STUDIES ON INDOOR FUNGI

Loading...
STUDIES ON INDOOR FUNGI

James Alexander Scott

.\ diesis submtred in conformity with the requirements

for the degrec of Doctor of Phdosop hy in .\.lvcoIogv, Graduate Department of Botany in the Cnive-eniry of Toronto

Copvnght by James Alesander Scott, 200 1

Library I*)ofNational Canada

Bibliothèque nationale du Canada

Acquisitions and Bibliogaphic Services

Acquisitions et services bibliographiques

395 Wellington Street Ottawa ON K i A O N 4 Canada

395, rue Wellington Ottawa ON K1A O N 4 Canada

The author has granted a nonexclusive licence allowing the National Library of Canada to reproduce, loan, distribute or seil copies of ths thesis in microfom, paper or electronic formats.

L'auteur a accordé une licence non exclusive permettant a la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/film, de reproduction sur papier ou sur format électronique.

The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts fiom it may be printed or othenirise reproduced without the author's

L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.

permission.

STUDIES ON INDOOR FUNGI

James ;Uexander Scott Depamnenr of Botany, CNvenity of Toronto

200 1

ABSTRACT Fungi x e among the most common microbiota in rhe interiors of buildings, including homes. Indoor h n p l contaminants, such as &-rot, have been known since anaqutty and are important agents of strucnirnl decav, pa&uiarly

Li Europe. The p ~ c i p aagents l of indoor

hngai contamination in North .\merica ioda., howevcr, are m a m o r p h c (asexual) [email protected] mosdy belongmg to the phvla .-Iscomrcotaand Zygomycota, commonly known as "moulds".

Brondloom dust taken from 369 houscs in Wdaceburg, Ontano during winter, 1394, wu serial dilution phted, yielding appro?umately 150 fungai taxa, over 9 0 O . 0 of whch wcrc moulds.

The ten most comrnon taxa were: .- lftcrnurria rlftrn~itlrr.: lmobustiiiunr puf/u/Lin~-, Eumtium r~emCofor,Prniifii~trn&y~ogcn~trm,Cfrldu~poriumif'do~porioicic'~, P. hrrbrrrionrm, . l~peqiillu~

a ~phurmrpc'murn,.-(rn

e and

J ~ ~ I ~ ~ O J J I I ~ ,

T~i~hodcnncl uin'de. Chi-square assodauon andvsis of this

mycotlora revealed several ecological groups including phylloplnne-, soil-, and serophilic foodspoilage h g .

Genorvpic variation was invesngated in nvo common dus-borne species, Pcniri(iium b~t>vi~'o+~~~z~m and P. ihTogenirm. Nine mululocus haplocvpes comprising 7 5 isohtes of P. brrvi~.o+ctzmErom 50 houses were detected by heteroduplex mobdity assq- ( i 3 L I ) of

polymorphic regtons in bem-nibulin (beni), nuclear ribosomal RY-\ spanning the interna1 nanscribed spacer regions (ITS 1-2) and histone 4 ( h 4 ) genes. Sequence analysis of the b e n \ and rDNr\ loci showed w o geneticdy divergent goups. Authentic snains of P. I > r r ~ t l L . o ~ u ~ ~ u m and P. ~-tofon&xtll dustered togcdier in the predorninant clade, accounting for 86010of isohtes.

The second lincage containcd l-l0'oof isohtes, and included coilecuons €rom the rotting h

t

bodtes of macrohngi.

S&lv,

5 mululocus haplotypes based on acen.1 coenz~me-:\ srnthase

(acu;\), ben-\.

ITS 1-2

and dÿoredoxin reductase (WB) grnes compnsed 198 isohtcs of P. L./,rysogrnlirnobtainunrd [rom

109 houses. .\ suicdv clonai pattern of inheritance was obscrved, indicxing die absence of recombinaaon. Phylogencnc andyses of allele sequences segregatcd die popuhaon into thrce divergent Ilieages, encompassing 90'"1i,-"'Oand 3Oa of the house dust isolates. respecril-ely.

Type isohtes of P. Lhry-ogmmand its svnonrm P.

noiuLmn clustercd

\ d u n die secondan

Luicage, contjrming dus synonymy. No isolates of nomenclanirai statu clustered M t h the predominnnt lincage; however, ths chdr contiiined .ilesander Fleming's historicaliy noceworthy p e n i c h - p r o d u k g suain from 1919. SunilarIv, there was no nvailable name for the &or

luicage.

\\ken 1 heard the Imrn'J asuonomer. Uhen the proois. the figures. were rangcd in columns behrc me,

\\hm 1 was shown the c h m s and diagrms. ro add. divide, and m a s u r e thcrrn, I sitting heard the asuonomer wherc hr lectured ulth much npplause in the lecture-room. tiow soon unaccountable 1 became ared and sick Till risuig and glidiny out I wnndcr'd off by myself, In the mysucal moist night-air, and from tirne to cime. Look'd up in pert'ect silence at the stars. \\%en

1 un profoundlv p t e h i l to my advisors, Dave h i d o c h and Neil Snaus, for their thoughthi mentonhip. both intenuonal and unintentionai, on dl maners of science and Li&.

n i e y have

gwen me gilrs of their patience and wisdom thnt 1 cannot repay. 1 thank the mrmbers of mv supen-isorv cornmittce, Jim ;\nderson, David .\mer and Richard Summerbeli. for their gentle encouragement and slicerc cnthusiasm ~ v h c hhelped me ro srav on-crack. Lhda Kohn

2nd

Keith Seifert îre thnnked for thcu excclient and thoughfd ulecdback on the thesis in conjunction with the senate oral esamination.

Icould not have completcd this thesis nor the rcsearch it presents without the hendship. dedication and bcnevolence of Brenda Koster, Bess Urong and Wendv Cntereincr.

1 have hughed. cried and groown irnrncasurablv from mv hendships and &cussions, otfcn

orer bcer, pizza or #49, uith my fellowv graduatc students Jacque Bedc, Cameron Curric. L u r i e Ketch m d Sixnona h l ~ r p t e s c u d, o n g with manr others. 1 am gatehil for the assistance of Len Hutchson. Brett Couch, Wendv hiailoch, Collcen McGee, E d v. Tavlor and Megan Weibe: during the early stages of h s work. More recently, hlichael Wîmock hrlped with proofreading and c o r r e c ~ gdus thesis. B a r n N e d e and ShaneIle Lum h d l y kept me Liformed of mînv news items on indoor h g that o d i e ~ i s e1 would certîmly have missed.

Carolyn Babcock and Steve Peterson grauously provided cultures. I thank John P o p c u for insightful cont-ersaaons o n building science and for help in b a l thesis preparation. Financial support was pronded bv NSERC as o p e r a ~ pg t s and a strategic gram to Dhl and NS, and a doctord s c h o ~ h i to p JS. Jim Gloer generousls h d e d mi-e a l y mycologicd training.

Wieland Meser has been a superkitive collaborator on the aspects of this proiect involving

DN-4 hgerprinting of Pcni~iIliumhysogeenum. Steve Peterson, John Pin and Rob Samson are thanked for man! insightful discussions on PrnitiI/iurn muonomy.

I owe the grearest debt of grautude to my parents, Kay and .\les Scon, for numiring rny ecclecuc interests t'rom a r c r .v voung nge. for thcir compassion and understanding of the mm!. . tums mv Life has taken, and for the unconditionai frecdom. support and love char rher have gik-en ml: as

1 have punued mr dreuns. For ail d u s and much more, I dedicnre this thesis ro

them.

O n a mugg-, sumrner da. when I was a vertboy. my cousin. Jin G d e t inspued me to . voung . smdv biolog.. 3 s we srood togcther in mv pndrnother's garden, Jim esphincd thnt the stems of the rhubarb plant couid be enten but thnr the leaves c o d d not, because thcr were poisonous. H o w could it be so; And whr? I starcd in utter disbelief and hodv chdenged dus qucer notion. as mi-parents, gnmacing, looked on. 1 stoppcd iusr short of b i ~ inro g a leaf mvself to support my unsophisticated contention. In the vem man. inten-cning yeus since. I have rcflected on our eschange countless times. Jim, prrhaps unintcntionaily, taught me four vem valuable lessons that dav: 1) Nature is fascinating and inuicate, her propemes and processes are mely apparent or intuitive; 2) Never be a h d to quesuon an. noaon proffered as facr no matter how high the auchorirv; 3) Science embodies a set of methods that c m provide insight into the delicare iMer w o r h g s of Nature when applied thoughtfullv and

sktllfullk-; and above dl,4) Don't eat rhubarb lemes.

TABLE OF CONTENTS

TABLE OF CONTENTS ..........................................................................................................Vi LISTOF TABLES

.................................................................................................................X

LISTOF FIGURES ..............................................................................................................

xi

LISTOF APPENDICES........................., . , . .....................................XII1 LISTOF ABBREVIATED TERMS ...........................................................................................

XIV

LISTOF NOMENCLATURALABBREVIATIONS...................................................... ............. XVI

CHAPTER 1. INTRODUCTION .................... ..,......, . , ..... . , . ...........1 The biologv of house dust.....................................................................................................................I .

.

Interactions bcween mites and tungi ........................................................................................... 3 [email protected] in household dust ................................................................................................................... 3 Indoor sourccs of dusr mycoflora ................................................................................................. 5 . . Ptnitil.i~mm rndoor environmen ts ..................................................................................................6 EIedth effects of rsposure ro indoor b n g ........................................................................................9 . . . . . . .Urrgic r h o s and srnusias.......................................................................................................... 10 Tvpe I dergic syndromes ......................................................................................................... 10 Dust mites and allergy ................................................................................................................ 11 . . . Hypersensiavm syndromes ............................................................................................................ 13 .4s&.ma .............................................................................................................................................. 13 ........................................................................................................................................ 15 ~lvcotosuis Volade fungai metabolita ............................................................................................................ 17 Objectives of the cunent smdy .......................................................................................................... 17

.

ANALYSIS O F HOUSE DUST MYCOFLORA ................................................. 19 -4bstract.................................................................................................................................................. 19 Introduction ......................................................................................................................................... 19 Materials and methods ......................................................................................................................... 20 Collection of d u r samples ............................................................................................................. 20 .\naivsis of dusr smples ................................................................................................................. 23 Identification and isohtion of cultures .................................................................................... 2 5 Rehbilitv of identifications............................................................................................................ 26

C m E R2

Storage of cultures ........................................................................................................................... 26 O r ~ n t i o and n *sis of data .................................................................................................. 27 Resdts ................................................... ...... .................................................................................... 29 Species diversi. and dismibution .................................................................................................. 29 Efficiencv of smpling .................................................................................................................... 29 Species abundance ........................................................................................................................... 35 .4 ssociauon analysis ......................................................................................................................... 33 Discussion ............................................................................................................................................. 35 Conclusions ........................................................................................................................................... 50 7

C m ' E R 3.

.

A REVIEW OF TECHNIQUES FOR THE ASSESSMENT

OF GENOTYPIC DiVERSITY .................................................................. 52 introduction .......................................................................................................................................... 32 The derection of genecic variation .....................................................................................................53 The use of proreins to disthguis h variation ................................................................................ 33 Hvbridization-based markers ......................................................................................................... 54 -~ A w - s u i n ~ e n cPCR y ....................................................................................................................... 3 3 .. Randornlv amplilied polymorphic DN.4 &\PD) .................................................................33 .\mpiified fragment length polvmorphism (AFLP) ............................................................... 3.. Chgh-stringencv PCR ..site-specific polymorphisms ...........................................................5 9 Detecrion of low-lerel sequcncc variabdito ................................................................................. 60 Restriction endonuclease digestion of PCR products ............................................................ 61 Denaturing-gndicnt gel electrophoresis (DGGE) .................................................................62 Single-stnnd conformation polymorphism (SSCP)............................................................... 62 Wrteroduples mobllitv assav (HAL-\)........................................................................................ 64 Su r n r n q ...........................................................................................................................................6 9 .)

.

.

CHAfTER 4

DEVELOPMENT OF METHODS FOR THE ASSESSMENT PENICILLIA ............................................. 70

OF GENOTYPIC DIVERSITY OF

-4bstract .................................................................................................................................................. 70 Isolate selection ................................................................................................................................-0 Isolation of DN.4 from PenitiIliun~conidia................................................................................... 't Matenals m d methods. DN.4 isohtion ...................................................................................71 Results and discussion. DN.4 isolation ....................................................................................93 Heterodupiex rnobdity nssay ..........................................................................................................74 Materials and methods. H X \ ................................................................................................... '4 DNA mplification ................................................................................................................. 74 .. Cloning and sequencing of PCR products ........................................................................... 3 Prepuauon and analvsis of DN;\ heteroduplexes ............................................................. 76 Elecaophoresis and imagmg .......................................................................................................... 7 Resolucion of heteroduplelted DN.\s on Phas t svstem ......................................................... 77 Results and discussion. HGE ............................................................................................... 81 V e d gel electrophoresis c'GE) in L\t\ ........................................................................... 84 &\Li Screening appronches ............................ . . .................................................................. 85 Oreriapped pairs ..................................................................................................................... 85 Cai~ersalheteroduplex genentor .................... . ................................................................ 86 Resuits and discussion. \'GE ..................................................................................................... 86

Pcni~lliumhysogenzm and the indoor environment .................................................................. 1 % Conclusions ......................................................................................................................................... 179

C H M E R 7.

