glycosaminoglycan (GAG) content was quantified by using 26 TM a 1,9-dimethylmethylene blue assay. The Quant-iT dsDNA Broad-Range assay kit in TM fluorometer (Invitrogen. Carlsbad, USA) was used in combination with a Qubit accordance with the manufacturer’s instructions. Collagen was quantified by using a hydroxyproline assay and calculated from the hydroxyproline content by multiplying with 27 a factor 7,5. Total GAG and collagen content were normalized for DNA content of the NP and AF. Statistical analysis 28 All data were analyzed by using R statistical software, package 3.0.2. Residual plots and quantile-quantile (Q-Q)-plots were used to check normality of the data. In case of violation of the assumption of normality, data were logarithmically transformed. A linear mixed effect model was used to analyze the effect of intradiscal injection and intradiscal application of PEAMs on DHI, T2 values, histopathological grading, GAG, collagen and DNA content. Model selection was based on the lowest Akaike Information Criterion (AIC). The correlation between multiple measurements within one dog was taken into account by incorporating ‘dog’ (dog 1 – 7) as a random effect. DHI and T2 values were corrected for t0, and ‘treatment’, ‘time’ (t6, t12, and t24), and their interaction served as fixed effect factors. ‘Treatment’ (non-injected, sham, PEAMs) served as a fixed factor in the analysis of histopathological scores. For the analysis of GAG and DNA levels, ‘treatment’, ‘tissue’ (NP and AF), and their interaction were incorporated into the model as fixed effect factors. The Cox proportional hazards regression model was used to estimate the effect of the injected treatments on gene expression levels. Calculations were performed on the ratio of the Ct values for each target gene to the mean Ct value of the reference genes. Ct values t 40 were right censored. Regression coefficients were estimated by the maximum likelihood method. Differences between treatments were considered significant if 0 was not included in the confidence interval, whereas hazard ratios were considered significant if 1 was not included in the confidence interval. Confidence intervals were calculated and stated at the 99% confidence level to correct for multiple comparisons.

Intradiscal injection and biocompatibility of PEA microspheres | 51

Results Cytocompatibility of PEA in vitro and biocompatibility of polyester amide polymers and polyester amide microspheres in vivo No visible signs of toxicity in response to the PEAs were observed in the fibroblast monolayers at microscopic evaluation. Cell viability, as measured by the XTT assay, was 29 97.9% after 48 h incubation with PEA dispersions, and was considered non cytotoxic. Macroscopic evaluation of the PEA implant sites in rabbits indicated no significant signs of inflammation, encapsulation, hemorrhage, necrosis, or discoloration after two weeks. Microscopic evaluation of the implant sites indicated no significant signs of fibrosis, hemorrhage, necrosis, or degeneration compared with the control implant sites. Cellular infiltrates and giant cells were seen at the interface of the test implant sites. Individual scores of the rabbits are shown in Additional file 2. Overall, implantation of PEA specimens demonstrated a slight foreign body reaction intramuscularly. Intradiscal injection in a canine model of spontaneous intervertebral disc degeneration All dogs recovered from surgery uneventfully. All 21 injected IVDs were scored a Pfirrmann grade II before surgery (t0). Pfirrmann scores of 20/21 IVDs and T2-values of all IVDs were not significantly different over time (t6, t12, t24). T2-values per condition are described in Additional file 3. One (1/21) sham-injected IVD was scored a Pfirrmann grade III at all subsequent time points. The mean DHI of non-injected, sham-injected, and PEAMsinjected IVDs were not significantly different (Figure 1a). Mean disc height of non-injected IVDs was 3.84 mm (range 3.20 – 4.93 mm). As the outer diameter of a 27G needle is 0.41 mm and of a 26G needle 0.47 mm, the ratios of needle diameter to disc height were calculated at 11% and 12% respectively. The volume injected in this study consisted of 3 30 20% of the total NP volume (i.e. 40 μl of 200 mm ). Post-mortem, all IVDs were scored a Thompson grade II, in accordance with early IVD degeneration. Representative macroscopical images of all three conditions are shown in Figure 1B, 1C, and 1D. Histopathology and biochemistry The median histopathological grade of non-injected (12; range: 10 – 15), sham-injected (14; range: 11 – 17), and PEAMs-injected IVDs 13 (11 – 15) was not significantly different. Representative histopathological images (picrosirius red/alcian blue stain) of all conditions are shown in Figure 1B’, 1B’’, 1C’, 1C’’, and 1D’, 1D’’. In one of the PEAMs-injected IVDs (level L7 – S1) a small pyogranulomatous reaction in the dorsal ligament and outer layer of the dorsal AF was detected, indicative of an inflammatory response. GAG and collagen levels corrected for DNA were not different between conditions (Figure 2A and 2B). In all conditions, GAG/DNA was significantly higher in the NP compared with the AF (M 0.55, SD 0.04; CI99% 0.44 – 0.66).

52 | Chapter 2

Figure 1. A. Change in disc height expressed as the percent disc height index compared with the pre-injection value (set at 100%) in non-, sham, and polyester amide polymer microspheres (PEAMs)-, injected canine IVDs at 6 months follow-up ± standard deviation. B – D. Representative macroscopical (B - D) and histopathological images (picrosirius red/alcian blue stain) of non-injected (B’B’’), intradiscally injected (sham (C’- C’’)) and PEAMs (PEAMs (D’- D’’)) canine IVDs at 6 months follow-up. B’’, C’’, D’’ are magnifications of the squares in B’, C’, D’, respectively. B - D. Nuclei pulposi (NPs) in all conditions had a bulging aspect (asterisk) due to the processing method and the tissue properties. Regardless of the treatment, at macroscopy a white opaque NP could be noticed in all IVDs, consistent with early IVD degeneration. Histopathologically, also regardless of the treatment, small size chondrocyte groups, consisting of 2 – 7 cells (arrow), within a mixture of collagen-rich (red stain) and glycosaminoglycansrich (GAG; blue and green stain) extracellular matrix were observed in the NP of all IVDs.

Intradiscal injection and biocompatibility of PEA microspheres | 53

Figure 2A- G. Relative gene expression levels in non-, sham,- and polyester amide microspheres (PEAM)-injected, canine intervertebral discs (IVDs) at 6 months follow-up. The non-injected (Non-inj) nuclei pulposi (NP) are set at 1. A, B, and C Gene expression levels of collagen type II alpha 1 (COL2A1)(a) and collagen type II alpha 1 (COL1A1) (B) were not significantly different between conditions, neither was collagen corrected for DNA (C). D. Caspase 3 (CASP3) expression levels were significantly lower in the annulus fibrosus (AF) compared with the NP. E. Expression levels of caveolin-1 (CAV1) were significantly higher in shaminjected IVDs (NP + AF) compared with non-injected control IVDs. F. In all conditions glycosaminoglycan (GAG) corrected for DNA were significantly higher in the NP compared with the AF. G. The PEAM-injected IVDs showed a significant higher B-cell lymphoma 2-associated X/B-cell lymphoma 2 (BAX/BCL2) ratio compared with the shaminjected IVDs. Data in A, B, D, and E are expressed as n-fold changes, in c and f as mean values, and in G as ratio ± standard deviation.* Indicates significant difference at a99% confidence interval

54 | Chapter 2

Gene expression apoptotic and degenerative pathways and immunohistochemistry Relative gene expression of CASP3 in the AF was significantly lower (HR 0.21; CI99% 0.07 – 0.66) than in the NP in all conditions and could be suggestive of a higher apoptotic rate in the NP (Figure 2C). The BAX/BCL2 ratio in the sham-injected IVDs (NP and AF) was significantly lower (HR 0.14; CI99% 0.02 – 0.85) compared with the PEAMs-injected IVDs, indicative of an anti-apoptotic effect of the PEAMs (Figure 2D). In addition, CAV1 gene expression was significantly higher (HR 3.30; CI99% 1.00 – 10.83) in sham-injected IVDs (NP and AF) compared with non-injected IVDs (Figure 2E). None of the IVDs showed staining of cells with anti-caveolin-1 antibody in the NP and/or AF. Relative gene expression of anabolic (ACAN, COL2A1 (Figure 2F), COL1A1 (Figure 2G)), catabolic (MMP13), anti-catabolic (TIMP1), and proliferative (CCND1) genes were not significantly different (Additional file 4). Gene expression of ADAMTS5 was below detectable levels in the NP as well as the AF in all conditions. Discussion In this study, intradiscal injection of a volume of 40 μl through 26 and 27G needles induced no degenerative changes in a canine model predisposed to IVD degeneration at long-term (6 months) follow-up. Although sham-injected IVDs showed increased CAV1 expression compared with non-injected IVDs, which may indicate increased cell 31 senescence, these findings were not supported by immunohistochemistry, biomolecular analysis of genes related to apoptosis, biochemical and histopathological results. A needle puncture has been described to alter mechanical properties by reducing pressure in the NP and/or damaging the AF, depending on the diameter of the needle. The rabbit 32 annular stab model of induced IVD degeneration is based upon this concept. IVD degeneration has been observed when the ratio of needle diameter to disc height 15 exceeded 40%. With regard to injection volume, the NP can be considered as a confined 18 space in which the hydrostatic pressure will increase if a substance is injected. In the caudal IVDs of rats, volume-dependent degenerative changes have been demonstrated after injection of phosphate buffered saline at a radiographic, biochemical, and 19 histopathological level. Although the exact threshold volumes were not specified, 3 injected volumes up to 66% (i.e. 2 μl of 3.1 mm ) of the total NP volume, showed no degenerative changes at short-term follow-up. Needle size diameters and injected volume applied in our study were well within the safety ranges described in literature, and induced no degenerative changes in canine IVDs predisposed to degeneration. Furthermore, we showed a good cytocompatibility in vitro and biocompatibility of PEAs in rabbits. Only a slight foreign body reaction was seen after intramuscular implantation in rabbits. We hypothesized that intradiscal application of PEAs in the avascular IVD would

Intradiscal injection and biocompatibility of PEA microspheres | 55

be well accepted, in line with previous studies showing a moderate subcutaneous tissue 33 response to a hydrogel that showed no response at all upon intradiscal injection. Furthermore, safe intravitreal application of PEA fibrils through a 26G needle was already 13 shown by Kropp et al . Indeed, PEAMs were considered safe within a 6 months follow-up period, based on clinical signs, disc height index, T2 values, biomolecular and biochemical analyses, and IVD histopathology. The focal, mild granulomatous reaction described in one of the PEAM injected IVDs could have been a consequence of leakage of the PEAMs, the injection procedure itself, or it could have been a reaction consistent with the ongoing 34 process of IVD degeneration. The PEAMs-injected IVDs showed a significant higher BAX/BCL2 ratio compared with the sham-injected IVDs, suggestive of an anti-apoptotic effect of the PEAMs. However, neither substance significantly affected this parameter compared with the non-injected controls, thus questioning the implications of this finding. Several clinical trials are currently being performed, in which promising regenerative treatments, consisting of cell, gene and protein therapies, are injected into the IVD (http://clinicaltrials.gov). In order to use PEAMs as a part of a regenerative therapy, effectuating sustained release of bioactive substances in the degenerative IVD, release profiles and degradation processes in the intradiscal environment need to be investigated in future. The stage of degeneration has been shown to be an important factor in the efficacy of treatment with cell-based therapies, which emphasizes the importance of the 35 preclinical canine model that resembles the human situation. Conclusion In conclusion, we showed a good cytocompatibility in vitro and biocompatibility of PEAs in rabbits. Intradiscal injection of 40 μl of a sham condition through a 27G needle, and of PEA microspheres through a 26G, could be safely applied in a large animal model predisposed to IVD degeneration without accelerating degeneration over the course of 6 months.

Acknowledgements This research forms part of the Project P2.01 IDiDAS of the research program of the BioMedical Materials institute, co-funded by the Dutch Ministry of Economic Affairs, Agriculture and Innovation. The financial contribution of the Dutch Arthritis Foundation is gratefully acknowledged (IDiDAS, LLP22 and LLP12). We would like to acknowledge Toxikon Corporation (Bedford, MA, USA) for performing the cytocompatibility tests in vitro, and the biocompatibility tests in vivo. Furthermore we would like to express our sincere appreciation to Saskia Plomp and Jeannette Wolfswinkel for their assistance in the laboratory.

56 | Chapter 2

References 1.

2. 3. 4. 5.

6. 7. 8.

9.

10. 11.

12.

13.

14.

15.

16.

17.