CONCLUSIONS AND GENERAL SUMMARY ..............................................180 Fungal decav in earlv structures ................................................................................................... 181 Ventilation ....................................................................................................................................... 182 Euly housing and urbanization ................................................................................................... 183 Modern era...................................................................................................................................... 183 The changmg urbaa hndscnpe..................................................................................................... 186 Suburban life.................................................................................................................................. 187 No& Americnn dependencc on petroleum .............................................................................. 1YThe encrgy crisis and the sick building .......................................................................................188 H e a ~ and g venahaon ................................................................................................................. 189 Gypsum-based wdboard products ............................................................................................. 194 The dawn of "Sick Burlding Syndrome" .................................................................................... 195 Ecolog.of dust-borne hngi ........................................................................................................ 195 . . . . . .issocmnon analusis O t dust-borne tungt .................................................................................... 196 ... Pc'n1~7lizum brevironpu~fmx ................................................................................................................ 198 Ptnitlliium hy~~ogenz~rn ..................................................................................................................... -200 Su.............................................................................................................................................. 201 *

LITERATURE CITED ........................ .................................................................................. 205 339 S u m m a n of dust rnycoflora bu house ........................................... ...............-C h square staasacs for ~ssocktionmal+ of dustbornc usa ..................390 CalcuL~uonsof sampllig e fficiency................................................................. 3JO Alignment of sequences of nuclear ribosomal DNA, ITS I -5.8s-ITS3 and p d 28s regon lrom 85 Penzdiium species ............344 ~\Lignmentof sequences of nudear nbosomal DN.\, ITS 1 3.8S-ITS2 region from 46 tava from Subgenus Pcni~7llzm................ 393 .A ilignments of P. bnvicompuctum sequences Bera-tubulin (ben\), pamal sequence ............................................................ 406 Nuclear r i b o s o d RV.\, ITS 1.S.%-[TS2 ............................... ,.,................... 409 .ilignments o f P. cbp-ogcrnumsequences -\cet$ coenzyme .\ synthase (acd), partial sequencc................................. 413 Beta-tubulin (ben\), p h 1 sequence ............................................................ 418 Nuclear r i b o s o d W.\, ITS 1-5.8s-US2..................................................... 426 Thioredoxin reducrase (&), p d sequence............................................. 436

LISTOF TABLES TABLE 1.1 . TABLE1.2 . TABLE 2.1 . TABLE2.2 TABLE4.1 . TABLE4-2 T-ABLE4-3 . TABLE 5.1 TABLE 5.2 . TABLE 5.3 . TABLE 5-4. TABLE 6.1 . TABLE6.2 TABLE 6.3 . TULE 6-4 TABLE6.5 . TABLE 6.6 . TABLE 6.7 .

.

.

. .

Selected hvpenensitivity paeumoniudes of rnicrobial eaolog). ................................ 14 Mvcoroxins of significance produced bu indoor funa ............................................... 16 S u m m 7 of significcandy-associated couplets of a x a.................................................. W Distribuaon of samples in houses manifesting visible mould growrh ...................... -16 Loci screened for polvmorphisms in P . brrMrompu~~~lm ................................................ 92 Loci screened for polvmorphisms in P. ~hyoyrnum..................................................... 93 Sources of nuclear ribosomal ITS 1-5.8S.ITSI and partial 28s sequences ...............94 List of isohres of P. i>niiL.onpi~*f~m and rehted species from ocher sources ........... 106 Primer sequenccs used ro ampli& polymorphe regions in P. Unm~ompuns involvcs interference widi various aspecrs of c d metabolisml producing neurorosic, carcinogenic or tcntogenic effects (Rylander, 1999). Other roluc hngd metabolites such as the q c l o s p o ~ s esert potent and specîfic tosicity on the celluhr immune system (Hawksworth et al.. 1'995); however, most mycotoluns are known to possrss Lnmunosuppressanr propemes that var)according to the compound (Flanmgan and hliller, 1994). Indeed, the tosiury of certain fimgal metabolites such as atlarosin, nnks them arnong the mosr potendy rosic, k u n o s u p p r e s s i v e and carcinogenic substances knom-n(ibid.). There is unambiguous ekldence that ingestion exposure as weil as esposures bu the inhalation pathwap have been coaelated Mth outbreaks of

humm and a

d mycotoxicoses (Abdel-Hafez and Shoreir, 1985; B u g et dl1983; Crofi et al.,

1986; Hinctkka, 1978; Jmis, 1986; Norback et d.,1990; Sorenson et al., 1987; Schefer, 1986). Several cornmon mycotoxigenic indoor hingi and their respecrive to&s are listed in Table 1-2.

TABLE 1-2:

Xlvcotoxins of significcance produced bv indoor h g

MYCOTOXIN

P~UMARY HEALTH EFFECT .

FL'NGALPRODUCERS

Sephroro-uin Imrnunosuppressanc

Cucinogens, neurotoms Carcinogcn Prorem synthesis inhtbttor. nephrotosui

Cxcinogcn. heparotoun

Tnchothccenrs, macroqclic Satntoms

Hemorrh~gic,emeuc, carunogcn

scuroto.~

SOURCES: Hurgr. 2nd .\mmrinn 1999): Rodricks cr d. ;19-7

S m s m cr II. (1 996)

VOLATILE FUNGAL METABOLITES DuPng e s p o n e n d growth, manr h g i release low molecular weighr, voiaule organic cornpounds POCs) as products of s e c o n d q metabolism. These compounds comprise a great divenin- of chernical structure, including ketones, aldehydes and alco hob as weli as moderatek to highlv modified aromaacs md aliphaacs. Cultural studies of somr common household moulds suggests that the composition of \'OCs remauis qualitati~elvstable orer 3 cange n i growdi media and conditions (Suncsson et al., 1995). I~unhermorc,the prescncc o f c e n m market compounds comrnon to mulaple spcues, iuch as 3-mcthylhran, may be monitored as a pro? for the presencc of a hngal amplifier (Sunesson et al., 1995). This method has been suggested as a menns of monitoring [email protected] contamination in grain storage facilities (Bojcsson ct

al., 1989; 1990; 1997; 1993). Lunired evidence suggests that rvposurc to Low concenrntions of

L'OCs may induce rcsplatory irritation independent of exposure ro aliergenic parricularc (Korcn et al., 1993). \.rolade organic compounds mav also yisc dirough mdLect mrtabolic cfkcts. .\

well-known exîmple of this is the h g a l degradauon of uren formddehvde h a m uisulation.

[email protected]

colonization of this material rcsults in the cleavage of urca from die polvmer, presumabiy

to seme as a carboa or niuogcn source for p r i r n q metabolism. D u h g dÿs process g a d e c h e in IAQ (Bissen. 198;). formaldrhyde is e ~ o l v e das a derivative, c o n t n b u ~ to

OBJECTIVES OF THE CURRENT STUDY The present studv was conceived with nvo p r h q obiectives. First, diL; Liresagauon s h d charactetize the h g a l biociive-enicv of house dust. Thts work s h d investigare correhaons bcrween dustbornr hingal speaes, and e - m e the ecological similv of positkelv associared t a u based

on the h\-podiesis that positive1 assockted dustbome b g i are likelr. to share habitat

chancrerisucs. From dm,a second hypochesis foilows that mechanisms chat permit the en.

concentrarion a given species d ltend to faalirate the en-

or

of other posiavelv correlated m a .

.\ second objecave of dÿs research L; to assess the extent of genon-pic variablliry in nvo

dustbome PeniciUia, P. b > t . t i ~ i r . o q t ~and ~~m P. ~~ h r y ~ o p n ~ The ~ r n .goal of ths work shaii be to examine the extent of clonalin. within these nvo spedes. and to detemime if the obsen-cd

patrems of genocypic mriauon suppon the currcnt species concepts.

CHAPTER 2.

ANALYSIS OF HOUSE DUST MYCOFLORA

ABSTRACT Broadloom dust samples were enurnerated For culnirable h n g Gom 369 homes in K'ailaceburg, Oomio, Canada Li minter, 1994. In total,

153 h n g d msa were identified. The t î x î obsen-ed

were consistent with other published reports on the f u n g l flora of houschold dusr and indoor air. Tasa obsened in the present studi- foilowed n Raunkiaer-npe disuibuuon, wvhcre sevcral

species accounted for the maion? of observations (abundance), and the p a t e r propornon of species docurnented were obsen-ed only rarelu. A cnlcuhaon of samphg efGcicncy accordmg to Good's H!-pothesis suggestcd high overail s a m p h g efficiency, a v e r a p g ovcr

92 " O of the

rotai espected biodiversity. :\ssociation andysis based on two-way ch-square contingency resolred a number of species assemblages. These assemblages were p r i r n d y correlatcd

to

ccologtcal specialization. The chtee main ecological categones k a t characterizcd t h e main asscmbhges comprised 1) phyiiophne hngi; 2) soi1 h n g and 3) food spoilagr/ serophilic fi

.\ number of srnalier assembhges containcd species known to be active conraminants of water damaged building m a r e d s .

INTRODUCTION Ic has long been hvpodiestzed that indoor dusts possess ,dergenic properties (L.ucretius, 50 BC). Howcver, the imporunce of hngai mtenals as dust-borne dergens, was not demonsuated with fair certain5 und early in the 2 0 cen~

(Hood, 193 1; Hopkins et d,1930). Recentlv,

however, there have been efforts to study household dust as an ecosystem, in an anempt to d e t e d e die chvacteristics of dut-borne fimg that Eaulimted their di-enitication into thL: relaave-elvne%-habitat (Davies, 1960; BronsMjk, 1981; Bronswijk et al., 1986: Swaebiv and

Chnstensen, 1952; Verhoeff et al., 1994). It is difficult to interpret much of the e?dsting Lirerature in t h area for nuo main reasons: 1) m

y nuthors provide onlv genus-level

idenafkîtions of fun& or employ species names that are antiquated or conhsed; and, 2) the hck of roucher isohtes precludes the contimiauon of results.

The prcsent smdv is an csarnination of thc hngd tlora of household broadloom dust obtaincd

during rhe course of a larger rcscnrch proiccr hndcd br rhc Canada h[orrgnge and Housing Corporation (ChlHC) (Ottawa). n ÿ s project \vas sought to measure various parameters of environmenml esposure incurred bu housing occupants, and artempred ro correlate dicsc

tindings to objectk-e measures of illness. Withrn thL: contesr, the present srudy shall (1) dctcrmine die numbcrs and h d s of moulds prcsent in houscliold broadloom dust in a smdy site

in Wdhceburg , and (2) invesagate sratisucai associarions benveen diffcrcnt mould tasa

in

an

attempt to form hypotheses on sources and contamination padiwars.

MATERIALS AND METHODS Field work for t h s studv was conducted by a privnte companv undcr contracr lrom ChIHC over a period of five monchs s t h g in Januuv, 1994. Initiai$, 400 households in Wallaceburg, O n m i o agreed to participate in Phase 1 the study (set Figure 2- 1).

COLLECTION OF DUST SAMPLES LFacuurnclenner bag samples of carper dust were coilected kom 369 houses. Sample covenge 1s

illustrated on the residcnaai sneet map shown in Figure 2-2. These aarnples were suppiied in sealed, 10 rnL polvproprlene 4

s

which were stored at room temperature u n d andvsis.

Ontario

FIGURE2-1:

Map of Ontario, Canada, uidicating the location of Wdlaceburg.

ANALYSISOF DUST SAMPLES Two subsamples of appro.uimiiteIv 50 mg (the a c d mass was recorded) were added individuail!

to 10 mL of sterile 2 O . o peptone broch and suspended by vortelung at medium speed. Two s e d dilutions of these stock suspensions were made subsequendy uskg an adaptation of the standard technique revieived br Malloch (1981); the first was made bv cùluting 1 mL of srock suspension in 3 mi. of

2O n

peptone broth md the second was made br diluting 1 mL of the tmt semi

dilution in 9 mL of ."O peptone brodi. Four aliquors of 1 mL cach werc rnken from each of rhc nvo sets of dtlutions and dispensed i n d i v i d d v into polystycne 90 mm Petri dishes (Fisher).

Two Peui piates were set up in thts manner for cnch of the nvo stock suspensions. Molten sterile Rose Bengal agar (RB:!)

(llailoch, 1981) and RB.4 conraining 25

"IO

glvceroi (Ri3G.i) as

an osrnoucanr. Both media were amendcd with 60 ppm of chlorreuacycline hwirochloride (Sigma), streptomycin sulphate (Sigma) and benzrlpeniclllli (penicdh-G, S p a ) , werc cooled to

45 OC md nsepticaiiy dispensed each into half of the Petri plate replicates at a roiurne of 3 rd. per plate using 3 Pour-O-matic Petn phte W g machine ('New Brunswick Scienafic, New Jersey). The medium was mived with the diluaon d q u o t bu gently swL1Lig the Petri platcs pnor ro solidification. A schematic of the phting regune is providcd Li Figure 2-3.

--!fier 12 to 18 hr the plates were removed Gom the machine, wrapped with P a r a h (Alcan) and inverted in stacks of 20 phtes each. The piates were incubnted under 12 hr 3mficd dnylight at room temperature (m. 24 O C ) for 7 &YS. One of the three sets of dilutions averagmg benveen 13 md 60 colonies per plate was selected for identification and enurnenaon. Escept where one

of the media wed could not be enurnerated at the dilution selected (due to escessivelr high- or low numben of colonies or contaminarion) the same dilution set was enumerated for both media. This method wns rehned bv multiple p r e h m i n q ekrpe&encs.

hficroscopic mounrs were made in eidier disàlled wnter with Phoroflo (Kodak) or lacro-hichsin (Carmichael, 1955). ;\li culture media and stock solutions were autochi-ed for 20 min at 15 psi ptior to use. Stenle ghss- and plsticware were used for d asepüc procedures.

IDENTIFICATION AND ISOLATION OF CULTURES Where possible. [email protected] wcre idenuficd to rhc genus level direcdv from colonies on the Rosc Bengai isolation media using \veil-esrablished rechniqucs of macroscopic and mcroscopic esaminauon and srandard reference works for the idenafication of moulds (e.g. An, 1970; B m e t t and Hunter, 1986; Barron, 1968; Carmichael et al., 1980; Domsch et al. 1980; E h , 1971.

1976; Hanlin. 1990; S l d o c h , 1981). hlanv isolates wcrc hrthcr idcnufied to spcucs lcvcl using appropria te monognphs.

Species o f P r n i o f h m were grouped according to macroscopic and microscopic surillarip-. averaging five groups pet house. Representanvcs of rach of the g o u p s wvith s d a r penictllia were subcultured on four diagnosac media for h t h e r identification using a central-point inoculation technique modified Gom Pin (1979). The Petri phtes were wrapped with P u a f i , and incubated inverred under 12 hr mificial davlight nt room temperature for 7 to 14 days p i o r to esaminarion. The followlig media were empioyed in die identification of cultures of PrniriUium

agar

to species level: Cznpek's veast-autoivsnte agar (CY.4) (Pitt, 1979), CreacUie sucrose

(CRELI) (2s rnodified bv Frisvad, 1985), 350r0 Glycerol-niaate agar (G25X) (Pitt, 1979) and

hlodified Leonian's agar (ML.4) ~ I d o c h 1981). , .\.Iultiple unique isolates of P r n i r i l l m spp. were

reralied for subsequent use. Cultures w-ere identified accordhg to colonial and microscopic morphologies produced on these media and compared to the speaes descripnons g v e n by Pitt (1980, 1988). Other [email protected] that could not be idendied directly o n RBA and RBG;! plates were

subculmed on a range of other growth media (includmg CY-I, h L \ ,

?'/O

water agar, Weiuman-

Silva Humer's agat and Sabounud's glucose agar (hldoch, 1981)) and incubated in a manner sunilar ro that used for the species identification of Prnz~ifLzmcultures.

RELLABILITYOF IDENTIFICATIONS This snidr inrolved the es~rninationand identification of ovcr 300.000 inch-idunl funLgal colonies. Ovcr hdE of these identifications were pcrformed by die nuthor: the balance werc c m i e d out bv

BAI. Loster, D. hIalloch and L.J. Hutchson in addiaon to sevenl conuacted

srudent assistants (JW Acknowledgcments. p. iv). Discussions benvccn thc nuthor and other / phase suggested thar the rate of misidenafications projcct workcrs during the p L ~ g isolation was

relaaveh low, and npicallv rcstrictcd to rare or difficult rasa (cg. Ptn~iifiztm ~zmuztiopistz~n~

group). * f i s specuiacion has becn supponrd by retrospecrive examinauon of manv retalied cultures. For the purposes of the andyses presentcd in dus chapter. dl idcnutications wcre accepted as accurate and comparable; however, the readcr is cautioned thar thc reimbilitv oi idenafications mav r q ro some extent accordmg to the skill of the i n w s q p r o r and thc condiaon of the pamcular isohte eramined.

STORAGEOF CULTURES Ench represenrauve isohte of Pc'ni~dIlimwas subcdtured in duplicate into 2 mL screw cap (widi rubber " O " - ~ g )tlat-bonom microcenmhge (microcultue) tubes (Smtedt) containing 1 rnL

per tube of 7 O b A L \ .

;\dditional representaui-es of Ptw~~ifhium and other genen were

subcultured in a s&

mamer pendmg hiture need. The tubes were capped and incubated

m d e r 13 hr mifiaal davhght at room temperature for 7 to 10 dars prior to transfer to 5 O C for short-term storage. Cultures r e q a g long-term preservation (e.g. for use

tîflgerprin~g)

were subcultured subsequentlv and checked for purity. -\xenic cultures were subculnired in mplicate in microculture tubes and Licubated as ouduied above. -ifter colonies had grown out, cultures were asepticdy overlaid widi 1 mL stenle 70 ' a glvcerol combined with 17 "'O skun miUc as a cryoprorectant and stored at -70 'C (;\IcGinnis and Pasareii, 1992).

ORGANIZATION AND ANALYSIS O F DATA D:m wvere compiled using the Borland Parados dambase (\-m. 3.0. Borhnd Corp.). Thc databnsc consisted of one record for each occurrence of a species on each plate examuieci (for both RB;! and RBGA). Each record compnsed 6 fields: House number; Plate identifier; Spccies name: Numbcr of colonies counted; hlass of dust used in subsamplr (mg); 2nd. Totd numbcr of phtes

of each medium (RB.\ oc MG.\) that were es3muied for that house. Subscquent manipulations of the data includuig statisticd analyses wcre camed out by means of specific sofnvarc C O U M ~ S p r o p m r n e d and compiled bv the author using QuickBasic (rcr. 4.5, .\[icrosoft Corp.).

An index of sampluig efficiency ( I ) was cdculatcd using Good's Hvpothesis as modified bv Moore înd Holdeman (Good, 1953; Moore and Holdeman, 1974), such char:

where,

A-, = number of species observed once .YT= t o d nurnber of observations of al1 species Presence-absence (occurrence) data for taxa present in 2 "O o r more of samples were inalysed usuig chi-square associaaon mal+

Mth Yate's conection iactor for s m d datasets (Gres-

Smith, 1964; Kent and Coker, 1!JE), such that:

where, u=

(JW

obsen-ed number of relevés conciking "a & b" b = observed number of relevés conrainlig "a" o d y 6- = obsened number of relevés contaking "b" only d = obsen-ed number of relevés hckuig "a & b" n = total number of relevés examined

The rciaare degrce of association \vas summarized graphtcally for ail combinacions o i [am involved in one or more sipnrficant associations based on ncgativc inverse logarirhms o f c h square values. These values were compded inro an artificd "distance mauiu" in w h c h closcly-

associared pairs of t u a had srnalier interposing dismnces relative ro rhose widi lesser associations, w h c h wcre separated by grcarer dis~mce.A clusrer analysis of t h s maut\ \vas conducted using the CPGhL-\ mcthod in the P;\CP4 software package (PACP' version 4.0b-h for 32 bit Microsoti Wrindows, Sinauer .\ssoclatcs, Inc., Sunderland, Massachuserts). I t is acknowlcdgcd thar as test statistics. ch-square values cnlcStcd from pair-wise contingcncv of nominal data such as those in the present study represcnt multiple non-independent comparisons, and thus should not properlv be analysed in un-correctcd combinauon. Ir is important ro note, however, that the use of ch-square values in thc present application is solev a mensure of the degree of association and not an assessmcnt of the statistical stpnificnnce of correlation

Causton, 1988). Followving CPGAL-1cluster malysis, reminal clusters of duce or

more closelv-associated t u a were pnined Gom the dendrognm and ce-examined graphcaily as

2-wîy mamces upon w h c h the level of significance and p o h t y of assochaon of individual c h square smcistics were encoded.

RESULTS SPECIESDlVERSITY AND DISTRIBUTION Two hundred and f i h - d u e e hngal ma were isohted fiom the 369 dust samples malvsed. The proportion of house dust smples containing each rason are summîrized in Figure 2-4. .\ complete List of abbreviations used is given in the front mmer. The distribution of funpl tasa

in the studv site wns of a Raunkiaer-n-pe,whercbt- species were dismbut~duncrcnly in abundance. In h s model, mosr species wcre obsen-ed onlv rnrelr, and the rnîjonn. d individuais in the popdation comprised relavely few species (Daubenrnire. 1968; hunkiacr,

1934).

Thq--thrce rasa werc obsen-ed i n 10 "'O or more of samples;

SLY

of rhrse tasn, . - l f f m ~ r l n ~

~lferntutrr. .- I zmobtz~i~Iiitm puff~tfms.Ezmfizm hcrbmion,n,.Epi~-ot.~~tnz nkntn~,- - l~pctgiiit~rrrxicoior and Pc'ni~iI/iz~m ~fi~Jqgtnztm wrre present in 50 "'O or more of the samples analysed. Fom-chree rasa were obsen-ed in 2 to 1 0 ",O of samples, wMc an addirionai 17' tasa were present in fewer than

2 "(O of sarnples. Inrerestinglv, unidentiticd veasrs were observcd in 85 " h of snmples annlysed w hile che most commonlv encountered &mentous hngus,

.-llfernmb dtemrtii, wns obsenxd in

89 "O of samples. The most comrnonh- occurring species of Peniri(lztn. were: P. d!~Jyy?Zfm(52 Oh

of samples), P. ~pinitio~~urn (39 "'O),P. iogdophiltm (29 '*O),P. commnr (26

(23 "O).

O)

and P. b~ci~-ompu~-tum

hlost rasa obsewed were nnamorphic species; howerer, a Ietv sesud species were

encountered (e.g. Eztmtiim hrdmnimm, S o h h spp., and Ezprni~iffiumo~fim~-drnonrurn).

EFFICIENCY OF SAMPLING -4ccordLig ro Moore and Holdeman's modificaaon of Good's hvpothesis (Good 1953; Moore and Holdemn, 1971), the speaes that were obsen-ed comprised, on average, 92.1

(8.8 ')'O,

E r n WRB

€PIC NIGR ASPE E R S PENI CHRY C MC M P W SPIN C M SPtC4 ASPE NICE TRIC \/IN PEN1 CORY m HERB PEN1 C a T l M O RACE WL SEBI C MH m PEN1 M O PLUI

w mm

PEM WA PENI \/IR1

WIZ ORn

PENI CTFU'l

P K C VAN ASPE MXI PEN1 WRA ENI

XW BfW PEN1 SPXW CPEO PEN1 RAiS Pm CWR

9ASPE F M

wu CHAE Glœ

ASPE

AWEVSIU

PENI GRIS PEN1 W L P PENI OXAL FW 0x5 PENI SIW

ASPEVW) P ME C U PENI IMPL PEN1 €CHI

FIGURE2-4:

Frequency of dustborne f u q i observed in broadloom dust samples from Wailaceburg, Ontario.

FIGURE2-4 (cont'd): Frequency o l dustborne fungi observed in broadloom dust samples from Wallaceburg, Ontario.

FIGURE2-4 (cont'd): Frequency of dustbome luagi observed in broadloom dust samples from Wallaceburg, Ontario.

FIGURE2-4 (cont'd): Frequency of dusrborne fungi observed in broadloom dust samples from Wdaceburg, Ontario.

FIGURE2-4 (cont'd): Frequency of dustborne hngi observed in broadloom dust samples from Wallaceburg, Ontario.

Figure 2-42

Figure 2 - 4 3

Figure 2 - 4 4

SD) of the total expened biodivenitv in the smdy site. This resdt, in combination with the Ehmkher-type dismibution of mm w i h the sarnple ser, suggests that an Licrease in the number o f sarnple sites would have oniy conmbuted to an incrense in die number of rare species observed (rzr Figure 3-5).

SPECIESABUNDANCE The cdc~.&~tcd abundancc data (not presented hcrc) showed numbers of colon!.-tiirming units (CFCs) prr gram of dust that nnged, on average, from 7 to 10 CFZCs/mg; but, sprcies abundance occasiondv was obscrved as high as 500 CFCsimg. Gcneraily, yeasts and yeast-Like

hng (cg. : ! l i ~ ~ b d J r ' & t / m ~ ~ f / / ~ rrnded / d n ~ ~ to occur at grenter abundnnces than smctlv f i m e n t o u s species. Due to the rehtivelv low number of replications pcr sarnple (i.r. the nurnbcr of platesamined) which varied from 4 to 8, the standard deilarions of average species abundances tended ro be excessive, often

in cxcess

of cdcuiatcd mcans. For dÿs renson, excessive oudying

data would not pennit trends of species associations to be resolved using canonical

correspondence analysis @ra& 11993). Species that occuned at a low kequency (ix.in fcwer thnn 7

of smples) tended to skew the ch-sntistic îmfactuaiiy towards sigiificance. For dus

reason, rare species were elimuinted h m thü: analysis. The resuits of sigmficant chi-square assoctztions are shown in trellis-&gram format in Figure 2-6. The 52 pairings of species represent the significmt associaaons (a= .OS, df = 1) diat resuited fiom die inspection of 3,003 p&gs

(m Appendiu B). The 6rst 21 couplets were k h l v sipniîïcanr (a=.001, itr Appendix Bj.

ASSOCIATION ANALYSIS The 53 associations of stgnificance iavolved fort-y-seven m a (including a cntegory of unidentified r e m s ) ; fom-three o f diese associations were positive correktions whde the

O

V

~

)

a

V

)

)

c

r

'

n

J

~

0

C

O

o

a

o

)

o

N

a

C

o

D

o

O

,

Percent coverage of sample (%)

FIGURE2-5:

Sampling efficiency for house dusr mycoflora Hypothesis.

as

estimated based on Good's

FIGURE2-6:

TreUis diagram summarizing significant associations of dusrborne t u a . Positive associations are indicated by t ( =0.05) $ ( =0.001). Negarive associations are indicated by -( =0.05)and = ( =O.OO 1).

37

remainder (9) were negath-eh associated. hteresangly, C I L I ~ O J b~hO~I~?m~rwas ?m a parmer in two

thirds of the negative associations.

The results of diis association andysis are presented as a d e n d r o p m based on average distance

bv an inverse loganthnuc transformation of the f value. Overail, 14 clusters of more than nvo tasa were obsen-ed (w Figure 2 - 3 . Thesc rerminal clusters of 3 or more rzm are shown m

Figure 2-8. and thcir polarin. is indicîred. Each rcmiinal branch is 2ihown as a matnx, in ivhich

the positive or negative nature of the conelarion is shown bv a shaded circlc 3 r each node. Following is a surnmaq of'thrse terminal clusters:

Cluster a) .\n unidentified specirs of Pu;rriiomy~ruswas posiavely corrcla ted ro PrniLi/Ii~~rn L.opmphii~~m (srr Figure 3-8a). This pair was negîtively correlated to Tri~*bu Z taxa).

40

ASPEORYZ

PENIVERR

ALTEALTE EPICNIGR AUREPULL

ASPENIGR

1

PEN1 SPIN

CLADSPHA

0positive @ Positive

8 Nagative

.