Bergknut N, Rutges JP, Kranenburg HC, Smolders LA, Hagman R, Smidt HJ, Lagerstedt AS, Penning LC, Voorhout G, Hazewinkel HA, Grinwis GC, Creemers LB, Meij BP, Dhert WJ. The dog as an animal model for intervertebral disc degeneration? Spine (Phila Pa 1976) 2012 Mar 1;37(5):351-8. Roughley PJ. Biology of intervertebral disc aging and degeneration: Involvement of the extracellular matrix. Spine (Phila Pa 1976) 2004 Dec 1;29(23):2691-9. Grunhagen T, Wilde G, Soukane DM, Shirazi-Adl SA, Urban JP. Nutrient supply and intervertebral disc metabolism. J Bone Joint Surg Am 2006 Apr;88 Suppl 2:30-5. Putney SD, Burke PA. Improving protein therapeutics with sustained-release formulations. Nat Biotechnol 1998 Feb;16(2):153-7. DeFife KM, Grako K, Cruz-Aranda G, Price S, Chantung R, Macpherson K, Khoshabeh R, Gopalan S, Turnell WG. Poly(ester amide) co-polymers promote blood and tissue compatibility. J Biomater Sci Polym Ed 2009;20(11):1495-511. Rodriguez-Galan A, Franco L, Puiggali J. Degradable poly(ester amide)s for biomedical applications. Polymers 2011;3:65 - 99. Guo K, Chu CC. Biodegradable and injectable paclitaxel-loaded poly(ester amide)s microspheres: Fabrication and characterization. J Biomed Mater Res B Appl Biomater 2009 May;89(2):491-500. Sun H, Meng F, Dias AA, Hendriks M, Feijen J, Zhong Z. Alpha-amino acid containing degradable polymers as functional biomaterials: Rational design, synthetic pathway, and biomedical applications. Biomacromolecules 2011 Jun 13;12(6):1937-55. Ghaffar A, Draaisma GJ, Mihov G, Dias AA, Schoenmakers PJ, van der Wal S. Monitoring the in vitro enzyme-mediated degradation of degradable poly(ester amide) for controlled drug delivery by LC-ToF-MS. Biomacromolecules 2011 Sep 12;12(9):3243-51. Mihov G, Draaisma G, Dias A, Turnell B, Gomurashvili Z. Degradable polyesteramides: A novel platform for sustained drug delivery. J Control Release 2010 Nov 20;148(1):e46-7. Lee SH, Szinai I, Carpenter K, Katsarava R, Jokhadze G, Chu CC, Huang Y, Verbeken E, Bramwell O, De Scheerder I, Hong MK. In-vivo biocompatibility evaluation of stents coated with a new biodegradable elastomeric and functional polymer. Coron Artery Dis 2002 Jun;13(4):237-41. Webster M, Harding S, McClean D, Jaffe W, Ormiston J, Aitken A, Watson T. First-in-human evaluation of a sirolimus-eluting coronary stent on an integrated delivery system: The DIRECT study. EuroIntervention 2013 May 20;9(1):46-53. Kropp M, Morawa K, Mihov G, Salz A, Harmening N, Franken A, Kemp A, Dias A, Thies J, Johnen S, Thumann G. Biocompatibility of poly(esteramide) (PEA) microfibrils in ocular tissues. Polymers 2014;6: 243 - 260. Andres-Guerrero V, Zong M, Ramsay E, Rojas B, Sarkhel S, Gallego B, de Hoz R, Ramirez AI, Salazar JJ, Trivino A, Ramirez JM, Del Amo EM, Cameron N, de-Las-Heras B, Urtti A, Mihov G, Dias A, Herrero-Vanrell R. Novel biodegradable polyesteramide microspheres for controlled drug delivery in ophthalmology. J Control Release 2015 Aug 10;211:105-17. Elliott DM, Yerramalli CS, Beckstein JC, Boxberger JI, Johannessen W, Vresilovic EJ. The effect of relative needle diameter in puncture and sham injection animal models of degeneration. Spine (Phila Pa 1976) 2008 Mar 15;33(6):588-96. Wang JL, Tsai YC, Wang YH. The leakage pathway and effect of needle gauge on degree of disc injury post anular puncture: A comparative study using aged human and adolescent porcine discs. Spine (Phila Pa 1976) 2007 Aug 1;32(17):1809-15. Masuda K, Aota Y, Muehleman C, Imai Y, Okuma M, Thonar EJ, Andersson GB, An HS. A novel rabbit model of mild, reproducible disc degeneration by an anulus needle puncture: Correlation between the degree of disc injury and radiological and histological appearances of disc degeneration. Spine (Phila Pa 1976) 2005 Jan 1;30(1):5-14.

Intradiscal injection and biocompatibility of PEA microspheres | 57

18. 19. 20.

21. 22.

23. 24.

25.

26. 27. 28. 29. 30.

31. 32.

33.

34.

35.

Schechtman H, Robertson PA, Broom ND. Failure strength of the bovine caudal disc under internal hydrostatic pressure. J Biomech 2006;39(8):1401-9. Mao HJ, Chen QX, Han B, Li FC, Feng J, Shi ZL, Lin M, Wang J. The effect of injection volume on disc degeneration in a rat tail model. Spine (Phila Pa 1976) 2011 Jul 15;36(16):E1062-9. Katsarava R, Beridze V, Arabuli N, Kharadze D, Chu C, Won C. Amino acid-based bioanalogous polymers. synthesis, and study ŽĨƌĞŐƵůĂƌƉŽůLJ;ĞƐƚĞƌĂŵŝĚĞͿƐďĂƐĞĚŽŶďŝƐ;ɲ-ĂŵŝŶŽĂĐŝĚͿɲ͕ʘ-alkylene diesters, and aliphatic dicarboxylic acids. J Polym Sci A Polym Chem 1999;37:391-407. Roehm NW, Rodgers GH, Hatfield SM, Glasebrook AL. An improved colorimetric assay for cell proliferation and viability utilizing the tetrazolium salt XTT. J Immunol Methods 1991 Sep 13;142(2):257-65. Willems N, Bach FC, Plomp SG, van Rijen MH, Wolfswinkel J, Grinwis GC, Bos C, Strijkers GJ, Dhert WJ, Meij BP, Creemers LB, Tryfonidou MA. Intradiscal application of rhBMP-7 does not induce regeneration in a canine model of spontaneous intervertebral disc degeneration. Arthritis Res Ther 2015 May 27;17:137,015-0625-2. Kristensen HK. An improved method of decalcification. Stain Technol 1948 Jul;23(3):151-4. Bergknut N, Meij BP, Hagman R, de Nies KS, Rutges JP, Smolders LA, Creemers LB, Lagerstedt AS, Hazewinkel HA, Grinwis GC. Intervertebral disc disease in dogs - part 1: A new histological grading scheme for classification of intervertebral disc degeneration in dogs. Vet J 2013 Feb;195(2):156-63. Smolders LA, Meij BP, Onis D, Riemers FM, Bergknut N, Wubbolts R, Grinwis GC, Houweling M, Groot Koerkamp MJ, van Leenen D, Holstege FC, Hazewinkel HA, Creemers LB, Penning LC, Tryfonidou MA. Gene expression profiling of early intervertebral disc degeneration reveals a down-regulation of canonical wnt signaling and caveolin-1 expression: Implications for development of regenerative strategies. Arthritis Res Ther 2013 Jan 29;15(1):R23. Farndale RW, Sayers CA, Barrett AJ. A direct spectrophotometric microassay for sulfated glycosaminoglycans in cartilage cultures. Connect Tissue Res 1982;9(4):247-8. Neuman RE, Logan MA. The determination of hydroxyproline. J Biol Chem 1950 May;184(1):299-306. The R Project for Statistical Computing. Vienna, austria: The R foundation for Statistical computing. http://www.r-project.org ISO 10993-5:2009 biological evaluation of medical devices. part 5: Tests for in vitro cytotoxicity; international organization for standardization: Geneva, switzerland, 2009. Kranenburg HC, Meij BP, Onis D, van der Veen AJ, Saralidze K, Smolders LA, Huizinga JG, Knetsch ML, Luijten PR, Visser F, Voorhout G, Dhert WJ, Hazewinkel HA, Koole LH. Design, synthesis, imaging, and biomechanics of a softness-gradient hydrogel nucleus pulposus prosthesis in a canine lumbar spine model. J Biomed Mater Res B Appl Biomater 2012 Nov;100(8):2148-55. Heathfield SK, Le Maitre CL, Hoyland JA. Caveolin-1 expression and stress-induced premature senescence in human intervertebral disc degeneration. Arthritis Res Ther 2008;10(4):R87. Sobajima S, Shimer AL, Chadderdon RC, Kompel JF, Kim JS, Gilbertson LG, Kang JD. Quantitative analysis of gene expression in a rabbit model of intervertebral disc degeneration by real-time polymerase chain reaction. Spine J 2005 Jan-Feb;5(1):14-23. Willems N, Yang H, Langelaan M, Tellegen A, Grinwis G, Kranenburg H, Riemers F, Plomp S, Craenmehr E, Dhert W, Papen-Botterhuis N, Meij B, Creemers L, Tryfonidou M. Biocompatibility and intradiscal application of celecoxib-loaded pNIPAAM MgFe-LDH hydrogels in a canine spontaneous intervertebral disc degeneration model. Arthritis Res Ther 2015;17(214). Kranenburg HC, Grinwis GC, Bergknut N, Gahrmann N, Voorhout G, Hazewinkel HA, Meij BP. Intervertebral disc disease in dogs - part 2: Comparison of clinical, magnetic resonance imaging, and histological findings in 74 surgically treated dogs. Vet J 2013 Feb;195(2):164-71. Ho G, Leung VY, Cheung KM, Chan D. Effect of severity of intervertebral disc injury on mesenchymal stem cell-based regeneration. Connect Tissue Res 2008;49(1):15-21.

GTCATTCCACTCTCCCTTCTC GAACCCATTCCACAAATGTC CTCAGCTTCTTGGTGGATGC AGGTGTGCAGATGCCGGTTCAGGT TGAAAGGAGCATGTTCTGAAGTAGCACT AAATCAATCTTGACCACGTCG CAGTTTGTTCACCAGGAGCA TCGCAAATCACGTCATCG TTCTGAGAGCCCTCGGT TTGGACCACTTGAGAGTTCG ACCTGTGCAAGTATCCGC

CTCCGATGCCTGCTTCACTACCTT TTATAGTCAAGGGCATATCC GTTCTCATCGTAGGGAGCAAG TTCTTGGCTCTTATGCGATG

Reverse sequence 5’ -> 3’

14 6 3 3 8 2 1 2 53 2 3

8 7 3 6

EXON

111 149 108 87 139 72 151 109 151 250 120

100 104 95 92

Amp. size

62 61 59 62 58 60 60 61 62 65 66

58 58 61 61

Ann. temp (°C)

XM_005618252 XM_846025 NM_001003011 NM_001002949 NM_001003042 NM_001003296 NM_001005757 NM_001003090 XM_005636674 XM_536598 NM_001003182

NM_001003142 NM_001003357 XM_005616513 DQ_402985

Accession #.

Primers used for qPCR analysis of reference genes: glyceraldehyde 3-phosphate dehydrogenase (GAPDH), hypoxanthine-guanine phosphoribosyltransferase (HPRT), ribosomal protein S19 (RPS19), succinate dehydrogenase complex, subunit A, flavoprotein variant (SDHA), and target genes: aggrecan (ACAN), a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS5), B-cell lymphoma 2-associated X (BAX), B-cell lymphoma 2 (BCL2), caspase 3 (CASP3), caveolin-1 (CAV1), cyclin-D1 (CCND1), collagen type I (COL1A1), collagen type II (COL2A1), matrix metalloproteinase 13 (MMP13), and tissue inhibitor of metalloproteinase 1 (TIMP1). Amp. = amplicon, ann. = annealing

13/14 5 2/3 3 8 1 1 2 52 1 2

Target genes ACAN GGACACTCCTTGCAATTTGAG ADAMTS5 CTACTGCACAGGGAAGAG BAX CCTTTTGCTTCAGGGTTTCA BCL2 TGGAGAGVGTCAACCGGGAGATGT CASP3 ATCACTGAAGATGGATGGGTTGGGTT CAV1 CGCACACCAAGGAAATCG CCND1 GCCTCGAAGATGAAGGAGAC COL1A1 GTGTGTACAGAACGGCCTCA COL2A1 GCAGCAAGAGCAAGGAC MMP13 CTGAGGAAGACTTCCAGCTT TIMP1 GGCGTTATGAGATCAAGATGAC

EXON 7 5/6 2/3 6

Forward sequence 5’ -> 3’

Reference genes GAPDH TGTCCCCACCCCCAATGTATC HPRT AGCTTGCTGGTGAAAAGGAC RPS19 CCTTCCTCAAAAAGTCTGGG SDHA GCCTTGGATCTCTTGATGGA

Protein

Table 1. Primers used for quantitative polymerase chain reaction (qPCR)