(p= O 5 )

Negative (p. O5 )

FIGURE2-8 (cont'd): Significant associations between 41

tzsa in

significant clusters (> 2 taxa)-

assemblage, however, a neg~tiveassociation wns observed berween .-lftc>mun'usp. and Penitif/im sp. #26.

Cluster e) G?omytupmnonrswas posiavely associated with Pm1iiomyt~~vmiotii (ire Figure 2-8e).

-inunidenafied species of . - f q e q i / i l u s showed a negauve correhtion to the former, and a positive correhuon to the In tter. Coilecul-el- , dus group \vas ne,pu\-el? associated with ScupztkinopsiJ.

c~m/i~icl.

Cluster g) T h e spccics negatively-associatcd assemblage in cluster g (Figure 2-8g) compnscd .- 1~ptrgifi..~ syrlowiz,

Pt'ni~iflizm i~iundiimtand Pcni~ifliumJ G L Y I , ~ ~ G ~ J - .

Cluster h) The t h e e t u a C h q ~ ~ ~ p o nsp., u mClufo~porim sp., Pi/lumycw Liburtm~m and uncaregorized yeast were positk-el: assockted in cluster h (Figure 2-8h). This group was negativelv correhted to C ~ U ~ O J P hrhumm. OK~I

Cluster i) .Ilwior ~ULYxfOJJUJJ was positivelv correhted with Peni~iifiuumuinJc~um,which was M e r positivelv correlated to Ptni~iIliumLitn'num ( M Figure 2-80. However, Peni~iiIizirzdnnurn showed a

suongly negative correhaon to . I h r ~ U L - ~ ~ -4s O Jweil, Z J - .an unidentified species o f P h o m showed negacive correhtions to dl taxa in this cluster (Figure 2-ai).

Cluster 0 l%niriliurn ihrysogenum was negativelv conekted with [>eni~-iffi~mz b f t ? ~ ( . ~ ~ r lyet ~ ~these Um, nvo ta..were positivelv correhted with .-1~pergz/i~r ogqae (set Figure 2-8j). W i h dus assemblage, i'rnzdiim vernt~~omrn showed a positive association Mth .

ogqut and

- ! J ~ ~ ~ ~ u J J

Ptxiiiiiurn bnvi~-ompu~-tun~ and a strongiy negative association with Ptnzdiiwm i h p - o q ~ ' n u / n .

Cluster k) The serop M c hngt .- 1 p q z l l z t ~ ~~w..i~oior. Emhm.. hrhrrionrm and It'>i/c'mi'

J&'

iormcd a posicivelr corrclated assernbiage (stt Figure 7-8k).

Cluster m) The phdioplane t u o n Lvioi/ddiiumrhurtmum was posimely associared Mch C/cfdo~pon'~trn ~phurmrpzmtrmand Phomtr htrbumm. This assembhge was coiiectkelr

negaaveh

associated with the serophilic hngus .-l~prrgillusustiw (se Figure 2-Ym).

The r e m h g couplet assemblages are summarized in Table 2- 1. Ten of these a s s o k tions were positive and one was negaave c-ltzmonium sp. with Ptnitiffizm t~fiinuicltztm).Of the positive

a s s o ~ t i o n s severd , are of interest. In particular, the soi1 h g. - L p r r g I i u ~ - iunJidu~and .-l~prrgiluus /iimgutu~were nssociated. .-l rpqzif/ur

Both of these

t a n are comrnon

O~.~~&TUJJ

showed and association Mdi Penitif/itrmv d i h .

indoor conmninants on damp bdding matends (Adan and

Table 2-1: Polarity Positive

Couplets of associated dustbome mua Taxon #1 - - L p c p I i ~L~~+n d i d u J -

Taxon #2

p-value 0.003

Samson, 1994). Similarlv, Cbuetomiumgfobosm showed an association with Peni~iiliumLTUJJOSZI~. These axa are common colonists of very wet gvpsum w d board. .Clu~-orpf~tnbc'us was correlated

wvith Rhi;opus o9;ae.

Booth of these

CWA

Xe npid colonists of substrates under iugh disturbance,

particularlv in the presence of simple carbohydrares (e.g. such 3s decaying buts) (Samson and Reenen-Hoeksna, 1988). Ptnitiffi~~m bnvirompu~.tz~m showed a positive associauon with Penztd'i~m iommrrnr. Thesr Penicdh occur frcquentiy on indoor firushes, particSrlv

wvall paper or d m v d

u-hch incurs intermrrcnt \vetting. T h c soll iungi 1'rnit.jllium L i ~ ~ ~ n [ and g n mTrithohmi linih were positively associated. For compantivc purposes, the houses w h c h were obsen-ed to harc active mould growth o n indoor surfaces are summarized Li Table 2-2.

DISCUSSION The most cornmonl- occuring species found in the prescnt smdy ate consistent with reports on the

specics composition o t household dusr by other authors (Bronswiik. 1% 1; Calvo ct al.. 1381;

Da~les,196O; Gravesen, 1978: Hamada and k'amada, 1991; Ishi et al., 1979; Lustgraaf and Bronswljk, 1977; hlallea et al., 1'382; Saad and El-Gindv, 1990; Schober, 1991; Swacblv and Christensen, 1953; K'ickman et d., 1997). The sprues assemblages of dust rnicrotlngi obsen-ed

in this srudy comprised a mixture olecologicdy homogeneous groups:

Ph ylloplane (ien f surface) moulds (e.g. . - lftern~r7uL I ~ I L > ~- - hobruidilrm ~I(I, puilrfun~~, C f ~ d o ~ ilrh.po>ioidrs p o ~ and Epicorsvm nignrn), ail of which were nepuvelv correlared to Peni~ifiiunz~uranfiognirum,a n-pical serophihc food spollage hngus. Serophilic moulds cvpicdy asso&ted with food spoihge such 3s [email protected]~~IIJlun-iioior group. Eum~iumhtbunonrm m d IVhifemi(~sth' (rrr Pin and Hockmg, 1985; Samson and Reenen-Hoeksm, 1988)

Table 2-2: House Number 1O 24 38 30 31 34 43 45

48

--

33

86

36 100 102 111 115 117 137

U2 134

U6 150 154 157 167

177 190 137

201 206 216

335 247 350 276

333 377 39 5 396

Houses wvith visible mould growth obsemed

N u m b e r of isolates recovered P. cb~~oqentrm

P.bm~omprl~-tum

3) Soilborne hingi such as Tikbodemu u i d e and Pt'ni~ih'iurn~itnonignm te Barron, 1968; Domsch et al., 1980). The e-xistence of these d i s ~ cspecies t assemblages was cocroborated by chi-square association analusis.

Besides the groups wirh obvious ecologcd s h t y , several species assemblages were nored that contîined taxa notable as conraminanrs of wntcr-damaged biulding materials o r h s h e s (eg. .- f J ? ~ @ / / Jrww'~a/ur. ~J-+ fi.

I~JYHJ..

C'/Jrlc'~omi~im .i$utio~xm.f'cni~d/iunzu r m h y i w ~ .1%~ .I>nt$'anrp~~~~im. Pr.

ibty-o~enum and S t ~ i h s , b o~fiurturum). t~~~ O ften diese taxa (r.g. .- I i usfzt~,1% riurmfiiyi~mrn,c a.)we re

negativelr corrchted to clusters of taxa from d e h e d ccolog~calg o u p s discussed above. I t is Likely thnt these taxa are m e household residents, as agents of suucniral contamination or gro\iing in dust folowuig cpisodic wetting.

The resulrs of dus srudv showed disproponionately htgh riabie levels of smd-spored hngi, such as ..f~pcrgif~sor Pcr~iiiifi~o;lf (data presented in Appendiu -1). Thu:observation is consistent wtth those of other worken (cg. Flannigan and h u e r , 1994). who have suggested that ndditional factors besidcs proliferation in rilu ma! lead

CO accurnuiation

of these spores in dust m homes

absent of incikaton of mould problems (e.g. in good repair, clean and free Srom water damage) and objective measuremenrs demonsuate a high standard of I.\Q ( F h n w n and h U r r , 1994; Scon et al., 19994. Scon and co-workers (199%) posruiated that dilute levels of spores of these rasa hom outdoors rnight enter houses passively and accumulate in dusr, either because of diffcrenuailv long riabdi7 period of spores of diese species or rhrough mechanicd means. n i e

Luge component of phyllophne fungi in house dust suggests that, although chese f û n g may in some cases become resident in homes, their collective occurrence in dust is a hnction of the&

abundance in outdoor air; dius, in house dust, the accumuhaon of propagules of these fbnungi

Wtelv results £iom the setduig of spores hoom ambient air. The hcr thnt many s

d spored m a

are ofren wen-represented in carpet dust may relate to die rendency of these spore types to be produced bv phaiidic speaes, manv of which produce spores prolificdy o n compound conidiophores uith the number of spores per conidiophore grearly in escess of manv cornrnon, non-phialidic phvlloplane moulds (eg..-llfmuiru, Chh~ponitm).Differences in rabilin. over time benveen these nvo spore rvprts may d s o brt important. For instance. the relativelv ch&-wallrd nature of these n-picdr. phvlloplane . spores intuitively suggcsts an adaptanon ro increased spore

viabilin.; howercr, Sussman (1168) documentcd rhc disproportionate longevin. of s m d , t

h -

w d c d globosr spores such as .-l~pcrprllu~~ and P~ni~iffiuum, relaave to luger, thcker wniled sporcs of phyiiophne moulds. Despite die hck of input of serophhc spcues inro the indoor environment

fiom outdoon during wi-inrer monchs whdc windows r e m m closcd to conserve heat. a stlblc resen-ol of propaples of phviiophne moulds remains in the biologtcal " m c m o d ' of the carpet. ~ f'rni~iffiztmspores Flannigan and hLder (1994) r e c o p c d the longcviry of .-[ J p @ f h and

in

household dust, and suggested thar h s p r o p e q ma. permit die use of dust ns a long-term spore trnp whtch, by înalyis, could reved transient bursa of airborne spores of these taxa ovcr rime. Howcver, \.-crhoeff and CO-workers(1994) found

onlv 3 weak correlation bent-een houscs

thac had obiectivelv demonstrable mould problems and a s u b s r a n d change in the dust

mycoflon, suggesting chat dust analysis mav not be a reiiable preàictor of indoor contamination.

The viabtlitv of die mvcoflora %-as foUoa-ed over thrce vears for dust samples from selecrrd W h c e b u r g stored under dn- conditions. Fifteen dusr sampks (indicated in bold in Table 2 - 3

in follow-up resting showed die complete dying off of dl

excep t .-lunobm'riiiumpzti/~/un~and

Ptwidiuum spp. These results c o n h e d the obsen-ation of Sussman (1968) that spores of speaes of .- l p q i / h and Prni~ikzmremab riable for a much longer peeod of t h e compared ro

most phy lloplane b g i under o u storage conditions (e.g. .-ll~~'rn~fn;I, Cluh~pon'um,Epi~-ommand L r l o ~ -and / ~support ~ the hvpothesis chat the culture-presence of high nurnben of . - l p c @ i f . ~ and Ptni~1flizm11 rehtive to phylloplane ~

Y = from L

household dust rnav be an ytifact of the longer

period of spore rhbilin. of the former group. Davies (1960) proposed chat mould colonization of house dust required at least one of several conditions ro be met: 1) the direct obsen-anon of

conidiophores in the dust: 2) the ~bllin-to culture particular h n g i from dus-borne mvcehl Fragments; and. 3) an abundancc of a pamcular hngus

ui

dilution phrcs rhat sigmficmd!-

exceeds the represcntation of that same species in control sunples. These p ~ c i p a l are s supponed bv tbe prcsent snidy.

1 hvpothesize thnt various routine mechanicd proccsscs widun houses pcrmit the accumulation of hngal spores. Since spores of .-lrpcqjifi~tiand Prni~illizmare npicallv in the sur range of 2-

5 p m in diameter it 1s possible diac these particles mav peneuace inefficient fïlters, such es dust bags Li portable vacuum cleaners o r Glters in forced-ait heating svstems. and thus. not be rficiendy removed from the indoor cnvironment br these processes (Stetzenbach et al.. 1999). This bring the case, a properlv Listded, externdy-vented centnl vacuum cleanrr ma! help ro reducc the n c c u m S û o n of indoor mould spores.

The negahve correlation of C. he~untmwith a number of other, presurnîblv resident carpet dust h n g i mav result from its parti& al., 1986,

abundance in outdoor air dunng e x l v s p ~ (Abdel-Hafez g et

1993; Ripe, 1967). Addirional e.vaminaaons of outdoor air -,amples bv the author have

shown that C. hrrbuntrm is rvpicdy the most abundant species of Chdo~porirrmisolated kom outdoor air from e d v s p ~ through g sumrner in Toronto. %s

species remained rehtkelv

uncornmon in dusr samples u n d hte s p ~ gat, which point, the colonv counn of C. bC.rbumm

becarne suffiaentlv h g h that hgher orders of dilucion were used in order to maintain o v e r d counting efficiencv (data not shown). -1s such, the occurrences of other species that remained present nt roughly constant background lerels were dispkced by the high input of C. btrbrlntn. and proportions- were obsemed to decrease.

Soilborne f u n 9 occur onlv at ven. low lerels in indoor air, î n d rhcir presence in indoor cnrironments is mosdt 1imitt.d to the soi1 oL indoor. poncd ornamental plants (Summerbcil cr al., 1992). The resdts of the present smdv indicare that many common sollborne rasa occur frequentlv in carper dust as well. Thw:m a v result from the cornmonphce North Amcrican practice of we&g

foonvcar in die house, n custom uncornmon in mosr pans of Europe and

.\sia.

The indices of coverage that were calculated using Good's hvpothcsis showcd that in d l but a fcw cases (cg. house numberj 137.188 and 29 1) the s a m p h g technique cmplovcd \vas adequare to

detect close to the totd numbcr of species cxpected in each dust samplr (sce .\ppcn& C).