Additional file 1. Primers used for quantitative polymerase chain reaction

58 | Chapter 2

Intradiscal injection and biocompatibility of PEA microspheres | 59

Additional file 2. Histopathological evaluation of intramuscularly implanted polyester amide polymers in rabbits Implantation tests were performed to evaluate the local effects of implanted test articles on living tissue, at both macroscopic and microscopic level of test articles that were surgically implanted into an appropriate implant site. Hence, test and control materials were implanted into the paravertebral muscle of each of three rabbits. At the end of the observation period of 2 weeks, the area of the tissue surrounding the centre position of each implant strip was examined macroscopically. Subsequently, the implanted sites were processed for histopathologic evaluation by a veterinary pathologist. Inflammation, fibrosis, hemorrhage and necrosis were evaluated on a scale and compared to the control article sites. Polyester amide polymers (PEA) and control implant sites were processed for histopathological evaluation by a veterinary pathologist for each animal using tables 1 and 2. Table 1. Histological evaluation of inflammatory responses. Inflammatory responses

Score

Cell type/response Polymorphonuclear cells Lymphocytes Plasma cells Macrophages Giant cells Necrosis

0 0 0 0 0 0 0

1 Rare, 1-5/phf Rare, 1-5/phf Rare, 1-5/phf Rare, 1-5/phf Rare, 1-5/phf Minimal

2 5-10/phf 5-10/phf 5-10/phf 5-10/phf 5-10/phf Mild

3 heavy infiltrate heavy infiltrate heavy infiltrate heavy infiltrate heavy infiltrate Moderate

4 packed packed packed packed packed Severe

Phf = per high powered field (x 400)

Table 2. Histological evaluation of healing responses. Healing responses

Score

Cell type/response Neovascularisation

0 0

1 Minimal capillary, proliferation, focal, 1-3 buds

Fibrosis

0

Narrow band

Fatty Infiltrate

0

Minimal amount of fat associated with fibrosis

Phf = per high powered field (x 400)

2 Groups of 4-7 capillaries with supporting fibroblastic structures Moderate thick band Several layers of fat and fibrosis

3 Broad band of capillaries with supporting structures Thick band

4 Extensive band of capillaries with supporting fibroblastic structures Extensive band

Elongated and broad accumulation of fat cells at the implant site

Extensive fat completely surrounding the implant

60 | Chapter 2

The relative size of the involved area was scored by assessing the width of the area from the implant/tissue interface to unaffected areas which have the characteristics of normal tissue and normal vascularity. Relative size of the involved are was scored using the following scale: 0 1 2 3 4

= = = = =

0 mm up to 0.5 mm 0.6 – 1.0 mm 1.1 – 2.0 mm > 2.0mm

No site Very slight Mild Moderate Severe

For each implanted site, a total score was determined. The inflammatory response was added up and weighted by a factor of two (2). The healing responses were added up separately. Thereafter, the total score of the inflammatory and healing responses was calculated for each site. The separate tables of the histopathological evaluation of each tested implant and respective control sites 4 weeks after intra-muscular implantation in 3 New Zealand White rabbits are presented below:

Categories of reaction

Test sites

Animal #1 Foreign debris Rel. size Polymorphonuclear cells Lymphocytes Plasma cells Macrophages Giant cells Necrosis Subtotal (x2) Neovascularization Fibrosis Fatty infiltrate

T1 0 1 2 1 0 2 0 0 10 1 1 0

T2 0 1 1 0 0 1 0 0 4 1 1 0

T3 0 1 2 0 0 2 1 0 10 1 1 0

T4 0 1 1 0 0 1 1 0 6 1 1 0

T5 0 1 2 1 0 1 0 0 8 1 1 0

T6 0 1 2 1 0 2 1 0 12 1 1 0

C1 0 1 1 0 0 1 0 0 4 1 1 0

Control sites C2 0 1 1 0 0 1 0 0 4 1 1 0

C3 0 1 1 0 0 1 0 0 4 1 1 0

C4 0 1 1 0 0 1 0 0 4 1 1 0

C5 0 1 1 0 0 1 0 0 4 1 1 0

C6 0 1 1 0 0 1 0 0 4 1 1 0

Subtotal (x1) TOTAL

2 12

2 6

2 12

2 8

2 10

2 14

2 6

2 6

2 6

2 6

2 6

2 6

Intradiscal injection and biocompatibility of PEA microspheres | 61

Categories of reaction

Test sites

Control sites

Animal #2 Foreign debris Rel. size Polymorphonuclear cells Lymphocytes Plasma cells Macrophages Giant cells Necrosis

T1 0* 1 2 0 0 1 1 0

T2 0* 1 2 0 0 1 1 0

T3 0* 1 2 0 0 1 1 0

T4 0 1 2 0 0 1 1 0

T5 0 1 2 1 0 1 1 1

T6

C1 0 1 1 0 0 1 0 0

C2 0 1 1 0 0 1 0 0

C3 0 1 1 0 0 1 0 0

C4 0 1 1 0 0 1 0 0

C5 0 1 1 0 0 1 0 0

C6 0 1 1 0 0 1 0 0

Subtotal (x2)

8

8

8

8

12

NA

4

4

4

4

4

4

Neovasularization Fibrosis Fatty infiltrate

1 1 0

1 1 0

1 1 0

1 1 0

1 1 0

1 1 0

1 1 0

1 1 0

1 1 0

1 1 0

1 1 0

Subtotal (x1)

2

2

2

2

2

NA

2

2

2

2

2

2

TOTAL

10

10

10

10

14

NA

6

6

6

6

6

6

Animal #3 Foreign debris Rel. size Polymorphonuclear cells Lymphocytes Plasma cells Macrophages Giant cells Necrosis

T1 0 1 2 0 0 1 1 0

T2 0 1 1 0 0 2 1 0

T3 0 1 1 0 0 2 1 0

T4 0* 1 1 0 0 1 1 0

T5 0 1 2 1 0 1 1 0

T6 0 1 1 1 0 1 1 0

C1

C2 0 1 1 0 0 1 0 0

C3 0 1 1 0 0 1 0 0

C4 0 1 1 0 0 1 0 1

C5 0 1 1 0 0 1 0 1

C6 0 1 1 0 0 1 0 0

Subtotal (x2)

8

8

8

6

10

8

NA

4

4

6

6

4

Neovasularization Fibrosis Fatty infiltrate

1 1 0

1 1 0

1 1 0

1 1 0

1 1 0

1 1 0

1 1 0

1 1 0

1 1 0

1 1 0

1 1 0

Categories of reaction

Test sites

Control sites

Subtotal (x1)

2

2

2

2

2

2

NA

2

2

2

2

2

TOTAL

10

10

10

8

12

10

NA

6

6

8

8

6

NA: not available; * the PEA in situ was not scored as foreign debris

62 | Chapter 2

Based on the average score of the test and control sites, the average difference between test and controls for each animal was calculated. Animal #

test

control

score

1

10,3

6

4,3

2

10,8

6

4,8

3

10

6,8

3,2

Mean

4,1

Based on ISO10993-6, 2007, Biological Evaluation of Biomedical Devices – part 6, biocompatibility was rated at 4,1 compatible with a slight reaction based on the following scheme: 0.0 – 2.9 3.0 – 8.9 9.0 –15.0 > 15

No reaction Slight reaction Moderate reaction Severe reaction

Intradiscal injection and biocompatibility of PEA microspheres | 63

Additional file 3. T2-values per condition

T2-values in canine non-, sham-, and polyester amide polymer microspheres (PEAM)- injected intervertebral discs showed no significant changes at 6, 12, and 24 weeks.

Additional file 4. Relative gene expression levels in canine intervertebral discs at 6 months follow-up.

Relative gene expression levels in canine non-, sham-, and PEAMs- injected canine IVDs at 6 months follow-up. The non-injected (Non-inj) nuclei pulposi (NP) are set at 1. Gene expression levels of aggrecan (ACAN) (a), matrix metalloproteinase 13 (MMP13) (b), tissue inhibitor of metalloproteinase 1 (TIMP1) (c), and cyclin-D1 (CCND1) (d) were not significantly different between conditions. Data are expressed as n-fold changes ± the standard deviation.

Chapter 3

Intradiscal application of rhBMP-7 does not induce regeneration in a canine model of spontaneous intervertebral disc degeneration Nicole Willems, Frances C. Bach, Saskia G.M. Plomp, Mattie H.P. van Rijen, Jeannette Wolfswinkel, Guy C.M. Grinwis, Clemens Bos, Gustav J. Strijkers, Wouter J.A. Dhert, Björn P. Meij, Laura B. Creemers, Marianna A. Tryfonidou Arthritis Research & Therapy (2015) 17:137

66 | Chapter 3

Abstract Introduction Strategies for biological repair and regeneration of the intervertebral disc (IVD) by cell and tissue engineering are promising, but few have made it into the clinic. Recombinant human bone morphogenetic protein 7 (rhBMP-7) has been shown to stimulate matrix production by IVD cells in vitro, and in vivo in animal models of induced IVD degeneration. The aim of this study was to determine the most effective dose of intradiscally injected rhBMP-7 in a spontaneous canine IVD degeneration model for translation into a clinical application for patients with low back pain. Methods Canine nucleus pulposus cells (NPCs) were cultured with rhBMP-7 to assess the anabolic effect of rhBMP-7 in vitro, and samples were evaluated for glycosaminoglycan (GAG) and DNA content, histology, and matrix-related gene expression. Three different dosages of rhBMP-ϳ;Ϯ͘ϱʅŐ͕ϮϱʅŐ͕ĂŶĚϮϱϬʅŐͿǁĞƌĞŝŶũĞĐƚĞĚin vivo into early degenerated IVDs of canines, which were followed up for 6 months by magnetic resonance imaging (T2weighted imagĞƐ͕ dϭʌ ĂŶĚ dϮ ŵĂƉƐͿ͘ WŽƐƚ-mortem, the effects of rhBMP7 were determined by radiography, computed tomography and macroscopy, and by histological, biochemical (GAG, DNA, collagen), and biomolecular analyses of IVD tissue. Results In vitro, rhBMP-7 stimulated matrix production of canine NPCs as GAG deposition was enhanced, DNA content was maintained and gene expression levels of ACAN and COL2A1 were significantly upregulated. Despite the wide dose range of rhBMP7 (2.5 – ϮϱϬ μg) administered in vivo, no regenerative effects were observed at the IVD level. Instead, extensive extradiscal bone formation was noticed after intradiscal injection of 25 μg and ϮϱϬђŐŽĨ rhBMP-7. Conclusion Intradiscal bolus injection of 2.5, 25, and ϮϱϬђŐƌŚDW-7 showed no regenerative effects in a spontaneous canine IVD degeneration model. /ŶĐŽŶƚƌĂƐƚ͕ŝŶƚƌĂĚŝƐĐĂůŝŶũĞĐƚŝŽŶŽĨϮϱϬ μg rhBMP-7, and to a lesser extent 25 μg rhBMP-7, resulted in extensive extradiscal bone formation, indicating that a bolus injection of rhBMP-7 alone cannot be used for treatment of IVD degeneration in human or canine patients.