Nererrhelrss, the number of replications that would be required to establish statisticd confidence in abundance data is prohibiai-eiv Lugr in n study of dus magrunide. Ercn su, the interpretation of abundance dam is complicated by the renden? of heavi&-sponilating hngi

i i ~ ~ , and h n g i exhibiting yenst-like groowth forms to be orer-represented such as . - l ~ p ~ r g iPcni~ifiium

in surr-eus employing senai diluaon techniques.

CONCLUSIONS The fimgal flora of broadloom-bound house d u t consisrs of a mixture of ncave and passive residents. The passive occupants of carpet substrates are d i dochthonous, and &e frorn

ecologicdv diverse habitats, mosdv outside of the indoor environment. The main sources of dochthonous indoor rnoulds are 1) the phvuoplane; 2) soi1 and 3) xerophilic hngal Çoodspodage. The accumulation of spores of these hngi widÿn broadloom dust is a resuit of the indoor environment. Thcse processes ma: multiple mechanical processes o p e r a ~ widÿn g includr the propapaon of phylloplane spores Lidoors on air currents and clothing and die movement of soil-borne h n g indoor on ioonvcar and by pers.

The smd-spored narure of manv xerophilic food s p o h g e fÙng mai- iavor theu passage through inefficient fltcn, such as on vacuum cleanen and forccd air h a c e s . This iikeihood, coupled

with the differentiaily grcater longerin rehtivc to phyliopianc m a ma)- factlimre thrir artifacnial nccumulation widiui broadloorn over m e . However. many of the rasa common ro anv of thesc groupings ma. undergo active g r o w h in the indoor environrncnt under suitable condiaons, however, die prirnan- sources of inoculurn for these fununy are dochthonous. i h c active cesidents of broadloom dust r e mosdv restricted to a s m d subser of the total h n g d

biodivenirv conrained within dus substrate. These species prolifcrate withm bcoadioom dust (autochthonous), and Xe similarlv ofren responsible for fungal disfigurcment of othrr indoor hnishes and building rlements under conditions of water accumulation (e.g. .-lr uer51~dor.Il': icbr).

CHAPTER 3.

A REVIEW OF TECHNIQUES FOR THE ASSESSMENT OF GENOTYPIC DïVERSITYd

INTRODUCTION The development of the polymerase chah reacuon (PCR) in the mid 1980s prccipitated a series of rapid technological advancements in DNA-based diagnostics as well as DNA sequencing tcchnolog. l l a n r such irnprovcmcnts have lcad to thc u-idesprcad ncccptancc and, indeed. r o u ~ use c of DNA sequcncing as a tool for addressing a myriad of previously untenable biological hupotheses. In particular, DKA sequencing has permirted the inferentkl elucidaaon of phylogeny in manu dimcult taxonomie groups. such as the Trichocomaceac.

.\s problems of relatedncss and species concept among the anamorphs of thc Tnchocomaccac arc resoked, questions of population biolog or genctic variation below the specics level become

g e m m e . l o date, manv mole&

gnctic techniques have been deviscd to discrimate

'individuals'. These methods include the chssical hvbridisauon approach of Restriction F r a p e n t Length Polvmorphism (RFLP) as well as several PCR-based approaches such 3s Randorn Ampiified Polymorphic DN;\ (R.APD), Amplifiai F r a p e n t Length Polymorphism

(AFLP), RFLP of PCR products (PCR-RFLP), Single-Sand Conformation Pol~morphism (SSCP), 1Licrosatehrc Single-Locus F i n g e r p ~ and ~ g Heteroduples ,\Iobllity Issa! (HAL-\).

This chapter is repmted wrth the k m d consent of the copyright ouners. Overseas Publishers .\ssouaaon (OP.\) S.\-.,wth permiss~onfrom Gordon and B r a c h Pubiishers, from Scott, J,\. and Straus, S.A.2000- .\ rewew of current mettiods in DN,\ f k i g e r p ~ m gpp. . 209-224. in inremnon of Modern T~xonomich[ethods for P c t r i ~ d h m and ,-t~crmIhCiassification. IL\. S m s o n and J.I. Pitt (eds). .imsterdam: Harwood :\cadrmic Publishers. Thts work uns a conuibution to the k d I n t e m a o d Workshop o n Peni~rf&wn -and .-Lpqh"I~-, held in B - m . The Netherlands, from 26-29 139'. md is presented here ris jusuficxion for the use of heteroduplex mobtiiry wsay as a method ofgenorypic cornparison in h s dissert~tion. For up-to-&te &scussion of DX% hngerp~ang rechques, the reader ts refened to Blears et al. (1998), Ryskov (1999), Savelkod et d. (1999), Smouse m d C h e d o n (1998) and SOU(2000).

This chapter presents a criacal assessrnent of these techniques and comments upon their appropriate uses.

THE DETECTION OF GENETIC VARIATION The a b h o to analyse and chuncterize geneuc variaaon benveen indiriduais of the same spccics with both accuracv and precision has bren a technologcal grail of biological science sincc Gregor .\lendel's pioncering wvork on hercdm in the mid-nineteenth centun. Tradirionnil!-. morphologicd and later p hysiological characteristics of p henotype served as proxy mmsurements oigenotypic variauon. However. most p h e n o ~ p i cM

t s

do not behavc 3s suicr

hlendehn dcterminanrs and Listead are repiated br multifacrod gencuc expression (ix. polygenruc inheritance) coupled widi comples environmentai intluenccs. Thus. while usehl as taxonomie and ecologcal indicarors, thesc markers pose problems in populaaon g n e n c snidics.

In more recent Bme, molecular approaches have anemptcd to s o h c thesc shortcoming. h s t with studies on prorein variaaon and hter. followmg the emergcnce of recombinant DNA technolog, by analyses of the genetic matcrial itself. 'fie recenr introduction of the polymerase chain reaction (PCR) (irlulbs, 1990; Sa& et al., 1985. 1988) reprcsents a quanrum tcchnologcd adrance in applied molecuiar geneacs, and has &en

the development of a grmt diversin. of

a n c i l l q methodologies m t e et al., 1989).

THEUSE OF PROTEMS TO DISTINGUISH VARïATïON Exly approaches to the assessmenr ofgenetic divenin- exploited polymorphisms in 1 variety of weli chvacterized enzymes. Esnacred proteins were separnred by gel electrophoresis and

allozyrnes (delic variants of the same enzvme) were detected by reacMg the gel with an amino a u d sequences appeared as appropriate subsuate and dve. .illozymes w~lthd i f f e ~ g

bands with unique elecu-ophoretic mobiliues in native gels. With the development of dozvme andysis in the rnid 1960s, it at once became possible to address questions about spaaal and temporal distribution of genetic variabdi.

Mthin and benveen popdations and to invesngate

Fundamend aspects of mating systems, recombinaaon, gene flow and genetic &fi.

f i s early

f o m of molecular genetic malysis remalied prominent u n d the mid 1980s.

HYBRIDIZATION-BASED MARKERS In die eady 1970s. DNA-based technologies began to rephce protein analyses. InitiaIli-, Dhi-\-

DNA reassociation b e t i c s coupled tvich DN.\ hybnd stabilttr was used to andrse phylogenenc relationships of single-copv DNA in e u k q o t i c organisms je.g. Shields and Straus, 1975; Sohn et ai.,

1975). Thesc p i o n r c ~ gtechniques of the 19-0s rapidlr gave wav to the more po\vcrful

methodologics of genetic enb&eenng. CnW ~ v i ~ ~ o n ' p uclade, observed. The k t of these contained the es-rvpe straLis of P. btrvi20mp~~~ttrm @;\OLI 1937 II)

and P. rloloni/enim (ATCC 101 1 1) dong with 60 isolates from the Wahceburg collection represented bv B65.4 (46 isohtes) and B35 1 (15 isolate). The second group consisted of 11) W h c e b u r g isolates represented bu B 132.1.

501 F! vindicalum NRRL 96 1

aurantmgnseum --PP polonimm 995

NRRL 97 1 (T)

gj

NRRL

4

(T)

P pobninim C74.1

- F! viridicatum NRRL 958 (T)

P echrnulalum NRRL t 151 (T)

-

FI olsoni CBS 232 32 (T)

- P casercolum [= F! camemberul - -P wostosum digrtatum 57 s~mlgenum (T) P camembm NRRL 874 (T)

NRRL 875 (T)

NRRL 968

F! NRRL 786 (T) NRRL 346 1

/?

-Eupenrullium cnrstosum NRRL 3332 (T)

C

P Wdicatum NRRL 5880

9P

ael)wpium CBS 486.84 (T)

P dipodomicola NRRL 13487 (T)

-Eupenrulliom egypticum NRRL 2090 (T) L

F? chrysogenum Ca. 12

f

FI naigiovense NRRL 911 (T) 6 7O F! notatum NRRL 824 (Fleming strain) F! notatum NRRL 832 (Biourge stfain)

C

i? gnseoroseum NRRL 820 (T)

P notatum NRRL 821 ( T ) F! chrysogenum C8 24 ? i chrysogenum NRRL 807 (T)

-

4

P grtseofulwm NRRL 734 (T)

81! f. g#seofulwm NRRL 2300 (T)

4

F? dipoâwnyts NRRL 13485

m

-P coprophilum NRRL 13627 (T)

- F? granulatum [= P expansuml NRRL 974 (Biourge suain)

65

-

Hemcarpenteles paradoxus NRRL 2 162 (T)

P aOë?mentasum NRRL 795 (T) i? turbatum NRRL 751

V)

F! swieackri NRRL 9 18 CT)

F? koligenum NRRL 3442 (T) P raistrickii NRRL 2039 (T)

P soppi NRRL 2023 (T)

87

F! brevrcompactum 865 4

66 F! brevrcompacium DAOM 1937 12 (T)

95

, . P

t O0

stolonrlémm ATCC 10 111 (T)

P brewcompactum 8251

b

F? brencompaclum 6 132 1

P canescens NRRL 910 (T) P aûuvenefum NRRL 2571 (T) Eupeniuilium lapidosum NRRL 7 18 (T) F! &lai, NRRL 3397 (T)

0.01

FIGURE4-8:

Disrance tree of Penzcillzurn subgen. Penicillizrm inferred from ITS 1-5.8s-ITS2 rDNA data rooted using Eupenici~liwnlapidosrrm and P. bilaii.

C-R

5.

ASSESSMENT OF GENETIC VARIATION IN INDOOR ISOLATES OF P E N E I U U M BRE'CICOMPACTUM8

ABSTRACT Prnirili~mbrpukompu~~um is a cornrnonly occurring putatiwly asesual soilbome huigus and inhabitant of the decaying fntit bodies of fleshr [email protected] This species is &O known as :i frcquent contaminant of watcr-damagcd building marcrials such 2s gypsum w-ailboard (Scott. 1909n). The present study rsamined the distribution of genorvpic diversin based on scquences of nvo genes benveen indoor and outdoor populations of this hngus. 'nie primari- objcctivc of dus smdy wns to test the current specics concept applied to P. It~~iom~~lc~~mi.

Scr-cnty-th-e morpholoycdv and phvsiologicaily uniform isolates of l? bn~i~tranp'.t~~m were o b t m e d Gom 54 houses in Wallaceburg, Ontario. Canada. 'Ihrcc polymorphic geneuc luci. bem-nibulin (ben\). intemal transcribed spncer regions of nbosomal D N A (ITSI -2) m d hstone -i (h.1~4) werc arnpiitied using PCR and compared by heteroduplex rnobilitv assav (HAL-\). Ninc

unique multilocus haplon-pes were obsemed in w h c h alleles showed strong nssociation i n d i c a ~ gpredominantiy clonal reproduction. Two maioc genotqes were observed, whch dominared die houses samplrd, a c c o u n ~ gfor 88.6 " O and 5.4 O . 0 of the sample. respcctk-el!. Other haplotypes were obsenred at low frequency in severai of the houses from whch mulaple isolates were obtaïned.

Pms of this chapter are reprinced with the b d pemssion of Eastern Sew lork Occupaaond .md ESituonmentd Heaith Cmue (EhYOEHC), ;Ub;uiv, Sew Iork, CS.\, from Scon. J-A., Str~us,5-4. and Wong, B. 1999. Heteroduplcs DN-\&g,erpnnang of Ptni~if6umbm~umprlcrtru.from house dut. pp. 335-342. In ~ionerosok, fime and mycotoirrns: hedth rffects. assessmcnt, revenuon and control. E. Johanning ( e a . .ilbany, Sew York

ESllOEHC. 638 pp.

DN.1 sequence analysis of the bem-tubulin and rDN-1 loci for ail d e l e s c o n h e d nvo

as m e n * circurnscribed. -4uthentic genetic& dioergen t groups withm P. I>nvi~-ompu~~~.lum and P. stoionijmum clustered together in the predominant indoor clade snains of P. Bnv~~o'ttpmtum w h c h accounted for 86

of the W d c e b u r g isohtes. The second Lineage conwined 14 "$1 of

the Wdaceburg isohus, and clustered with voucher collecnons obtained from the rocring Luit bodies of macro fungi.

INTRODUCTION There is widespread q p x m e n t that the outdoor environrnent contributes substantiallr to the burden of biological pmicuhte prcsent in builcimg intction (hliUer, 1992). .\ldiough airborne h n g d spores of outdoor ongin arc acccpted to be amongst the p ~ c i p a dergenic l mediators o f seasonal aiiergic rhinias, the presence of amplitiers of h n g i wtdiin the brulduig envelope presents a more serious concern. Tbts is so for two main rcasons: 1) in connast to most outdoor surfaces, bruldmg matcrds of orgmic origui remain devoid of acuve growth u n d rhev becomc wîter damaged, nt w h c h point the absence of microbial competiuon facilitates the unbndlcd growth of p r k m fun&& colonists; and 2) the indoor environrnent contîins a h t e d u t i o n volume of air, permi-g

the establishment of airborne concentrations of these

contamuiants w h c h mny profoundy esceed outdoor levels. In the case of persistentl! wet dqw321, the species most O ften obsen-ed are : I~prrg7Iusniiiduns group, .- 1s. ~vm>olor.Cheto~nittm

.

spp. Ptni~iilizimb r e v i ~ ~ o ~ r l and c t ~ ~SmL U L ~ ~iburimm. O L ~ ~ J C- uriously howevrr, certain speues, notably .-L vt'ni~iolor.P. Itnci~-ompu~'~m and P. cbyogmlrm rnav be obsen-ed in nbundmcr even in

building enrironments h c h g conspicuous amplifiers (Scott et al., 1999a, b). Invesagations of both ourdoor atr and organic substrats fail to a demonsnate sufficient presence of propayules of these fuagi to account for their predominance in the indoor spora rehnve to other q i c d

background mua, such as pphylloplane moulds (Scott et al., 1999a). Thus, the culture-presence of these taxa Gom dusr isolations. m n y of w h c h range from xerotolerant to xerophilic, has been interpreted as evidence for the proliferation of these species in the dust substrate under "nomial" conditions (e-g. low water activip) (e.g. Dacies, 1960; Bronswijk, 1981). Despite considerable obsen-auon and documentation of these species from household dust and indoor air, there is scant empiricd cridcnce ro suppon t h s widcsprcxi hrporhcsis of gcneralized cr?pnc

indoor proLiferauon under normal circumstanccs. Funherrnorc. the phrlogcneuc placement of

P. I>nri~nrnpu~~~ wldun Pc't~i~iili hîs ~m oot been tesrcd using molecular methods.

The prcsent smdt was underrnken in cooperation with the Canada hlortgage and Housing Corporaaon (CMHC) in w h c h multiple isolntcs of

P. ~RL~L~O+JLY~~LZI wcrc obtaincd from houscs

in Nr&ceburg, Ontano (.w Frgure 2- 1). The amount of genon-pic v&bilin. in PCR-amplificd polymorphic grnctic loci was asscssed using a heterodupler mobdp assa-. T h mcthod has been used pretiously in thc screening of human gencs for murations of c h c a l dkgnostic significance (c.g. W'hm et al., 199?), and in the epidemiologicnl investiganon of hurnan vi.ral populations (Delwart et al., 1993; 1994). Chapters 3 and 4 present a more d e d e d discussion of t h i s method.

MATERIALS AND METHODS

COLLECTION AND CHARACTERIZATION OF ISOLATES LFacuumcleaner bag samples of c q e t dust were coiiected Gom 369 houses in ït'allaceburg, OntaPo, Canada by a private cornpan)- under contracr to the Canada Slortgage and Housing O

Corporaaon over a period of fil-e months smning in Januan-, 1994. The disrnbution of house locations sampled is shown on the sneet mnp in Figure 5-1. Funpl isoktes were obtained using

a standard dilution p i a ~ technique g (hldoch, 1981). Isolates of Ptnzri/Iium were idenuced using conventional methods (e.g. Pin, 1980). Isohtes selected for genetic screening were indistingwshable based upon microscopic rnorphology and physiological profdes on swiclud growth media (Pin, 1970). Chapter 4 contins detded information on these procedures. .\ set of isolates of P. .6n~licompu~~u1n from other locations was included for cornparison (izr Table 5- 1).

DN.\ isolation ~ n PCRs d were prrformed accordmg ro thc mcthods descnbed in (Ihapter 4. Three polvmorphic loci c o n s i s ~ gof inuons in the genes encoding beta-tubulin (BenA). histone 4 (H4) and the region spmning the internd trînscribed spacers (ITS 1 ro ITS3) of nuclear

tibosomal DNA (rDNA) were PCR-amplificd using die primer sequcncrs given in Table 5-2. *rile position

of thesc primers is shown Li Figure 5-2. Slcthods uscd for hcteroduplcs analrsis

of PCR products are gven in Chapter 4.

SEQUENCE ANALYSIS PCR temphtes were purificd using QL\quick PCR purificauon kit (QPgen. Inc., i'alenua, Calif.). PCR temphtes were sequenccd using the T q DvcDeon. ncle . sequrncing kit(.\ppIied Biosvstems, Inc., Foster Cirv, Calit) and cstcnsion products were analvscd on an .\BI-50 fluorescent automated scqurncer (.ipplied Biosystems, Inc.). Srquences Lverc d e t e d e d on both sense and mu-sense suands using the same ptimers diat were used for ampii6cation ( J Y ~ Table 5-2).

.iLgnments of sequences were performed using C l u s d S software package (version 1.8) (iér Jeammougin et al., 1998; Thompson et al., 1997) and adjusted bv visual inspection using a test

rditor. Sequences were combined for m d ~ s i sbased on congruence as dererrnined by the

Lst of comparative strains used in this smdv Table 5-1: Strain number Identification Status Substratum

.\TCC 101 11 CBS 232.60 DAO11 1-1'648 D:\O1I 19132'

ex-rype ex-rype

decaying aganc, .Ugonqurn Prov. PL, Ontario, Canada decayng agmc, .ilgonqm Prov. Pk.. Onrario, Canada decqing bolete, C o ~ e c n c u tt'S.\ , rootofPiLw, mushroom, Ottawa, Onrano

urea formaldchydc ioam msulation. atfm-3Ontano

ex-ypc ex- type

ex-?pc

checse. Connecncur, CS.\ iuhtr. rnterrum, Belgium

=

dccquig bolcte. Conn~cncur,CS.\ decarmg mushroom. Dcnmxk spnicc lumber. Quebec

sprucc lumber, Qucbec

b) ITS

0 18s

FIGURE5-2:

ITS 1

5.8s

ITS2

0 2 8 s

Locations of primers used to mplify polymorphic regions in P.brevicompactrirn.

Table 5-2:

Prïmers sequences employed in ths smdv

Beta-tubulin (benA) Source: Fwd primer 5'-3*: Rvs primer 5'-3':

Glass & Donaidson, 1995 GGT AAC CAA ATC GGT GCT GCT TTC ACC CTC AGT GTA GTG ACC CTT GGC

Nuclear rDNA ITS regions Source:

\K'hice et al.. 1390. h d ;

Fwd primer 5'-3': Rvs primer 5'-3':

Cncereuicr et al.. 1995, LYS AGT CGT GGA AGT TAT GCT T.m GTT CAG CGG

Histone 4 (H41) Source: Fwd primer 5'-3': Rvs primer 5'-3':

Glass CG Donaidson, 1995 GCT ATC CGC CGT CTC K T GGT ACG GCC CTG GCG CTT

c FI4 la) /FI41b)

Partition Homogeaeity Test (PHT). The PHT has been subject to recent cnacism for its performance in determining sequence congruence (Barker and Luaom, 2000). Ce& which have been demonsn~blvcongruent have not been reporred so using this

test.

datasets As such,

the PHT should only be used as a g u d e h e and not an absolute determinant of congruence; however, it remains widelv used for this purpose and is offered as a best arailable assessrnent of c o n p c n c c in the presenr stud-. These problems arc considercd in geater d e t d in the discussion scction of t h s chap ter.

Ph~logenrticanalvses were canied out using the Clustal S and P.\CPK sofnvare packages

(P-\CP* version 4.Ob-h for 32 bit hlicrosoft Windows, Sinaucr .-\ssociatcs, Inc., Sunderland. Mnssachuscns) using the Ncighbor-Joinjng method. The data were re-smpled bu 1000 bootstrap rcpiicates, and the prupornon of Ncighbor-Jomg trces posscssing each pamcular intemal brmch is indicarcd to espress its level of support. Phdogeneoc mecs were generatcd using the Treeiïcw sofnvare package. version 1.52 for hlicrosoft Windows 32 bit (Rodeick

Page, Oxford Cnivcrsin-), and formattcd using Corel Dmw version 8.232 (Corel Corpormon. Ottawa).

RESULTS Collection locations of house dust isohtes are shown in Figure 5- 1. Isolates of P. b r u r r ~ - o n p ~ c f ~ n were obtained Gom 3-1 of the 369 houses esamined (1 5

''.O).

Siu of these houses w r e in rural

locaaons (Le. outside the town h n ) . In tord, 77 isohtes were e-&ed,

54 of w h c h

onginated from urban locations and the remahder (18) Gom nual locations.

HETERODUPLEX MOBIUTY ASSAY The genotvpes of house dust P.

b r e M i o ~ isolates ~ t ~ ~are

summuized in Table 5-3. The lowest

degree of d e l i c variation was observed in the histone 4 locus (2 deles) whereas the h h e s r variation (6 alleles) was sern in the ben-rubulin locus obsen-ed haplorvpes were present in 57 haplon-pes occurrcd were obsen-cd in

NO

in

",O,

(JW

Table 5-41. The &ce mosr commonly

17 "'0 and 16 ''(O of isolates. Tne remauiing minor

4 " O or fewer isohres. .\liued populauons of nvo-or more genonpes

t h d s of houses from ~vhichmulnple isolatcs of 1? b r n r i o n z p ~ awere ~~~~~~

obtained suggesnng the stable CO-esistenceof multiple gcnotypes widun indtvidual houses.

DNA SEQUENCE ANALYSIS DN-\ sequcnces were obtaincd for rcpresentati\-CSof each îUelc for thc ben.\ and ITS loci. Diffkulties were rncountercd in o b m g unambiguous scquence fur the histone 4 locus in house dust isolates m d roucher strains. Further anempts to rcsolvc diese dilficulaes wcre not made due to the low atlelic variation in t h s locus, and it was escluded from sequence înalrscs.

Sequrnce îitgnrncnts of p a r d bcra-cubuh and ITS sequenccs arc gn--e in -1ppend.u F. Figure

5-3 shows die resdts of a P e t i o n Homogeneity Test ('PHV conducted on a combined alignmenr of beta-rubulin and ITS sequences including representativr isohtcs of all house dust genonpes and voucher suauis (hsted in Table 5-1). The PHT produced a p-value = 0.0943, indicating that sequence data from these w o genetic loci were congruent and couid be combined. ;\ distance tree produced kom the cornbined beni-ITS damset tvith P.lCPx usuig

the 'ueighbor-Joining method and roored to P. ibrysogrnwm (D.iOM 1937 10 T) is shown ui F w e 5 - k . Brmch support is gwen as the percentage of 1000 bootsnap repiications. Two weii supported clades were obsen-ed. Chde 1 contained authentic strains of P. Iirrvi~-omp(~~./zim and P.

Table 5-3:

S u m m m of haplotypes of [email protected]~-tumisolater

IsoIate #

bed

LOCUS his4

Isolate #

ITS

benA

LOCUS his4

ITS

Table 5-4:

Happlotvpe kequencies for P. b~Vi~-on';bw~lun isolates

Representative Isoiate B65.4

LOCUS

Frequency

Bt2

H41

ITS

A

-4

--\

0.569

Summed tree length (steps)

FIGURE 5-3:

Results of Paxtirion Homogeneity Test for combined benA and ITS sequence data for P. trreuicompactum. B a n show the ciinribution of the total summed branch lengths of 10,000 trees generared from data sampled nndomly across panitioned gene sequences (benA and ITS) using PAUP4 -I.Ob4a (Swotford, 1999). Summed brlnch length for the observed MPT is indicated by the arrow.

865.4 (41)

1

899 (3) 8117 (2) F? bmvicumpactum DAOM 193712 P stokniferum DAOM 193713 P stoloniferum ATCC 1O111 DAOM 215331

m m

-

m

875.3 (1) 8306.2 (1)

i ~ 2 4 4 . 1(1) OAOM 147684 DAOM 215332 8132.1 (10) OAOM 191327 DAOM 214776 DAOM 215335

ALGI J 1

L

G

2 P. chtysogenum OAOM 193710

m

0.01

P

brevrcompactum DAOM 193712 P stolonrferum DAOM 193713 P stolonrferum ATCC 1O111 8117 (2) 8306.2 (1) OAOM 275331

m m

J

-

m

DAOM 192262 0132.1 (10) DAOM 147684

1

I1

DAOM 191327 DAOM 215335

DAOM 214776

I

0.01 -

P chrysogenum DAOM 193710 m

FIGUKE5-4A, B Neighbour-joining trees of P. brevicompactrm isolates based on a) b e n h d a t ~ s e t and b) E S dataset, rooted ro the authentic srrain of P. chrysogenzmz (DAOM 193710 T). Asterisks indicate bootstrap support greater than 90% based on lOVO replicates.

P. brevicompactum DAOM 193712 m

m i? stoloniferum DAOM 193713 m P. stoloniferum ATCC 10111

"'LDAOM 192262

I

6132.1 (10) DAOM 147684

DAOM 191327 DAOM 215335 9 L ALGl

y

ALG2 loO DAOM 214776

-

- DAOM 215332

P chrysogerrum DAOM 1937 10

m

0.01

FIGURE5-4C.

Neighbour-joining tree of P. brevicompactttm isolates based o n combined b r n h ITS data rooted to the authentic main of P. chrysogmzrrn (DAOM 193710 T). Asterisks indicate bootstap support grearer than 9O0/o based on 1000 replicates.

~-tuionifènrmas well as 62 of the Wdhceburg house dust isolates and nuo D-lOhI sn3ins (DAOhl

197767 from urea forrnaldehvde foam insulacion in Ottawa and Dr\Ohl21533 1 from spruce

. . of the P. i/o/oni/emmwvidi P. brervi-onpu~~~inr proposed inidlv lumber in Quebec). The svnonvmv bv Pin (1979) is supported. \Vidin th& chde, the house dust isolates clustered cenuaily.

shoiving less than 1 "'0 geneac distance benveen an? pair of isohtes. Isolate DAOhI 2153.31 ( e s Pirry

lurnber, Quebec) \vas closest to B 1 1

-. B306.2. B63.4, 825 1. B99 and B2U. 1. respccuvcli.

comptising 68 " of the isolates obtamed from Wahceburg. Sisrcr to ths g o u p wns î \veU 41

supported ciade containing 18 ( ' O of Wallxeburg suains represented bu B65.6 and 875.3. Isolatc

D:\Ohl 1 9 3 3 2 ( e s CFFI. Otfawi.3) was ar the base of Chdc 1 o n 2 \di-supponed brnnch.