Intradiscal application of rhBMP-7 | 67

Introduction 1 Low back pain is one of the major sources of disability in humans. Several studies have 2, 3 provided evidence for its association with intervertebral disc (IVD) degeneration. Current therapies, such as physiotherapy, anti-inflammatory medications, and surgery alleviate symptoms, but do not restore the physiological function of the degenerated IVD. Prevention of further degeneration or regeneration of the IVD require intervention at an early stage. Strategies for biological repair and regeneration of the IVD by cell and tissue engineering are promising, but are not widely clinically applicable thus far. A number of studies have been performed on bone morphogenetic proteins (BMPs) given their 4 potential regenerative role in degenerative IVD disease. BMPs belong to the transforming growth factor- ɴ ;d'&-ɴͿ ƐƵƉĞƌĨĂŵŝůLJ͕ ĂŶĚ ĂƌĞ ŝŶǀŽůǀĞĚ ŝŶ ŵĂŶLJ ĚĞǀĞůŽƉŵĞŶƚĂů 4, 5 Recombinant human bone morphogenetic protein 7 (rhBMP-7) has been processes. 6-8 tested extensively and appears to be a promising BMP for IVD regeneration, as it has been shown to have beneficial effects on extracellular matrix production of rabbit, bovine, 7, 9-13 Several animal models with experimental IVD and human IVD cells in vitro. degeneration were used to study the efficacy and translational aspects of BMP-7 towards 14 a clinical application in humans. In rabbits with induced IVD degeneration, rhBMP-7 restored disc height and improved the IVD viscoelastic properties by increasing the 15, 16 An anti-catabolic effect of rhBMP-7 was shown in a rat model proteoglycan content. 17 with induced IVD degeneration. Also in a canine model of allogenic IVD transplantation, nucleus pulposus cells (NPCs) expressing rhBMP-7, prevented degeneration of the 18 transplanted IVD at 6 months follow-up. Thus far, novel regenerative therapies deploying rhBMP-7 intradiscally have been tested in animal models with induced IVD degeneration, but not in an animal model with spontaneous IVD degeneration that more closely resembles the biological condition in humans. Furthermore, dose response studies evaluating intradiscal injection of rhBMP-7 and possible adverse effects are not 4, 19 available. The goal of this study was to assess the effect of a wide range of intradiscally injected dosages of rhBMP-7 (2.5 – ϮϱϬʅŐͿŝŶĂĐĂŶŝŶĞŵŽĚĞůǁŝƚŚƐƉŽŶƚĂŶĞŽƵƐ/sĚĞŐĞŶĞƌĂƚŝŽŶ ϮϬ͕ Ϯϭ For this, we first that closely resembles IVD degeneration and disease in man. investigated the anabolic effect of two dosages of rhBMP-7 on early degenerated canine NPCs in vitro. Potential regenerative effects of rhBMP-7 in vivo were studied by obtaining conventional T2-ǁĞŝŐŚƚĞĚ ŝŵĂŐĞƐ ĂŶĚ dϮ ĂŶĚ dϭʌ ŵĂƉƐ ŝŶ Ă ůŽŶŐŝƚƵĚŝŶĂů manner. Both dϭʌ ĂŶĚ dϮ ƌĞůĂdžĂƚŝŽŶ ƚŝŵĞƐ ĂƌĞ ĐŽƌƌĞůĂƚĞĚ ǁŝƚŚ /s ĚĞŐĞŶĞƌĂƚŝŽŶ ƐŝŶĐĞ dϮ ƌĞůĂdžĂƚŝŽŶ ƚŝŵĞƐ ĐŽƌƌĞůĂƚĞ ƐƚƌŽŶŐůLJ ǁŝƚŚ ǁĂƚĞƌ ĐŽŶƚĞŶƚ͕ ǁŚŝůĞ dϭʌ ƌĞůĂdžĂƚŝŽŶ ƚŝŵĞƐ ĂƌĞ ƉĂƌƚŝĐƵůĂƌůLJ 22, 23 At 6 months sensitive to a decrease in glycosaminoglycan (GAG) content in the NP. follow up, the effects of rhBMP7 were determined post-mortem by radiography and computed tomography, macroscopy, and by histological, biochemical, and biomolecular

68 | Chapter 3

analyses. Materials and methods Ethics statement All procedures involving animals were approved and conducted in accordance with the guidelines set by the Animal Experiments Committee (DEC) of Utrecht University ;džƉĞƌŝŵĞŶƚĂů ŶƵŵďĞƌƐ͗ ϮϬϭϮ͘///͘Ϭϳ͘Ϭϲϱ͕ ϮϬϭϯ͘///͘ϬϮ͘Ϭϭϳ͕ ĂŶĚ ϮϬϭϯ͘//͘ϭϮ͘ϭϮϲ), as required by Dutch regulation. Isolation and culture of nucleus pulposus cells Nucleus pulposus tissue was separated from early degenerated IVDs (Pfirrmann grade 2) of twelve laboratory beagle dogs; care was taken to avoid the transitional zone. Tissue was washed with hgDMEM + Glutamax + pyruvate (31966, Invitrogen, Paisley, UK) + 1% penicilin/streptomycin (p/s) (P11-ϬϭϬ͕W>ĂďŽƌĂƚŽƌŝĞƐ'ŵď,͕WŝƐĐĂƚĂǁĂLJ͕EJ, USA) and ĚŝŐĞƐƚĞĚǁŝƚŚϬ͘ϭϱйƉƌŽŶĂƐĞ;ϭϭϰϱϵϲϰϯϬϬϭ͕ZŽĐŚĞŝĂŐŶŽƐƚŝĐƐ͕/ŶĚŝĂŶĂƉŽůŝƐ͕h^ͿĨŽƌϰϱ ŵŝŶƵƚĞƐ Ăƚ ϯϳȗ ĂŶĚ ƐƵďƐĞƋƵĞŶƚůLJ ĚŝŐĞƐƚĞĚ ŽǀĞƌŶŝŐŚƚ ǁŝƚŚ Ϭ͘ϭϱй ĐŽůůĂŐĞŶĂƐĞ // ;4176, Worthington, Lakewood, NJ, USAͿ Ăƚ ϯϳȗ͘ EWƐ ǁĞƌĞ ĨŝůƚĞƌĞĚ ŽǀĞƌ Ă ϳϬ ђŵ filter, ĐĞŶƚƌŝĨƵŐĞĚ;ϱŵŝŶĂƚϱϬϬŐͿ͕ĂŶĚĐƌLJŽƉƌĞƐĞƌǀĞĚĂƚƉĂƐƐĂŐĞϬ;ŚŐDDн'ůƵƚĂŵĂdžнϭϬй dimethyl sulfoxide (DMSO) нϭϬйfetal bovine serum (FBS) ;,ŝŐŚƉĞƌĨŽƌŵĂŶĐĞϭϲϬϬϬ-Ϭϰϰ͕ Gibco, Bleiswijk, The Netherlands)) until further use. NPCs were expanded in expansion ŵĞĚŝƵŵ ;ŚŐ DD н 'ůƵƚĂŵĂdž н ƉLJƌƵǀĂƚĞ ;/ŶǀŝƚƌŽŐĞŶͿ͕ ϭϬй &^͕ ϭй ƉͬƐ͕ ϮϬ ŵD ascorbate-2-ƉŚŽƐƉŚĂƚĞ ;ϴϵϲϬ͕ ^ŝŐŵĂ-ůĚƌŝĐŚ͕ ^ĂŝŶƚ >ŽƵŝƐ͕ DK͕ h^Ϳ͕ Ϭ͘ϬϮ ŵD dexamethasone (D1756, Sigma-ůĚƌŝĐŚͿ͕ϭŶŐͬŵůď&'&;W,WϭϬϱ͕ď^ĞƌŽƚĞĐ͕KdžĨŽƌĚ͕hĂDĂƌĐĂ&͕WĂƌŬW͘ŽŶĞŵŽƌƉŚŽŐĞŶĞƚŝĐ proteins and degenerative disŬĚŝƐĞĂƐĞ͘EĞƵƌŽƐƵƌŐĞƌLJϮϬϭϮ Ɖƌ͖ϳϬ;ϰͿ͗ϵϵϲ͕ ϭϬϬϮ͖ĚŝƐĐƵƐƐŝŽŶϭϬϬϮ͘ Reddi AH. Bone and cartilage differentiation. Curr Opin Genet Dev 1994 Oct;4(5):737-44. ͕DĂƚŝĐŝĐ͕WŝƌŬŝĐ͕zŝŶ^͕ 1 wk, other) and their interaction. Residual plots and quantile-quantile(QQ)-plots were used to check the critical assumptions of linearity, equal variance at all fitted values and the assumption of normally distributed residuals. The Cox proportional hazards regression model was used for analysis of the COX-2 values, that did not approximate a normal distribution after log transformation. ‘Grade’ (Pfirrmann grade I – IV) and ‘breed’ (CD, NCD) and their interaction were incorporated into this model. Calculations were performed on values distracted from 100%. In the absence of COX-2 positive cells the sample was set at 100% and right censored. Histological reactive changes in the IVDs were statistically evaluated by using the nonparametric Kruskal-Wallis test, followed by a MannWhitney U-test. The Spearman’s correlation coefficient was calculated to estimate the correlation between the presence of inflammatory cells (‘yes’ or ‘no’) and COX-2 positive cells.

138 | Chapter 5

For all statistical models, regression coefficients were estimated by the maximum likelihood method. Model selection was based on the lowest Akaike Information Criterion (AIC). Confidence intervals were calculated and stated at the 99% confidence level to correct for multiple comparisons. Differences between treatments were considered significant if the confidence interval did not include 0, whereas hazard ratios were considered significant if the confidence interval did not include 1. Significant differences and the corresponding confidence intervals are represented in Additional file 2. Results Extracellular matrix components and inflammatory profiles in relation to stage of degeneration GAG content normalized for wet weight did not significantly change with degeneration grade according to Pfirrmann (Figure 1A and 1B). In grade IV + V samples the GAG content in the NP was significantly lower than in the AF (Figure 1A). DNA expressed as μg/mg wet weight was significantly lower in grade II samples compared with grade IV + V samples (Figure 1B). Due to sample limitations, samples that were above the upper range of the PGE2 assay (> 1000 pg/ml) were set at 1000 pg/ml. PGE2 levels normalized for wet weight were significantly lower in grade I NP samples compared with those in grade II, III, and IV + V NP samples (Figure 2A). PGE2 levels normalized for DNA were significantly lower in grade I samples compared with grade II, III, and IV + V samples regardless of the tissue origin (NP/AF), dog type (CD/NCD), or treatment group (no treatment, NSAID < 1 wk, NSAID > 1 wk, cort < 1 wk, cort > 1 wk, other)(Figure 2B). Cytokines IL-2, IL-6, IL-7, IL-8, IL-10, IL-15, IL-18, IP-10, TNF-ɲ, and GM-CSF were not detectable in the samples. Chemokine CCL2 was measured in 66/120 samples and chemokine CXCL1 in 119/120 samples. CXCL1 and CCL2 expressed as pg/gram wet weight did not significantly change with degeneration (Figure 2C and 2D). There were no significant differences between treatment groups. Extracellular matrix components and inflammatory profiles in relation to herniation of NP and AF GAG and DNA (Figure 1C and 1D) and CXCL1 (Figure 2D and 2E) expressed as pg/gram wet weight were not significantly different between herniation groups. PGE2 levels normalized for either DNA content or wet weight, were significantly lower in non-herniated samples compared with extruded and protruded samples of NCD dogs, regardless of the tissue origin (NP/AF), or treatment group (no treatment, NSAID < 1 wk, NSAID > 1 wk, cort < 1 wk, cort > 1 wk, other). CCL2 levels in the NP from extruded samples were significantly higher compared with the AF of these samples and the NP from protrusion samples regardless of the dog breed (CD/NCD) (Figure 2F). There were no significant differences between biochemical parameters of CD and NCD dogs or treatment groups.

Inflammatory profiles in canine intervertebral disc degeneration | 139

Figure 1. Mean + standard deviation glycosaminoglycan (GAG) and DNA content normalized for weight in the nucleus pulposus (NP) and annulus fibrosus (AF) per Pfirrmann grade (A and B) and per herniation (C and D). A. GAG/weight levels were significantly higher in the AF compared with the NP in grade IV + V samples. B. DNA/weight was significantly lower in the NP of grade II samples compared with grade IV + V. C and D. Normalized GAG and DNA levels did not significantly differ between herniation groups. No significant differences were shown between dog (chondrodystrophic, non-chondrodystrophic) or treatment (no treatment, NSAID < 1 wk, NSAID > 1 wk, corticosteroids (cort) < 1 wk, cort > 1 wk, other) groups, hence these groups are not shown separately. ** Indicates significant difference at a 99% confidence level

Pfirrmann grade II samples from this study were compared with Pfirrmann grade II 40 samples obtained from experimental CD dogs (Figure 3A). As sample weights were not available in the previous study, PGE2 was normalized for DNA. In this combined Pfirrmann grade II dataset, PGE2/DNA in the NP was significantly higher in extruded samples compared with Pfirrmann grade II IVDs with the NP in situ. To compare this combined Pfirrmann grade II dataset to the complete dataset, we have normalized PGE2 for DNA (Figure 3b and 3c).