Clade 2 containcd the rcmatrung Wailaceburg housc dust isohtes ( 1 4 " O) reprcscnted by B 132.1 that clusrcred on a wcll-supportcd branch wvith 5 voucher coiiections (D.\OXl 1-t7G84. D.\OhL 19 1327. D A O h I 115333, M G 1 and ALGI). 4 of w h c h wcre obt3ined frorn decaying rnacrohngi. Sisrer to ths cluster was D.-\Clhl 114776, an isolate obtaincd from 3 decavmg rnushroom in Denmark. Isohre D.-\Oh[ 115331 from spnice lumber in Quebec was at dic bnsc

of clade 2 on a well-supported branch.

Foliowuig the elimuiation of sequenccs of roucher stnins from die combined gene dataset,

î

parsimony analysis was conducted usmg PACP'. Srquences of authentic stnins wcre retmed in

this analvsis. f i s reduced dntaset virlded 29 pmïmory informacive characrers and produced 20

KITSof 139 steps in lengrh. A suict consensus u e r produced Gom the ?O hIMs is shown in Figure 5-5 (L = 141 ,CI = 0.9433. Ri = 0.8182, RC = 0.7718). Branch support is shown as the percentage of trees showing a pmiculv brmch in 1000 bootstrap rephcîaons. The branchmg

P. brevicompactum DAOM 193712 P. stoloniferum ATCC 10111

I

FIGURE 5-5:

m

m

P. chrysogenum DAOM 193710

m

Strict consensus tree of 20 MPTs for P. brevtcompactrrrn isolates based on combined benA-ITS data rooted to the authentic strain of P. chysogenirnz (DAOM 193710 T). Bootstrap values based on 1000 replicares are indicated for branches that demonstrated over 50% bootstrap support.

topology of this tree is not in c o n f i a with the distance tree shown Li Figure 5-4 and shows suong support for the same clades of indoor isolates resolved by the latter.

SPATIAL, DISTRIBUTION .-igraphical surnmarv of the &tribution of isohte genoqpes accocding ro the proslmiv of source houses is shoivn in Figure 5-6. The or$ trend thnt is clcarly evidenr 1s the

t from nuai locaaons [constraincd lit disproportionate obsen-ation of clade s - ~ p risolntcs

the

base of the dendrogram). Eight percent of the houses sampled werc from rurd locauons and accounted for one quarrer of dl isolates of the species examined. i-io~vever,rural isolations provided half of nii clade 2 genonpes. Overail, isolates i i t h h s genon-pc accounted for 9 urban isohtcs and 25

".O

"

O

of

of rural isolatcs.

DISCUSSION ;\s mediods of DNA sequencing imptove and associated cosrs decrease, diere has becn a

growing trend to Lifer phylogenirs based on the analysis of multiple radier than single molrcular datasets. Thus, app roaches ro analysing multiple datasets have received much recen t discussion. Huelsenbeck and CO-workers(1996) summarized and cornparcd three Fundamental stratcgics for dealing wtth muleple datasets: 1) Total evidence approach; 1)Separate -4nalysis and 3) Conditionai Combinacion. The Tocal Evidence npproach follows die assenion of Uugc (1989) that the inclusion of d a r d a b l e

t ~ (including m

both extant and exMct tasn) and d a t k b l e

chancten lavoun convergence on the correct phylogenetic tree. Critics have argued thnt the dernoastracion of conditions under t ~ h i c hparrimony f d s to yieid the correct bnnch topolog

gken evem informative character

(eBuil et d., 1993) c o u n t e ~ d i c a r e sthis approach

(Huelsenbeck and W i s , 1993). Siivmoto and Fitch (1995) advocared Sepante .inalrsis of

multiple datasers, aMg that the loss of independence of chancten resuiting Gom the combined analysis of multiple datasets weakens sratisticai support for phyiogenetic inference. In conuast, these authors hroured multiple independenr c o n h u o n of phvlogeny based upon the m a l r s i s of data particions separarely as a means to enhance accuracy and lend staasucal support to the inferred P ~ t t e n of i descent. Several authors have proposed a middle-gound compromise to thesc

C O ~ ~ % C M viewpoints. ~

o f f e ~ that g indcpendent datsets mny by analvsed in combinacion

\vhen the data partitions can be shown ro be c o n p e n t (Bu1 c t al., 1093: Huelsenbeck et al..

1996; de Queiroz, 1993: Rodngo ct d., 1973). This approach of "Condinonai Combinacion" mandates the prior demonsuaaon of homogeneiry of partitions. One hvoured mcthod ro test sequence c o n p e n c e has becn the Partition Homogeneitv test (PKT)( ~ ; P.\CPS sofnvzrc package bv Swofford) also known as die Incongruence Lcngth Differencr (ILD) (L* Fams et îl.,

1995) test, wherebv separate datasets arc randoml- rcsampled across parutions widiout rcplacement. and these resarnplcd data u c uscd to generatc trccs by parsirnon- analysis. The sum of the bnnch Iengdis of the "bcst" crec obtained without resamphg is then compared to the distribution of the sums of branch Iengths taken from a set of mecs inferred from rnndomlv resampled dam. These sums should be s d a r where datascts arc congruent (die n d hypothesis), and differ under incongruence (szr Famis et al., 1995). -ihrs test is usrd wideh to test congmence of pYetioned datasets and has shown superior performance rehtive to other statistical tests used for this purpose (Cunningham, 1997). Baker and Lutzoni (7000), howevcr. noted that the LLD test \vas suscepable to r e j e c ~ gthe nuil hypothesis of c o n p e n c e erroaeously when data partitions showed d i f f e ~ lerels g of homoplasv. Thw: problem was similarly noted bv Carbone and CO-workers(1999). The PHT has been emploved in the present studv as a test of congmence of sequence data prïor to combined analusis. However, the render is cauuoned that spurious rejection of partition hornogeneip ma! be an issue.

The present study coocems P~niih'iuumbnvi~%~omp~~urn, wnrhich is a common coIonist of wnter damaged indoor substrates, pYticulvlv. dn~vall . (Scott et ai., 19993; h o h?G pg. 194). This speues is also known k o m a nurnber of outdoor substrates including decomposing E r u i ~ bodies g of lmi macrohngi and other decavlig organic matter pin, 1979). Howerer P. b r ~ ~ i ~ o ~ r i r ~isl poorly

represented in outdoor air. Scott and colleagues (19993) proposcd that die differential rcmot-d of larger-spored h n g i by mechanical and 6ltraaon effecrs (cg. vacuum clenning and clumation

in air conrct'ancc svstems), md thc lengrhy spore viabilirics chnrmcrisac o f nnamorphs (>i thc Trichocomaceac play a significanr role in die artifacni;il concentrîtion of propagulcs of thesc microhngi m indoor cnvironments.

'Lhe present studr idenuficd nvo d i s ~ c ht e a g e s widun P. b~rntl~n~qwtmn (clades 1 rY: 2). [solarcs

from Clade 1 were &srnbuted throughout the set of houses samplcd, whereas Cladc 2 isolates showed an incrcasscd prevdence in nirnl localines. Voucher isolates includrd in sequcncing studies that clustercd in Clade 2 d c m o n s a t c d a subswate prefcrencc for decaying f u n p l imt bodies. It is clear that the namc P. bnvi~'0"~pd~m.n applies to tasa included in Chde 1; howevcr, based on the authcntic isohtes included in t h s smdr, there does not appenr to be an avatlable name for taxa in Clade 3. Seifen and Frisvad (1000) studied Prni~iifi~trn species on soiid wood produca and reported nvo discrete micromorphologies for isohtes of P. Iin~ri~-ump(~~~um. In parûcular, celrain P. b ~ v i ~ * o m p r r ~ isolates /um showed predominandv bivemcdiate branchmg nnd suonglv apicdv i n h r e d m e t h e in fresh cultures. These authors suggested chat these c u l d variants ma. represent d i s ~ c taxa. r It is of interest to assess die use of these charncters in

sepancing the geneuc lineages re\-eded in the present studv. Furthemore, the g e n o q i c markers emploved in dus smdv mav help to eluadate Seifert and F ~ s v ~(2000) ~ ' s obsen-ntion.

Thom (19 10) descnbed Peni~iiliumstolonijmlm based on an isohre obwined hom a decaving mushroom in Connecticut. This speues was reduced to svnonrrmyviith P. Iirrvi~~omp(~cturn bv

Thom (1930) but hter included in the P. b ~ v i ~ ' ~ m pseries ~ ~ - tbv ~ ~Raper m and Thom (1 949). whch included

P. brrtiiomp~z~~z~rn, P. ~-tofoniflnm m d P. p ~ i / l i . Pitt (1979) suggcstcd that Figure 3-3

isohtcs P. ~*tolor~+ntnz and P. bnr7mnpdt.lrm showcd a con~inuumof varianon. and oncc a

p rcduccd P. ~.to/oni/lnrnz ro srnonvmr . . Mrh P. i>rpri'.nnirz~~~nz. 'Ilus svnonvmi. . . is supportcd b!-

the present study.

~~VICILLIL'M P A W

Thc chird specics includcd by Rapcr and Thom (1949) in the l? 6 n i ~ i & p a ~ ~ series. tm P. p ~ i i f f , was descnbed bv Bainier (1901) from an isolacc obtaincd from banana cultivatcd in the Pans Botanical Garden. ' h s species \vas accepred bv Thom (1930) and h h c r characterizcd bv Raper and Thom (1949) based on an isolatc obtaincd €rom optical ghss in Panama P R R L 2008) duc to the uns\-ailabilin- of authenuc material. Pitt (1979) ncon-pificd P. p d l i using dus isolatc (as Herb. N I W226). and noted morphologtcal slrmlairv of P. pl~Itllito isolates of P. Iirrvti.onrpu~~xm in the production of apicalir i n h t e d metulae. Howewr, he iusâfied the

placement of P. pcx\ih'i

in subgenus FII~LIIUIII bnsed o n the absence of rami in this tason (Pitt,

1979). hter n o ~ that g bnnching variauon present in some isolates of P. p d i might indiclte the existence of wo distinct species (Pin, 1985). 1t is likelv thar the curent concept of

P.p ~ d i ( i

is inconsistenr viith P. p ~ d / l ~-ensxt i Bîinier (1903 based on the d i s s d t v of the habitat from

fili 1008 T) clustered with which the neonpe was obtained. In the present snidv, P. p ~ ~ ~ i(NRRL the n p e s a i n of P. ~ ~ m u f n n(NRRL ~ - e 7-9 T ) o n a well-supporred bnnch that \vas sister to the

(IU'RRL2147 T), P. 1uuIGmmzz clade that included es-type stnios of the divaricare mxa P. ~unes~Yn.r

(NRRL 777 T) and P. micynshi @RRL 1077 T), the furcated tsvon EH.shrurii (XRRL 715 T ) and die monoremcillate mxon P. mJroputpunum (NRRL 2064 T) (ste Chaprer 4, Figure 46). This clade was distan* separated Gom the clade that Licluded ten.ertic&te taxa, the closest relatives of the P. bnvi~'ompclr/mgroup to the

(JW Figure

4 8 ) . Despire some s d r i n - in appexance of P. p ~ i \ l i

P. I>rrtti~'~nrp(~~~urn group, the former w o n is on17 distandi- related. Ncvertheless. it is

possible that the recognition of a second speues withm the current circumscnption of P. pdli ns suggested

bv Pin (1985) mav redistribute somc isolates currentlr uearcd undcr chs name

to

the P. Irreuliomp~imgroup. Howerer, the eluadnrion of this problem nwaits die molccular chxacterizntion of multiple isolates of P. pu\i/l, includlig representatives from the origtndv dcscnbed habitat (i.c cultivated banana.;).

AFFIL~ATIONS OF P. BREWCOMPACTUM D u ~ the g F k t tnternational Pcnitdhrn and .-l~pr~$I~ts K'orkshop (P.\\Lr- 1) \1CPrlliamsand coliengues (1185) postulatcd that l? Itntri~'ompu~~um wns derked from P. L t r m n t @ i ~ ~ e ' ~and m that

it

represented a central erolutionanly Ilienge in die ten-erticillates. These authors depicted P. I>miiumpu~-t~~m ns a pendamare cvoluaonnq- srep beween P. ~zrrrn/iuOqnSc'um (basal) and P. ebnri

(derived) in a "nested trumprt" diagram (Williams et al., 1985). In discussion that followcd die presentation of t h s paper, Samson (1985) h h e r suggested chat the irnmrdiate ancestor of

P.

I i r r w I . v m p u ~m~ v be P. ihry-ooycnum. Neither of these hvpodieses is supported bv the present

snidy. 1 s shown in the ITS-based phylogeny presenred in Chapter 4, isohtes of P. Lrevi~~oap~z~-t~rn Liciuding die ex-rype of this species formed a basal clade diat was sister to the terverricillare

Penicillüi (Figure +8), although boorstrap support for thk branch was weîk.

Ironicallv, the placement of P. olsonii by Williams and CO-workers(1985) ü in agreement widi die position of this muon inferred kom the prescnt rnolecukr phylogenv based on ITS sequence

('er

Chapter 4, Figure 48). The npe s a L i of Ptni~iIIiuumo h n i i Bainier and Sartory (CBS 232.32 T) \vas siruated on a long, weakly-supported brrinch that was sister to the npe s a i n of P.

t'.hinzii(~~~im (NRRL 115 l T). In rum. dus clade was basal to die clade that Licludrd die npe sualis of P. L r m i n / i o g ~ ~ -( u'm iRRL 9- 1 T), P. puionir~rm('U'RRL 99 5 T) anci P. li~JiCirt;mi(XWU.