140 | Chapter 5

Figure 2. Mean + standard deviation prostaglandin E2 (PGE2) and chemokine (C-C motif) ligand 2 (CCL2) and chemokine (C-X-C motif) ligand 1 (CXCL1) levels normalized for weight in the nucleus pulposus (NP) and annulus fibrosus (AF) per Pfirrmann grade (A, B, C) and per herniation (D, E, F). A. PGE2 levels expressed as pg/mg wet weight in grade I NP samples were significantly lower compared with grade II, III, and IV + V NP samples. B and C. CCL2 and CXCL1 levels normalized for weight did not significantly change with degeneration. D. PGE2 levels did not significantly differ in the NP and AF between the three herniation groups. E. CXCL1 levels did not significantly differ between herniation groups. F. CCL2 levels normalized for weight in the NP from extruded samples were significantly higher compared with the AF of these samples and the NP from protruded samples. No significant differences were shown between treatment (no treatment, NSAID < 1 wk, NSAID > 1 wk, corticosteroids (cort) < 1 wk, cort > 1 wk, other) groups, hence these groups are not shown separately. ** Indicates significant difference at a 99% confidence level

Inflammatory profiles in canine intervertebral disc degeneration | 141

Figure 3. Mean + standard deviation PGE2 levels normalized for DNA content in the nucleus pulposus (NP) and annulus fibrosus (AF) in Pfirrmann grade II samples obtained from experimental chondrodystrophic (CD) dogs (A), and in the complete dataset (CD and nonchondrodystrophic (NCD) dogs) per Pfirrmann grade (B), and per herniation (C). A. PGE2 levels ĞdžƉƌĞƐƐĞĚ ĂƐ ƉŐͬʅŐ E ŝŶ ƚŚĞ EW ŽĨ  ĚŽŐƐ were significantly higher in protruded grade II samples compared with NP in situ samples. B. PGE2 levels normalized for DNA were significantly lower in grade I samples compared with grade II, III, and IV + V samples regardless of the tissue origin (NP/AF), dog group (CD/NCD), or treatment group (no treatment, NSAID < 1 wk, NSAID > 1 wk, corticosteroids (cort) < 1 wk, cort > 1 wk, other). C. PGE2 ůĞǀĞůƐ ĞdžƉƌĞƐƐĞĚ ĂƐ ƉŐͬʅŐ E ǁĞƌĞ significantly lower in non-herniated samples compared with extruded and protruded samples in NCD dogs, regardless of the tissue origin (NP/AF), or treatment group (no treatment, NSAID < 1 wk, NSAID > 1 wk, corticosteroids (cort) < 1 wk, cort > 1 wk, other). ** Indicates significant difference at a 99% confidence level

Histology and COX-2 expression Histological scores according to the grading scheme by Bergknut et al. ranged from 7 – 12 (median = 8) for Pfirrmann grade I, 8 – 27 (median = 14) for Pfirrmann grade II, 14 – 20 (median =19) for Pfirrmann grade III, and 18 – 26 (median = 21) for Pfirrmann grade IV + V. In 5/37 IVDs from 3/16 dogs ventral bone formation was seen in grade I – V IVDs. Histology revealed no inflammatory cells or fibroblasts in the NP of Pfirrmann grade I – V IVDs, and in the dorsal AF of Pfirrmann grade I IVDs. However, in higher degeneration grades, focal infiltration of macrophages, proliferation of fibroblasts and capillaries were detected in the dorsal and/or the ventral ligament, extending into the outer layers of the dorsal and ventral AF, respectively (Figure 4). Macrophages and proliferation of fibroblasts were present in 0% (0/10), 10% (1/10), 83% (5/6) and 55% (6/11) of the IVDs scored a Pfirrmann grade I, II, III, IV + V, respectively. Numbers of macrophages and fibroblasts in grade IV + V IVDs were significantly higher than in grade I, and in grade III significantly higher than in grade I and II. Protrusion of the AF was seen in a grade II and a grade IV + V IVD.

142 | Chapter 5

Figure 4. Representative histological images of the annulus fibrosus (AF) of intervertebral discs (IVDs) graded according to Pfirrmann stained with a cyclooxygenase-2 (COX-2) antibody and counterstained with hematoxylin. A. The dorsal AF of a non-degenerated Pfirrmann grade 1 IVD consisted of well-organized lamellae with COX-2 negative spindle-shaped fibroblasts (asterisks). B. In the dorsal AF of a degenerated Pfirrmann grade IV IVD lamellar organization was lost and COX-2 negative chondrocytes (arrowheads) as well as COX-2 positive chondrocytes (arrows) were present. c. The dorsal AF of a Pfirrmann grade V IVD consisted of COX-2 negative chondrocytes (arrowheads), whereas COX-2 positive macrophages (open arrows) were situated in the dorsal ligament. Percentages of COX-2-positive cells in the NP and dorsal AF of grade I and grade II tissue were significantly lower compared with the NP and dorsal AF of grade IV + V samples (Figure 5). The presence of ŵĂĐƌŽƉŚĂŐĞƐĂŶĚĨŝďƌŽďůĂƐƚƐŝŶƚŚĞ ĚŽƌƐĂů&ǁĂƐŵŽĚĞƌĂƚĞůLJĐŽƌƌĞůĂƚĞĚ;^ƉĞĂƌŵĂŶ͛ƐʌсϬ͘ϰ͕p-value = 0.003) with COX-2 positive cells in the dorsal AF.

Figure 5. Percentage of COX-2-positive cells in the nucleus pulposus (NP) and annulus fibrosus (AF) per Pfirrmann grade. The NP and AF of grade I and grade II samples were significantly lower compared with the NP and AF grade IV + V samples. ** Indicates significant difference at a 99% confidence level

Discussion To our knowledge this is the first study that describes levels of COX-2, PGE2, cytokines, chemokines, and matrix components in IVDs from CD and NCD dogs with and without clinical signs of IVD disease and degeneration. PGE2 levels were significantly higher in degenerated IVDs compared with non-degenerated IVDs, and they were also higher in herniated (protruded and extruded) IVDs from NCD dogs compared with non-herniated IVDs of NCD dogs. In contrast to PGE2 levels in Pfirrmann grade II IVDs from CD dogs with (a limited number of) protruded IVDs, PGE2 levels in extruded IVDs were not significantly different from IVDs with the NP in situ. Furthermore, COX-2 protein expression was significantly higher in degenerated IVDs compared with non-degenerated IVDs. These results are consistent with findings in herniated human lumbar IVD cells that produced increased PGE2 levels spontaneously in vitro compared with PGE2 levels in control IVD 15 cells.

Inflammatory profiles in canine intervertebral disc degeneration | 143

Contrary to PGE2 levels, COX-2 expression in the NP and AF and numbers of macrophages in the dorsal and ventral ligaments were increased in advanced stages of degeneration. Histological results of non-herniated degenerated IVDs in our study are consistent with histological findings described in studies on canine herniated IVDs. In extruded IVDs an acute inflammatory reaction has been described, characterized by neutrophils and macrophages, while in protruded IVDs a more chronic inflammatory reaction has been 47, 48 described, characterized by macrophages, lymphocytes and plasma cells. Macrophages do not only have a phagocytic function, but secret next to cytokines also a number of growth factors, e.g. fibroblast growth factor, transforming growth factor beta, 49 that can induce neovascularization and mediate cell proliferation and differentiation. The focal infiltrates of macrophages, proliferation of fibroblasts and capillaries, and the new bone formation as was seen histologically in some IVDs are reactive tissue changes that might reflect a process of tissue repair. Although a physiological inflammatory response to aseptic tissue injury primarily serves to promote tissue repair, macroscopic findings may reflect an excessive inflammatory response. This response may have detrimental effects on tissue integrity, and may contribute to the pathogenesis of IVD degeneration and/or disease. Significantly higher PGE2 levels in degenerated NP tissues compared with nondegenerated IVDs were observed. Although not significantly different, PGE2 levels and COX-2 expression in grade II and IV + V IVDs were consistently higher in the NP of degenerated IVDs compared with AF, while the contrary was true for non-degenerated IVDs. In Pfirrmann grade II samples from CD dogs, PGE2 levels in the NP were significantly higher in Pfirrmann grade II IVDs with protrusion compared with IVDs with the NP in situ. This may indicate that the production of inflammatory mediators is more pronounced at the NP level. We cannot exclude that NP and AF cells respond differently to inflammatory stimuli and mechanic stress and hence produce different levels of PGE2, as also suggested 50 by others based on in vitro experiments in rat IVD cells. Cytokine and chemokine profiles in this study are largely consistent with limited veterinary publications. The significantly increased CCL2 levels in NP tissue of dogs with Hansen type I herniation compared with AF tissue and NP tissue in dogs with Hansen type II herniation are in line with other studies 35 reporting upregulated gene expression levels of CCL2 in dogs with extrusion of the NP. Furthermore, increased CCL2 protein expression and CCL2 production levels have been 28 reported in human prolapsed IVDs. No studies in canine tissues, and only limited studies in human tissues, have determined cytokine and/or chemokine levels by using a (multiplex) sandwich immunoassay, and have shown increased levels of IFN-ɶ͕/>-1, TNF-ɲ͕ and CCL2, in epidural lavage fluid and in cell culture media, which complicates comparison 51-53 Cytokine levels of IL-2, IL-6, IL-7, IL-8, IL-10, IL-15, IL-18, IP-10, TNF-ɲ͕ĂŶĚ of results. GM-CSF were not detected in NP and AF tissues of this study, consistent with

144 | Chapter 5

downregulated gene expression levels of IL-2, IL-6, IL-10, and TNF-ɲŝŶŚĞƌŶŝĂƚĞĚĐĂŶŝŶĞ 35 IVDs. Nevertheless, our findings seem to be in contrast with increased protein and gene 23-25, 28, 29, 54 Given the short half-life of expression levels of TNF-ɲĂŶĚ/>-1 in human IVDs. 55, 56 and that all samples collected from degenerated IVDs were TNF- ɲ ĂŶĚ cytokines, obtained during surgery and in several cases after flushing of the spinal canal, we cannot rule out degradation of cytokines/chemokines by the collection, preparation, and storage process. Although several studies have shown that IVD cells have the capacity to produce PGE2, we cannot rule out that PGE2 levels were influenced by infiltration from the epidural space. Despite elevated PGE2 levels in degenerated NP tissue in this study, GAG content was not significantly different between healthy and degenerated IVDs, while severely degenerated AFs (grade IV + V) had a higher GAG content compared with the NP. The latter may be explained by the presence of GAG-producing chondrocytes in the AF, known to be present 45 in later stages of degeneration, or by the presence of unidentified GAG-rich herniated NP and/or inner AF material in AF samples. These findings are in contrast with the decrease in 1, 11 One plausible GAG content with increasing IVD degeneration described in literature. explanation for this discrepancy lies in the scoring system of degeneration prior to surgery and the matrix heterogeneity of the degenerated NP tissue, discussed in detail below. Interestingly, cell density (DNA/weight) in our study was significantly higher in the NP of severely degenerated IVDs compared with mildly degenerated IVDs. These findings touch upon findings in human IVD degeneration, in which cell density in the inner AF and NP of severely degenerated (Thompson grade V) specimens was significantly higher compared 57, 58 with lower grades. The results on the effects of PGE2 on proteoglycan metabolism are conflicting. PGE2 at concentrations much lower than those involved in inflammation have been demonstrated 59 to be chondroprotective. PGE2 has been described to have anti-catabolic effects by downregulating the expression and synthesis of IL-1, TNF- ɲ͕ ĂŶĚ ŵĂƚƌŝdž metalloproteinases (MMPs), and to have anabolic effects by to inducing the expression, synthesis and secretion of IGF-I, and stimulating collagen and proteoglycan synthesis, 16, 60-62 In vitro, low concentrations of PGE2 have important factors in anabolic processes. been described to stimulate proteoglycan synthesis in rat chondrocytes, whereas higher 16, 61 doses have been described to decrease proteoglycan synthesis in NP cells. Furthermore, degradation of proteoglycans was not inhibited by a range of PGE2 60 concentrations in osteoarthritic chondrocytes. These possible protective effects of PGE2 might have resulted in preservation of GAG content in the course of IVD degeneration. Nevertheless, these results should be interpreted with care, as GAG content of the studied tissues may have been affected by confounding factors explained below.

Inflammatory profiles in canine intervertebral disc degeneration | 145

There are several confounding factors that may affect the results in the current study, including the factors that influence the scoring system of degeneration and the matrix heterogeneity of the degenerated NP tissue. Extruded NP tissue displaced into the vertebral canal results in narrowing of the disc space and a T2-hypointense area within the IVD on MRI. Hence, we cannot exclude that prior to the extrusion incident the IVD may have been assessed with a lower Pfirrmann score. Moreover, in CD dogs, calcification of 63, 64 In addition, in the NP could have negatively influenced the signal intensity in the NP. both CD and NCD dogs, IVDs may have been graded falsely higher due to hemorrhage or inflammation, that may have influenced the appearance of the IVD on MR images. Matrix heterogeneity is common in degenerating NP tissue. In human IVDs several disc-specific locations are described with a high variation in GAG and water content, suggestive of focal 65 damage and degeneration. Although this has not yet been described in dogs, we cannot rule out that tissues collected during surgery may have originated from specific GAG-rich areas in the IVD, that inherently are more prone to extrusion/protrusion compared with degenerated fibrotic tissue. Furthermore, due to sample limitations PGE2 values higher than 1000 pg/ml could not be measured reliably, but could have resulted in an underestimation of the highest samples. Lastly, a relatively high percentage of dogs in this study was treated prior to surgery with anti-inflammatory drugs, e.g. NSAIDs and corticosteroids. Dogs that did not respond to anti-inflammatory drugs initially, were treated with other drugs, e.g. opioids, GABA-agonists. Although treatment groups were categorized, duration of treatment and dosages used showed a high variation, and might have had an influence on the results. From a clinical perspective, decompression surgery is recommended if dogs present with clinical signs, and diagnostic work-up indicates compression of neural tissue (spinal cord and/or nerve roots) due to extruded material. With regard to an intradiscal application that provides controlled release of an anti-inflammatory drug, future studies should focus on protruded IVDs. Obviously, this would indicate development of an application in NCD dogs, as disc protrusion rarely occurs in CD dogs. IVDs ideally should be early degenerated (Pfirrmann grade II – III), without irreversible anatomical malformations due to degenerative changes. Conclusion In this study we have shown that PGE2 levels, and CCL2 levels in degenerated and herniated tissues were significantly higher compared with non-degenerated and nonherniated tissues. COX-2 expression in the NP and AF and numbers of macrophages in the AF increased with advancing degeneration stages. Although macrophages invade the dorsal and ventral AF as degeneration progresses, the production of inflammatory mediators seems most pronounced in degenerated NP tissue. Future studies are needed

146 | Chapter 5

to investigate if inhibition of PGE2 levels in degenerated IVDs provide effective analgesia and exerts a protective role in the process of IVD degeneration and the development of IVD disease.

Acknowledgements This research forms part of the Project P2.01 IDiDAS of the research program of the BioMedical Materials institute, co-funded by the Dutch Ministry of Economic Affairs, Agriculture and Innovation. The financial contribution of the Dutch Arthritis Foundation is gratefully acknowledged (IDiDAS and LLP22). We would like to acknowledge the assistance of Saskia van Dongen in performing the biochemical assays.

Inflammatory profiles in canine intervertebral disc degeneration | 147

References 1.

2. 3.

4. 5. 6. 7.

8. 9.

10. 11. 12. 13. 14. 15.

16. 17.

18.

19.

Bergknut N, Rutges JP, Kranenburg HC, Smolders LA, Hagman R, Smidt HJ, Lagerstedt AS, Penning LC, Voorhout G, Hazewinkel HA, Grinwis GC, Creemers LB, Meij BP, Dhert WJ. The dog as an animal model for intervertebral disc degeneration? Spine (Phila Pa 1976) 2012 Mar 1;37(5):351-8. Schmied O, Golini L, Steffen F. Effectiveness of cervical hemilaminectomy in canine hansen type I and type II disc disease: A retrospective study. J Am Anim Hosp Assoc 2011 Sep-Oct;47(5):342-50. Suwankong N, Meij BP, Voorhout G, de Boer AH, Hazewinkel HA. Review and retrospective analysis of degenerative lumbosacral stenosis in 156 dogs treated by dorsal laminectomy. Vet Comp Orthop Traumatol 2008;21(3):285-93. Macias C, McKee WM, May C, Innes JF. Thoracolumbar disc disease in large dogs: A study of 99 cases. J Small Anim Pract 2002 Oct;43(10):439-46. Cudia SP, Duval JM. Thoracolumbar intervertebral disk disease in large, nonchondrodystrophic dogs: A retrospective study. J Am Anim Hosp Assoc 1997 Sep-Oct;33(5):456-60. Brisson BA. Intervertebral disc disease in dogs. Vet Clin North Am Small Anim Pract 2010 Sep;40(5):829-58. Levine JM, Levine GJ, Kerwin SC, Hettlich BF, Fosgate GT. Association between various physical factors and acute thoracolumbar intervertebral disk extrusion or protrusion in dachshunds. J Am Vet Med Assoc 2006 Aug 1;229(3):370-5. Hansen HJ. A pathologic-anatomical study on disc degeneration in dog, with special reference to the socalled enchondrosis intervertebralis. Acta Orthop Scand Suppl 1952;11:1-117. Smolders LA, Bergknut N, Grinwis GC, Hagman R, Lagerstedt AS, Hazewinkel HA, Tryfonidou MA, Meij BP. Intervertebral disc degeneration in the dog. part 2: Chondrodystrophic and non-chondrodystrophic breeds. Vet J 2013 Mar;195(3):292-9. Adams MA, Roughley PJ. What is intervertebral disc degeneration, and what causes it? Spine (Phila Pa 1976) 2006 Aug 15;31(18):2151-61. Roughley PJ. Biology of intervertebral disc aging and degeneration: Involvement of the extracellular matrix. Spine (Phila Pa 1976) 2004 Dec 1;29(23):2691-9. Brisby H. Pathology and possible mechanisms of nervous system response to disc degeneration. J Bone Joint Surg Am 2006 Apr;88 Suppl 2:68-71. Freemont AJ, Peacock TE, Goupille P, Hoyland JA, O'Brien J, Jayson MI. Nerve ingrowth into diseased intervertebral disc in chronic back pain. Lancet 1997 Jul 19;350(9072):178-81. Ahn SH, Cho YW, Ahn MW, Jang SH, Sohn YK, Kim HS. mRNA expression of cytokines and chemokines in herniated lumbar intervertebral discs. Spine (Phila Pa 1976) 2002 May 1;27(9):911-7. Kang JD, Georgescu HI, McIntyre-Larkin L, Stefanovic-Racic M, Donaldson WF,3rd, Evans CH. Herniated lumbar intervertebral discs spontaneously produce matrix metalloproteinases, nitric oxide, interleukin-6, and prostaglandin E2. Spine (Phila Pa 1976) 1996 Feb 1;21(3):271-7. Vo NV, Sowa GA, Kang JD, Seidel C, Studer RK. Prostaglandin E2 and prostaglandin F2alpha differentially modulate matrix metabolism of human nucleus pulposus cells. J Orthop Res 2010 Oct;28(10):1259-66. Li W, Liu T, Wu L, Chen C, Jia Z, Bai X, Ruan D. Blocking the function of inflammatory cytokines and mediators by using IL-10 and TGF-beta: A potential biological immunotherapy for intervertebral disc degeneration in a beagle model. Int J Mol Sci 2014 Sep 26;15(10):17270-83. Burke JG, Watson RW, McCormack D, Dowling FE, Walsh MG, Fitzpatrick JM. Spontaneous production of monocyte chemoattractant protein-1 and interleukin-8 by the human lumbar intervertebral disc. Spine (Phila Pa 1976) 2002 Jul 1;27(13):1402-7. Hoyland JA, Le Maitre C, Freemont AJ. Investigation of the role of IL-1 and TNF in matrix degradation in the intervertebral disc. Rheumatology (Oxford) 2008 Jun;47(6):809-14.

148 | Chapter 5

20.

21.

22. 23. 24.

25. 26. 27. 28.

29.

30.

31. 32.

33.

34.

35.

36.

37.

Hughes SP, Freemont AJ, Hukins DW, McGregor AH, Roberts S. The pathogenesis of degeneration of the intervertebral disc and emerging therapies in the management of back pain. J Bone Joint Surg Br 2012 Oct;94(10):1298-304. Kepler CK, Markova DZ, Hilibrand AS, Vaccaro AR, Risbud MV, Albert TJ, Anderson DG. Substance P stimulates production of inflammatory cytokines in human disc cells. Spine (Phila Pa 1976) 2013 Oct 1;38(21):E1291-9. Le Maitre CL, Freemont AJ, Hoyland JA. The role of interleukin-1 in the pathogenesis of human intervertebral disc degeneration. Arthritis Res Ther 2005;7(4):R732-45. Le Maitre CL, Hoyland JA, Freemont AJ. Catabolic cytokine expression in degenerate and herniated human intervertebral discs: IL-1beta and TNFalpha expression profile. Arthritis Res Ther 2007;9(4):R77. Le Maitre CL, Hoyland JA, Freemont AJ. Interleukin-1 receptor antagonist delivered directly and by gene therapy inhibits matrix degradation in the intact degenerate human intervertebral disc: An in situ zymographic and gene therapy study. Arthritis Res Ther 2007;9(4):R83. Le Maitre CL, Pockert A, Buttle DJ, Freemont AJ, Hoyland JA. Matrix synthesis and degradation in human intervertebral disc degeneration. Biochem Soc Trans 2007 Aug;35(Pt 4):652-5. Le Maitre CL, Binch AL, Thorpe A, Hughes SP. Degeneration of the intervertebral disc with new approaches for treating low back pain. J Neurosurg Sci 2014 Nov 25. Park JY, Pillinger MH, Abramson SB. Prostaglandin E2 synthesis and secretion: The role of PGE2 synthases. Clin Immunol 2006 Jun;119(3):229-40. Phillips KL, Chiverton N, Michael AL, Cole AA, Breakwell LM, Haddock G, Bunning RA, Cross AK, Le Maitre CL. The cytokine and chemokine expression profile of nucleus pulposus cells: Implications for degeneration and regeneration of the intervertebral disc. Arthritis Res Ther 2013;15(6):R213. Purmessur D, Walter BA, Roughley PJ, Laudier DM, Hecht AC, Iatridis J. A role for TNFalpha in intervertebral disc degeneration: A non-recoverable catabolic shift. Biochem Biophys Res Commun 2013 Mar 29;433(1):151-6. Shamji MF, Setton LA, Jarvis W, So S, Chen J, Jing L, Bullock R, Isaacs RE, Brown C, Richardson WJ. Proinflammatory cytokine expression profile in degenerated and herniated human intervertebral disc tissues. Arthritis Rheum 2010 Jul;62(7):1974-82. Takahashi H, Suguro T, Okazima Y, Motegi M, Okada Y, Kakiuchi T. Inflammatory cytokines in the herniated disc of the lumbar spine. Spine (Phila Pa 1976) 1996 Jan 15;21(2):218-24. Wang J, Markova D, Anderson DG, Zheng Z, Shapiro IM, Risbud MV. TNF-alpha and IL-1beta promote a disintegrin-like and metalloprotease with thrombospondin type I motif-5-mediated aggrecan degradation through syndecan-4 in intervertebral disc. J Biol Chem 2011 Nov 18;286(46):39738-49. Wang J, Tian Y, Phillips KL, Chiverton N, Haddock G, Bunning RA, Cross AK, Shapiro IM, Le Maitre CL, Risbud MV. Tumor necrosis factor alpha- and interleukin-1beta-dependent induction of CCL3 expression by nucleus pulposus cells promotes macrophage migration through CCR1. Arthritis Rheum 2013 Mar;65(3):832-42. Weiler C, Nerlich AG, Bachmeier BE, Boos N. Expression and distribution of tumor necrosis factor alpha in human lumbar intervertebral discs: A study in surgical specimen and autopsy controls. Spine (Phila Pa 1976) 2005 Jan 1;30(1):44,53; discussion 54. Karli P, Martle V, Bossens K, Summerfield A, Doherr MG, Turner P, Vandevelde M, Forterre F, Henke D. Dominance of chemokine ligand 2 and matrix metalloproteinase-2 and -9 and suppression of proinflammatory cytokines in the epidural compartment after intervertebral disc extrusion in a canine model. Spine J 2014 Dec 1;14(12):2976-84. Iwata M, Ochi H, Asou Y, Haro H, Aikawa T, Harada Y, Nezu Y, Yogo T, Tagawa M, Hara Y. Variations in gene and protein expression in canine chondrodystrophic nucleus pulposus cells following long-term three-dimensional culture. PLoS One 2013 May 2;8(5):e63120. Brock TG, McNish RW, Peters-Golden M. Arachidonic acid is preferentially metabolized by cyclooxygenase-2 to prostacyclin and prostaglandin E2. J Biol Chem 1999 Apr 23;274(17):11660-6.

Inflammatory profiles in canine intervertebral disc degeneration | 149

38. 39. 40.

41.

42.

43.

44. 45.

46. 47.

48. 49. 50.

51.

52.

53.

54. 55.

Clark TP. The clinical pharmacology of cyclooxygenase-2-selective and dual inhibitors. Vet Clin North Am Small Anim Pract 2006 Sep;36(5):1061,85, vii. Nell T, Bergman J, Hoeijmakers M, Van Laar P, Horspool LJ. Comparison of vedaprofen and meloxicam in dogs with musculoskeletal pain and inflammation. J Small Anim Pract 2002 May;43(5):208-12. Willems N, Yang H, Langelaan M, Tellegen A, Grinwis G, Kranenburg H, Riemers F, Plomp S, Craenmehr E, Dhert W, Papen-Botterhuis N, Meij B, Creemers L, Tryfonidou M. Biocompatibility and intradiscal application of celecoxib-loaded pNIPAAM MgFe-LDH hydrogels in a canine spontaneous intervertebral disc degeneration model. Arthritis Res Ther 2015;17(214). Samad TA, Moore KA, Sapirstein A, Billet S, Allchorne A, Poole S, Bonventre JV, Woolf CJ. Interleukin-1 beta-mediated induction of cox-2 in the CNS contributes to inflammatory pain hypersensitivity. Nature 2001 Mar 22;410(6827):471-5. Bergknut N, Auriemma E, Wijsman S, Voorhout G, Hagman R, Lagerstedt AS, Hazewinkel HA, Meij BP. Evaluation of intervertebral disk degeneration in chondrodystrophic and nonchondrodystrophic dogs by use of pfirrmann grading of images obtained with low-field magnetic resonance imaging. Am J Vet Res 2011 Jul;72(7):893-8. Harder L, Ludwig D, Galindo-Zamora V, Wefstaedt P, Nolte I. Classification of canine intervertebral disc degeneration using high-field magnetic resonance imaging and computed tomography. Tierarztl Prax Ausg K Kleintiere Heimtiere 2014 Dec 10;42(6):374-82. Farndale RW, Sayers CA, Barrett AJ. A direct spectrophotometric microassay for sulfated glycosaminoglycans in cartilage cultures. Connect Tissue Res 1982;9(4):247-8. Bergknut N, Meij BP, Hagman R, de Nies KS, Rutges JP, Smolders LA, Creemers LB, Lagerstedt AS, Hazewinkel HA, Grinwis GC. Intervertebral disc disease in dogs - part 1: A new histological grading scheme for classification of intervertebral disc degeneration in dogs. Vet J 2013 Feb;195(2):156-63. The R Project for Statistical Computing. Vienna, austria: The R foundation for Statistical computing. http://www.r-project.org Kranenburg HC, Grinwis GC, Bergknut N, Gahrmann N, Voorhout G, Hazewinkel HA, Meij BP. Intervertebral disc disease in dogs - part 2: Comparison of clinical, magnetic resonance imaging, and histological findings in 74 surgically treated dogs. Vet J 2013 Feb;195(2):164-71. Royal AB, Chigerwe M, Coates JR, Wiedmeyer CE, Berent LM. Cytologic and histopathologic evaluation of extruded canine degenerate disks. Vet Surg 2009 Oct;38(7):798-802. Varol C, Mildner A, Jung S. Macrophages: Development and tissue specialization. Annu Rev Immunol 2015 Mar 21;33:643-75. Miyamoto H, Doita M, Nishida K, Yamamoto T, Sumi M, Kurosaka M. Effects of cyclic mechanical stress on the production of inflammatory agents by nucleus pulposus and anulus fibrosus derived cells in vitro. Spine (Phila Pa 1976) 2006 Jan 1;31(1):4-9. Scuderi GJ, Cuellar JM, Cuellar VG, Yeomans DC, Carragee EJ, Angst MS. Epidural interferon gammaimmunoreactivity: A biomarker for lumbar nerve root irritation. Spine (Phila Pa 1976) 2009 Oct 1;34(21):2311-7. Scuderi GJ, Brusovanik GV, Anderson DG, Dunham CJ, Vaccaro AR, Demeo RF, Hallab N. Cytokine assay of the epidural space lavage in patients with lumbar intervertebral disk herniation and radiculopathy. J Spinal Disord Tech 2006 Jun;19(4):266-9. Schroeder M, Viezens L, Schaefer C, Friedrichs B, Algenstaedt P, Ruther W, Wiesner L, Hansen-Algenstaedt N. Chemokine profile of disc degeneration with acute or chronic pain. J Neurosurg Spine 2013 May;18(5):496-503. Risbud MV, Shapiro IM. Role of cytokines in intervertebral disc degeneration: Pain and disc content. Nat Rev Rheumatol 2014 Jan;10(1):44-56. Tarrant JM. Blood cytokines as biomarkers of in vivo toxicity in preclinical safety assessment: Considerations for their use. Toxicol Sci 2010 Sep;117(1):4-16.

150 | Chapter 5

56.

57.

58. 59.

60.

61.

62.

63. 64. 65.

Oliver JC, Bland LA, Oettinger CW, Arduino MJ, McAllister SK, Aguero SM, Favero MS. Cytokine kinetics in an in vitro whole blood model following an endotoxin challenge. Lymphokine Cytokine Res 1993 Apr;12(2):115-20. Hastreiter D, Ozuna RM, Spector M. Regional variations in certain cellular characteristics in human lumbar intervertebral discs, including the presence of alpha-smooth muscle actin. J Orthop Res 2001 Jul;19(4):597-604. Zhao CQ, Wang LM, Jiang LS, Dai LY. The cell biology of intervertebral disc aging and degeneration. Ageing Res Rev 2007 Oct;6(3):247-61. Tchetina EV, Di Battista JA, Zukor DJ, Antoniou J, Poole AR. Prostaglandin PGE2 at very low concentrations suppresses collagen cleavage in cultured human osteoarthritic articular cartilage: This involves a decrease in expression of proinflammatory genes, collagenases and COL10A1, a gene linked to chondrocyte hypertrophy. Arthritis Res Ther 2007;9(4):R75. Di Battista JA, Dore S, Martel-Pelletier J, Pelletier JP. Prostaglandin E2 stimulates incorporation of proline into collagenase digestible proteins in human articular chondrocytes: Identification of an effector autocrine loop involving insulin-like growth factor I. Mol Cell Endocrinol 1996 Oct 14;123(1):27-35. Lowe GN, Fu YH, McDougall S, Polendo R, Williams A, Benya PD, Hahn TJ. Effects of prostaglandins on deoxyribonucleic acid and aggrecan synthesis in the RCJ 3.1C5.18 chondrocyte cell line: Role of second messengers. Endocrinology 1996 Jun;137(6):2208-16. Knudsen PJ, Dinarello CA, Strom TB. Prostaglandins posttranscriptionally inhibit monocyte expression of interleukin 1 activity by increasing intracellular cyclic adenosine monophosphate. J Immunol 1986 Nov 15;137(10):3189-94. Jensen VF, Arnbjerg J. Development of intervertebral disk calcification in the dachshund: A prospective longitudinal radiographic study. J Am Anim Hosp Assoc 2001 May-Jun;37(3): 274-82. Jensen VF, Beck S, Christensen KA, Arnbjerg J. Quantification of the association between intervertebral disk calcification and disk herniation in dachshunds. J Am Vet Med Assoc 2008 Oct 1;233(7):1090-5. Iatridis JC, MacLean JJ, O'Brien M, Stokes IA. Measurements of proteoglycan and water content distribution in human lumbar intervertebral discs. Spine (Phila Pa 1976) 2007 Jun 15;32(14):1493-7.

17

15

7

Grade I

Grade II

Grade III

NP CD

1

6

0

1

6

8

0 0

17

NP in situ/ Extr/Protr

1: Cort>1 wk

1: Other 1: NA 1: Cort1 wk

1: NSAID1 wk

6

1: NSAID1 wk 1: Cort1 wk

8

9

1

NP NCD

2: NSAID1 wk

7: No

17: No

Treatment

6

15

17

AF CD

1

5

0

3

6

6

0 0

17

NP in situ/ Extr/Protr

1: Cort>1 wk

2: NSAID>1 wk

3: NSAID1 wk

1: No

1: Cort1 wk

1: NSAID>1 wk

3: NSAID1 wk 2: Other

1: NSAID1 wk

4: No 2: NSAID>1 wk

1: NSAID>1 wk

1: NSAID1 wk

1: Cort1 wk 1: Other 1: NA

1: NSAID1 wk 1: Other

Treatment

NP = nucleus pulposus, CD = chondrodystrophic, Extr = extrusion, Protr = protrusion, NCD = non-chondrodystrophic, AF = annulus fibrosus, NSAID = non-steroidal antiinflammatory drug, Cort = corticosteroids, NA = not available

IV+V

Grade

NP CD

Continuation table Additional file 1.

152 | Chapter 4

Inflammatory profiles in canine intervertebral disc degeneration | 153

Additional file 2. Significant differences and confidence intervals of statistical analyses

Tables 1, 2, 3, and 4 represent significant differences and confidence intervals of statistical analyses. Figure numbers in the tables correspond to figures shown in the main article.

Table 1. Significant differences and confidence intervals of statistical analyses of glycosaminoglycan (GAG) and DNA content normalized for weight in the nucleus pulposus (NP) and annulus fibrosus (AF) per degeneration grade and per herniation type, corresponding to Figure 1 in the main article. Condition Degeneration 1A. GAG/weight NP grade IV+V Degeneration 1B. DNA/weight NP grade II

vs

Condition

Estimated coefficient

Confidence interval (CI)

CI (%)

vs

AF grade IV+V

0.65

0.05 – 1.25

99

vs

NP grade IV+V

1.13

0.22 – 2.04

99

Table 2. Significant differences and confidence intervals of statistical analyses of prostaglandin E2 (PGE2) and chemokine (C-C motif) ligand 2 (CCL2) and chemokine (C-X-C motif) ligand 1 (CXCL1) levels normalized for weight in the nucleus pulposus (NP) and annulus fibrosus (AF) per Pfirrmann grade and per herniation type, corresponding to Figure 2 in the main article. Condition

vs

Degeneration 2A. PGE2/weight NP grade II NP grade III NP grade IV Herniation 2D. PGE2/weight Extrusion NCD Protrusion NCD 2F. CCL2/weight NP extrusion NP extrusion NCD = non-chondrodystrophic

Condition

Estimated coefficient

Confidence interval (CI)

CI (%)

NP grade I NP grade I NP grade I

2.54 2.84 2.67

1.10 – 3.99 1.28 – 4.41 1.20 – 4.14

99 99 99

In situ NCD In situ NCD

1.85 1.98

0.31 – 3.40 0.79 – 3.17

99 99

AF extrusion NP protrusion

2.07 1.33

0.64 – 3.51 0.21 – 2.45

99 99

154 | Chapter 5

Table 3. Significant differences and confidence intervals of statistical analyses of prostaglandin E2 (PGE2) normalized for DNA content in the nucleus pulposus (NP) and annulus fibrosus (AF) in Pfirrmann grade II samples obtained from experimental chondrodystrophic (CD) dogs, and in the complete dataset (CD and nonchondrodystrophic (NCD) dogs) per Pfirrmann grade, and per herniation type, corresponding to Figure 3 in the main article. Condition

vs

Condition

3A. PGE2/DNA grade II CD dogs NP protrusion NP in situ Degeneration 3B. PGE2/DNA Grade II Grade I Grade III Grade I Grade IV Grade I Herniation 3C. PGE2/DNA Extrusion NCD In situ NCD Protrusion NCD In situ NCD

Estimated coefficient

Confidence interval (CI)

CI (%)

2.08

1.06 – 3.10

99

2.17 2.13 1.47

1.18 – 3.17 1.04 – 3.21 0.46 – 2.48

99 99 99

1.85 1.98

0.31 – 3.40 0.79 – 3.17

99 99

Table 4. Significant differences and confidence intervals of statistical analyses performed on cyclooxygenase-2 (COX-2) expression data in the nucleus pulposus (NP) and annulus fibrosus (AF) per Pfirrmann grade, corresponding to Figure 5 in the main article. Condition NP grade IV + V NP grade IV + V AF grade IV + V AF grade IV + V

vs

Condition NP grade I NP grade II AF grade I AF grade I

Estimated hazard ratio (HR) 34.3 7.40 27.32 4.92

Confidence interval (CI) 2.09 – 562.54 1.39 – 39.46 1.78 – 419.75 1.64 – 14.79

CI (%) 99 99 99 99

Chapter 6

Pedicle screw-rod fixation: a feasible treatment for dogs with severe degenerative lumbosacral stenosis Anna R. Tellegen, Nicole Willems, Marianna A. Tryfonidou, Björn P. Meij BMC Veterinary Research (2015) 7:299

156 | Chapter 6

Abstract Background Degenerative lumbosacral stenosis is a common problem in large breed dogs. For severe degenerative lumbosacral stenosis, conservative treatment is often not effective and surgical intervention remains as the last treatment option. The objective of this retrospective study was to assess the middle to long term outcome of treatment of severe degenerative lumbosacral stenosis with or without evidence of radiological discospondylitis with pedicle screw-rod fixation. Methods Twelve client-owned dogs with severe degenerative lumbosacral stenosis underwent pedicle screw-rod fixation of the lumbosacral junction. During long term follow-up, dogs were monitored by clinical evaluation, diagnostic imaging, force plate analysis, and by using questionnaires to owners. Results Clinical evaluation, force plate data, and responses to questionnaires completed by the owners showed resolution (n=8) or improvement (n=4) of clinical signs after pedicle screw-rod fixation in 12 dogs. There were no implant failures, however, no interbody vertebral bone fusion of the lumbosacral junction was observed in the follow-up period. Four dogs developed mild recurrent low back pain that could easily be controlled by pain medication and an altered exercise regime. Conclusion Pedicle screw-rod fixation offers a surgical treatment option for large breed dogs with severe degenerative lumbosacral stenosis with or without evidence of radiological discospondylitis in which no other treatment is available. Pedicle screw-rod fixation alone does not result in interbody vertebral bone fusion between L7 and S1.

Pedicle screw-rod fixation in dogs with severe DLSS | 157

Background Low back pain in dogs is a common problem and can be the result of different 1 pathologies. Degenerative lumbosacral stenosis (DLSS) is the most common cause of 2 caudal lumbar back pain in middle to large breed dogs. DLSS is characterized by bony and soft tissue changes leading to stenosis of the spinal canal and moderate to severe compression of the cauda equina. The intervertebral disc (IVD) is often degenerated and this results in a shift of load bearing from the IVD to surrounding structures. This may lead to spinal instability. Low back pain can also be caused by other conditions, such as 3 3, 4 discospondylitis, trauma (fracture and/or luxation), or neoplasia. Discospondylitis is a bacterial infection of the IVD and adjacent intervertebral end and commonly originates 3 from a primary urogenital infection via hematogenous spread. Discospondylitis can result in severe proliferation of fibrous tissue and bone, vertebral instability, subchondral bone 5 resorption and secondary DLSS. Computed tomography (CT) and magnetic resonance 6, 7 imaging (MRI) are the most informative modalities to investigate the LS area. Treatment of DLSS can be conservative or surgical. Low back pain in DLSS can be treated with non-steroidal anti-inflammatory drugs and/or opioids, body weight reduction, and an adjusted exercise pattern or physiotherapy. Epidural infiltration with methylprednisolone acetate has been reported as medical treatment for DLSS provided that the dog do not show urinary or fecal incontinence and proprioceptive deficits, and does not suffer from 8 concurrent discospondylitis. In case of discospondylitis long term antibiotic drugs are the primary treatment. Surgical treatment of DLSS is accomplished by dorsal laminectomy or foraminotomy, and if indicated, partial discectomy and uni- or bilateral facetectomy. In the short-term, surgical intervention leads to improvement of clinical signs in 78-93% of 9, 10 which is also cases but in the long-term clinical signs recurred in 17-38% of cases, 11, 12 Moreover, force plate analyses (FPAs) showed that known as failed back syndrome. the propulsive force of the pelvic limbs is not fully restored after decompressive surgery 13 for DLSS. It has been postulated that decompressive surgery, and especially facetectomy, 9, 14 can worsen LS instability in some patients, resulting in further overall degeneration. Therefore, we previously investigated the feasibility of pedicle screw-rod fixation (PSRF) in 14, 15 Screw entry points a cadaver study and in an in vivo pilot study in large breed dogs. and guideline values for safe insertion of pedicle screws into the canine L7 and S1 14, 16, 17 The purpose of spinal fixation vertebrae have been determined in other studies. and interbody fusion is to restore and maintain disc space height and to increase the 18 stability of the operated segment, thereby making further ongoing degenerative changes clinically irrelevant. The aim of the present study is to report the long term results of PSRF in 12 client-owned dogs with severe DLSS and also to assess whether PSRF leads to spinal fusion of the LS junction.

158 | Chapter 6

Materials and methods Dogs Twelve dogs with DLSS treated by PSRF were included in this retrospective study. The medical records of the dogs were systematically reviewed and the signalment, clinical history, findings on clinical examination, force plate data, radiographic, and CT- and/or MR imaging were retrieved. Due to the retrospective nature of the current study, no ethical approval was required. The owners consented to the use and disclosure of patient- and questionnaire data for the current study. Table 1 shows the signalment and clinical history of all the dogs included in this study. Table 1. Overview of signalment, history and radiological diagnosis in 12 dogs with lumbosacral degenerative stenosis (DLSS) and / or discospondylitis that were treated with pedicle screw-rod fixation. Dog #

Breed

Sex

Age (yrs)

1 2 3 4 5

Labrador retriever Rottweiler GSD GSD Rhodesian ridgeback

FC M FC MC F

5 8 8 11 10

6 7 8 9 10 11 12

GSD Cane Corso American Bulldog Border Collie Rhodesian Ridgeback Vizsla Am. staff. terrier

M MC M MC FC MC F

12 7 5 9 7 12 5

History LS pain, paraparesis LS pain LS pain, paraparesis LS pain, paraparesis; DL 6 yrs earlier LS pain, paresis left pelvic limb, urinary incontinence; DL 6 months earlier LS pain, paraparesis LS pain LS pain LS pain LS pain, paraparesis; DL 4 yrs earlier LS pain LS pain, left paresis pelvic limb, DL 3 yrs earlier

Radiological diagnosis DLSS & DS DLSS & DS DLSS & DS DLSS & DS DLSS & DS DLSS & DS DLSS DLSS & DS DLSS & DS DLSS DLSS DLSS

Am. staff. terrier = American Staffordshire terrier, DS = discospondylitis, DL= dorsal laminectomy, F = female, FC = female castrated, GSD = German Shepherd Dog, LS = lumbosacral, M = male, MC = male castrate, yrs = years.

Clinical examination All dogs underwent a full clinical examination, consisting of a general physical, orthopedic and neurological examination by a board-certified veterinary surgeon (BPM). Neurological deficits were graded based on the scale used by Griffith (modified by Sharp and Wheeler 2005): grade 0 (normal), grade 1 (spinal pain only), grade 2 (ambulatory paraparesis), grade 3 (non-ambulatory paraparesis), grade 4 (paraparalysis with deep pain perception), and grade 5 (paraparalysis without deep pain perception) (Table 2). Diagnostic imaging Ventrodorsal and lateral radiographic views were obtained with the LS spine in neutral position. CT- and MRI-scans were obtained under general anesthesia and dogs were

Pedicle screw-rod fixation in dogs with severe DLSS | 159

positioned in sternal recumbency with the pelvic limbs extended caudally. CT-scans were obtained with a third-generation CT-scanner (Tomoscan CX/S, Philips). Contiguous 2-mmthick slices were acquired. MRI was performed with a 0.2 Tesla open magnet (Magnetom Open Viva, Siemens). Contiguous 3-mm-thick sagittal T1- and T2-weighted images and transverse T1-weighted MR images were obtained. Pre-operatively, CT-scans and / or MRI scans were performed. The acquired diagnostic images were evaluated by a board-certified radiologist, a board-certified orthopedic surgeon (BPM), and a PhD student/DVM (ART). During surgery, correct position of the screws and the amount of distraction was verified by fluoroscopy. Post-operatively, the position of the pedicle screws, the amount of bony fusion and the development of adjacent segment pathology (ASP) were recorded by radiography or computed tomography on several occasions. In four dogs manual distraction was applied, and the amount of distraction was calculated by comparing the disc height indices prior to treatment with the PSRF device in place. The disc height index was calculated on the radiographs and midsagittal CT reconstructions by using the method described by 58 Hoogendoorn et al. Imaging performed during follow up visits is summarized in Table 3. Force plate analysis (FPA) Ground reaction forces (GRFs) were measured using a quartz crystal piezoelectric force plate (Kistler type 9261, Kistler Instrumente) together with the Kistler 9865E charge amplifiers. The force plate itself was 60 cm wide and 40 cm long, and was mounted flush with the surface in the center of an 11 m long walkway. The middle 5 m of the runway was bordered by a 50-cm high fence to guide the dogs over the force plate. GRFs were measured by force transducers, which were located in every corner of the plate. The amplifiers were connected to an analog-digital converter, interfaced with a computer that stored the signals. The sampling rate was 100 Hz. The signals corresponded with the GRFs in the mediolateral (Fx), craniocaudal (Fy) and vertical (Fz) direction. The Fz was calibrated with a standard weight before each recording session. Forward velocity of the dog was measured during FPA, using two photoelectric switches spaced 3 m apart and centered on the force plate and computer timing. FPA recordings were automatically started and stopped by these photoelectric switches. All dogs were guided over the force plate on a leash at a walking gait with an average speed of 1.08 m/s (standard deviation 0.08 m/s). Data recorded from measurements in which a thoracic limb and, after a short interval, the ipsilateral pelvic limb contacted the plate were considered valid. A minimum of eight recordings were used for data processing. All forces were normalized for body weight. + Ratios between pelvic (P) and thoracic (T) limbs were calculated: P/T Fy , P/T Fy and P/T + Fz . Obtained results were compared to previous FP results in normal dogs and dogs with

160 | Chapter 6

low back pain.

19

Surgical procedure and postoperative care All dogs were operated by the same ECVS board-certified surgeon (BPM). All dogs 2 underwent a dorsal laminectomy and several additional procedures before PSRF depending on the imaging and surgical findings (Table 2). Discectomy yielded nucleus pulposus (NP) material that was cultured for bacteria in 10/12 dogs. The spinous processes of L7 and S1 and the lamina of L7 were preserved to serve as autologous bone transplant in ten dogs. In one dog (case 4) a cancellous bone transplant was obtained from the iliac crest. The bone chips and cancellous bone were packed into the intervertebral disc space up to 5 mm beneath the floor of the vertebral canal. An autologous fat transplant, harvested from free subcutaneous tissue, was placed ventral to the cauda equina, and a larger piece was deposited dorsally in the laminectomy site with the aim of 2 preventing dural adhesions and new bone formation. In one dog the compression was severely lateralized necessitating a unilateral facetectomy (dog 5), in two other dogs bilateral facetectomy was necessary (dog 8 and 10). In dog 5 the left S1 nerve had an abnormal appearance and was completely resected and sent for histology. 14

Thereafter, PSRF was performed as described by Smolders et al. Briefly, the entry points of L7 and S1 were identified and the corridors in the cancellous bone within the pedicle were prepared using a bone awl and probe (USS Small Stature, Synthes). Once the ventral cortex was reached, the pedicle probe was removed from the screw corridor. To facilitate screw anchorage in the ventral vertebral cortex, predrilling of the ventral cortex was d performed with a K-pin (1.2 mm). Four 25 mm long, 4 mm wide titanium pedicle screws were inserted into the pedicle and vertebral body. Two 5 cm long, 6 mm wide titanium rods were used to connect the L7 pedicle screw with the ipsilateral S1 pedicle screw. The rod was slightly adjusted with a rod bender to acquire a proper fit on both screw heads. Once a tight fit was obtained, the sleeves and nuts were applied and tightened. Optimal screw anchorage was achieved by involving both the medial and lateral pedicle cortex. “Cortical encroachment” was identified when the pedicle cortex could not be visualized or 59-61 Screw as “frank penetration” when the screw was outside the pedicular boundaries. placement was considered optimal when screws involved the cortical bone and not fully penetrated the ventral vertebral cortex. Intraoperative fluoroscopy was used to verify correct placement of the screws. Four dogs underwent manual distraction as well because of intervertebral foraminal stenosis evident on pre-operative imaging. Manual distraction was applied to the base of the pedicle screws using a Gelpi retractor followed by tightening the screw heads to the rods. The amount of distraction was estimated based on the mobility of the LS segment and did not exceed 5 mm. Postoperative care consisted of leash restraint and exercise restriction for a period of six weeks and after that, the dogs

Pedicle screw-rod fixation in dogs with severe DLSS | 161

were allowed to gradually return to their normal exercise regime within three months after surgery. Follow-up and questionnaires to owners Follow-up data were collected from the medical records, by using questionnaires to 6, 13, 19 by interviewing the owners and by reexamination of the dogs. owners, Questionnaires for follow-up evaluation (Table 5) were sent to all owners of dogs that had undergone PSRF within the last four years. Two dogs were lost in follow-up due to unrelated mortalities. The questionnaires included questions regarding the history, clinical signs before surgery and the owner’s satisfaction with the outcome at three months and one year after surgery. Table 5. Questionnaire to the owners of dogs before, at three months and more than one year after pedicle screw-rod fixation for degenerative lumbosacral stenosis. Types

Questions

YES or NO questions

Did the symptoms disappear after surgery? Did the symptoms recur after surgery (after initial improvement)? How is your dog after surgery? Does your dog refuse certain movements? Did your dog receive further treatment after surgery? Does your dog have pain in the pelvic limbs and shows lameness? Does your dog show weakness in the pelvic limbs? Does your dog have low back pain? Does your dog have difficulty rising up? Does your dog have difficulty lying down? How would you rate muscle volume in the pelvic limbs of your dog? How is your dog holding its tail? Is your dog able to wag its tail? Does your dog show loss of control of urination and defecation? Does your dog show pain when you touch the lower back?

Open questions

Questions with a 10-point scale

Statistical analysis Statistical analysis was performed using software (SPSS 22 for Windows; SPSS Inc., Chicago, IL). Normal distribution of the data was checked by performing the Shapiro Wilks test. The reliability of the responses to the questionnaires was tested by calculation of 62 ƌŽŶďĂĐŚ͛ƐɲǁŚĞƌĞĂǀĂůƵĞŽĨхϬ͘ϳϬǁĂƐĐŽŶƐŝĚĞƌĞĚƌĞůŝĂďůĞ͘ Comparison of the mean ƐĐŽƌĞƐŽĨƚŚĞƋƵĞƐƚŝŽŶŶĂŝƌĞƐďĞĨŽƌĞƐƵƌŐĞƌLJ͕ĂƚϲŵŽŶƚŚƐ͕ĂŶĚхϭLJĞĂƌƐĂĨƚĞƌƐƵƌŐĞƌLJǁĂƐ conducted using the Friedman’s test. If there was a significant difference (P