5

1 . Ihu: inferrrd phrlogenv suggesrs rhar P. brrriiomptfi~irnl(= P. itoio~ir/nm)ancl l? nho),rr

represent dktantlv-rehted images which show convergent cvoluùon of characters such 3s variouslv a p i c d r inflated menilac and compact, fan-shaped penicfi. Sÿrularly, die elonptcd sapes reponed from P.

J Y O ~ O I I + ~ are I~~

reminiscent of those produced bv P. oironii

.\t

present.

howevcr, I cannot esclude the possiblliry thrit the tvpe suain of P. oi~*onii(CBS 132.37) includcd

in dits phylogcnv was a specious isolate. -1s such. confirmation of t h s sequencc u s q collccuons of die n p e stnin [rom ocher culture collections is rcquired to establish thc proper p hylogenetic position of P. r h n i i .

CONCLUSIONS Ptni~iiliuumBnM~-omp~i~ttim as prcsendy circumscribed consists of at lerist nvo linenges ch mnv represent d i s ~ cspeaes. t One of these Ilieages, P. Ii~uiompuct~irn sensu suicto occurred cornrnonlv in brondoom dust in houses in soudicm Ontario. hlembers of the second h t u g e tended to ocnir predomliantly as saprotrophs on the decat-ing Eniit bodies of fleshv h n g , and were isohted racely trom indoor dust sampies.

CHAPTER 6.

ASSESSMENT OF GENETIC VARIATION IN INDOOR ISOUTES OF PENICIUUM CHRYSOGE2VUM9

ABSTRACT Isolates of Ptnzirilfim zl,y.sogtn~tmwere e . d e d from 369 houses Li Wahceburg. Ontario. ~~~m obrained by sciai &lution Canada. In total, approIumately '00 isohtes of P. L - h ~ . q t vwere

plaring of broadloom dust samples, and idenuficd based on standard critcri~. I'rorn this collection. a subser of 198 isolatcs r e p r e s e n ~ g109 houses was selected for gcneric characterizauon based upon rnicrornorphological and physiologcal

uni for mi^ on sereral carbon

and nitrogen sources.

lIultiple gencnc loci spanning Litrons m smcnirrii and merabolic gencs such as thiorcdoxin

rcducmsc (trsB), beta-nibulin

fie=\)

and accn-1 CO-enzyme.\ svnthasc ( a c ~ \ ) ,as d . l as thc

internai uanscribrd spaccr regions of the non-coding nuclear nbosomal sub-repent (rDK.\.

ITS 1-7) wcre cornparcd using hetcroduples mobility assq. In dus method, homologous PCR amplicons were pooled painrise tn equLnolu proportion, thermally d e n a u c d and reanncdcd. Dissurulîr amplicon pairs werc resolved by

the slower elecuophoretic m y a a o n of

hereroduplexcd dsDNAs rehtive to homodupleses on low-crosslinkrd polrncnhmidr-ngarose . . hrbrid gels into n h c h giycerol was tncorporated as a. mild d e n a m n t .

Parts of this wotk were presented as .anmmed symposium contnbunon lit the iXInternanonal Congress of Nvcologv in Sydney, .\ustrali;i, -\ugust 1999, as Scort, J.,\., Smus, S. and Shlloch. D. 1999. hIoiecuk geneuc from indoor encuonmmts. .\IOS5.6. 0;Inremanod Cruon chancte~auonof vmiability in Pentiifdunr L;llr).sogen~m of .\ficrobioiogicd Societies flC1I.S) -\bsmcts Book, p. 185.

"

Five unique multilocus haplotvpes were reveded with no evidence of recombinauon, i n d i c a ~ g clonai propagation. Two major genotvpes were obserc-ed. which dominated the houses sarnpled, a c c o u n ~ gfor 88.6 u and 5.4 ' ' 0 of the sampk, respectkely. &ee

other muldocus motifs

were obsen-ed at low trequencv in several houses from whch multiplc isohres were obtined. Base sequencing of representatives of ail groupings. LicludLig ex-n-pe s a i n s of P. '$9~-ogrn~~m

2nd P. r r o t ~ i ~ msuggestcd . tha t P. ~ . h ~ ~ - o y nasi m currentlr circumscribed comprises thrcc strongly wpported heagcs. Both es-mpe suains clustered with the sccondan genocype (-')

1,

of dust

isohres), w M c the un-narned, prima- genot-pe (90O.o) included the notable laboratory conorninant isohted bv Alexander Fleming Li 1929. No nornenclntural n-pes included in the present smdv clustered

w i t h

the minor clade (CG)).

'Ihe groups d c h e d using die heteroduples method werc supported by threc scparnte DN.\

fïngerprinting methods: T w o randomir ~mpiifirdpolymorphic ElK.\-n-pe (R-\PD) tcchntqucs using either the

.\L 13 core sequence or (G.\C.\),

as a single primer; and a durd method

employing 3 primer pair of a r b i t r y sequence.

Estensire sampling of outdoor aL in the smdy l o c a l i ~duMg the late summer 1995 f d r d to reval P. cbp-ogrntmz. Outdoor air samples raken duoughout thc r e u ar other locdities in soudiem Ontario, Canada, have c o n b e d the rariry of this spctcies comples in outdoor air.

INTRODUCTION L'iable b g a i spores occur in great nurnbers in household dust and Lidoor air.

large

proportion of these spores typicallv anse outdoors in the phylioplane and are propagated indoors by mechanical means (e-g. upon air cunents and contminated Coonvear). In contrast,

the genen - 4 p r r g l i ' ~and ~ Pcnirillium are among the mosr cornmon indoor h n g , vet diese moulds are relatively poorlv represenred in outdoor air. Thus, ir is wideiy believed that ther proiiferate indoors, ofren c n p a c d y , on various substrates including dust itsclf under conditions of low water acuviry.

i 3 r n t d h m ..liry~-o~en~i,nl Thorn is perhaps the most cornmon of nU Pcnicdha (Pitt. 1980: Raper and Thom, 19-13), occurring as an ngcnt of food spoilage (Samson ct al., 1996j 3 s \veU as 2 rcsidcnt of household dust (Davtcs, 1960) and indoor air. l'rni~iifim~ h y o q t m is also 3 weil-known contaminant of damp building m a t e d s (Chang et di, 1995; Gravesen, 1999; Hunter and Lea,

1995) and indoor finishes (Adan and Samson, 1994). This species is one of die few temerticillate Pcnicdlia that typicalir does not producr mvcotoxins wtth signthnnt m a m m h n toxicity (Dillon et

al.. 13%; Nielsen and Gravesen, 1999; Pitt and L d s h a n k . 1990). tfowcver. P. ' 6 ~ ~ ~ 0 y n l i m

has been identified as a sqpficant allergen in the indoor environrncnt (Coolcy, 1199: Coolcv et al.. 1999; Fergusson et al.. 1984) and as a rare cnusnave agent of opportunisuc human mycosis (Eschetc ct al., 1981; Hofiman et al., 1992).

Little is known about the di~mbutionand variabil'

of the

!'. hyogrnitm group.

Samson and co-

workcrs (1977) iipplicd a broad msonornic interpcemtion of the variabllity die- observeci in dus

i~rnz~7ih1trn group, and elected to srnonrmize a number of hter n m e s with P. ~'h~sogrnz~rn. hyso~entimis thought to be a stnctlv asexud species, sincc no telromorph has been identified.

The purativelv cloml n a m e of P. L.hy-~genwm as well as its circumscription and the validin. of proposed synonrms remîins to be tested usuig modem molecuiar mems. The present smdv wdi examine the estent of c1on;ilrtv wittun a core group of isohtes fiom the

P. ihyogrnzum group

including represenmtii-e authencic isohtes, and test the suimbility of m e n t speaes concepts.

MATERMS AND METHODS ~ O L A T I O NAND IDENTIFICATIONOF STRAiNS

Over seven hundred isohres of P. ~-bFogmmwere coiiected from 376 houses in Wallaceburg, Ontario, as dcscribed in Chapter 4. These isolates were grown for 14 davs ar room temperature on modified Leonian's agar (Alalloch. 1981) and modified Creaûne-Sucrose a g u medium (Frisvnd, 1993). .\ duplicatc plate of each isolate was lncubated î t 3 7 O C for

- dan.

Bascd on

the results of dus prelumnan. csarnuinuon. a subsct of 198 rnicrornorphologicall~2nd physiologicîlly uniform isolates was srlected for genetic chuactcrizntion. .\ir s a m p h g wns conductcd at 18 ourdoor locations distlibuted erenlv throughout die Wallaccburg smdy site

during late surnrncr, 1995, using a Reuter Cenuifkgal sampler @CS) on Rose Ben91 agar medium tvith a snmpling volume of 80 L per sample. Colonies wcrc incubared and idcnafied 3s above.

*niespatial relntionship of' participant houses is shown Li Figurc 6- 1, in w h c h houses arc idenufied by arbitrm "housc numbers" ro prorect occupant pu\-acv. Sources of housc dusr isolates are summarized in Table 6- 1, including houscs from whtch multiple isolarcs wcre obtained. The obscrved condition of the house with respect to obvious mould damase :et thc k

e of site inspection is indicatcd.

The number nsstgned to each h n g d isolate is uniquc, înd

consisn of the "house number" coupled wirh an incrementd accession number reflectivc of die total number of isolates of P. ~hyrogmrrnobtained from thar house.

--\dditiond kohtes included Li s e q u e n ~ studies g consisted of nuthenuc strains as weU as a geognphical n n g e of voucher m a t e d (sre Table 6 - 3 .

Table 6-1: House No.

Sources of house dust isolates used in this srudv No. of isohtes Eiouse No. No. of isolates

*Houses showed visible rnould grou~hon mtcnor surfiices

House No.

No. of isolates

Table 6-2: Strain nurnber

h s t of culture collection striiins used in Identification S tatus

t h smdv Substratum b m c h e s of Hyjf0pu.i sp., Sorway grains of Hordcum vu/san, Ethtopla

ex-type

paper, Ottawa, Ontano paper, Ottawa, Ontano paper, Ottawa, Ontano Piceu focest sud, Quebec s a l m , Ottawa. Onrano \vt.;illsof mouidy housc, S iag;ir~F;iiis. Onrano Lrt-o,wr.ii-nmr~L.rrien:~m Ic;ivcs, P nncc Edward Mutd (3 t'6ce building, Que bec J.JC,!IJ.~E d hc. ~nzwtJ g m s of Hodeum. 1Lamtob;i cheese, Connccncut. CS.! woodtrn &*dismds. .Ubena woodcn waii snids, .ilberta hcmlock lumber, Bnash Columbia g r m s of Hon/eum, Canada _I't~.(~murn ~ n l l i c mKo rcri J.u~J.P. rnmt.. Fionduras check pouch tif Diporiomvi~.~pfxfd~rh~.. .\monü. CS.!

ex- ype

SRRL 1338' SRRL Y24

P. A y t y n n m Thom

SRRL 91 I

P. ncl~~ovc~~ic' L~va

flermng s r r m laboncon conramaru. London, Englmd ex-ypr: chcese. Sdzovy. Czrch Rcpublic

DNA PREPARATXON AND HETERODUPLEX ANALYSIS DN.\ isolaaon, PCR and prepantion of DN-I heteroduplexes were performed nccording to the methods described Li Chapter 4. Four polvmorphic loci consisMg of p introns in the gcncs encoding aceq-1CO-enzvme.i synthase (a--1). thioredosin reducrase (&)

d regions spmnlig

beta-nibulin (ben-\),

and the regon spannuig the interna1 transcribed spacers (ILS1 to

ITS2) of nuciear tibosomal DK.\(rDN.1) wcre PCR-amplificd using the primer scqucnces gircn in Table 6-3, emploving die rnethods dcscnbed in Chapter 4. Figurc 6-3 sho\vs the locsuons of primers used for PCR amplification and scquencing. HetcrodupIc.sîng rcacrions were set up m the manner described m Chapter 4, wherebv isolates with adjacent numbcn were pooled.

pairwise in overlapped cornbinations, so as to encompass the cnmc set. Subsequent rounds of hcteroduplcsing were performed in whch distinctive isolates wcre cornparcd u n d the ennrc coiiecuon was cornpictely characterized.

Electrophorcsis and imagmg o i HAL\ reactions was conducted using the t-crrical method of elecuophoresis descnbed in Chnptcr 4.

PCR ~ G E R P E U N T ~ G I ~ ) -4 subset of 40 isolates includuig representauon of d obsen-ed mululocus haplonpes was selected for fïngerprin~ganal+.

;\II

rninor mululocus haplo~-peswerc Licluded, and

represenmave m j o r haplotypes were randomly selected for inclusion. Two ohgonucleotides,

(G.IC;\),, and rhe core sequence of the wdd-npe phage 1113 (s'-GAG GGT GGC CGT TTG T-31, bodi miaisatellite-specih ptimers were used as single primen in a PCR conwining 25 ng

'11

Thrs work was conducted as a collaboranon mith Dr. Wielruid Meyer, Department of Mediane, Cniverstn of

Sydney, .-\us&

FIGURE6-2:

Locations of primen used to amplify polymorphic regions in P. chryogenirm.

Table 6-3:

Primers sesuences emvloved in ths smdv

AcetyI-CoA synthetase (acuA) Source: Genbank LW598, +2102 - 2452, spanning mtrons 3 & 4 Fwd primer 5'-3': ACC GTG TGG GGT GCC CAC .4AG CGT TAC ATG (acu;\-2F) Rvs primer 5'-3': GGT CAG CTC GTC GGC AAT ACC FAC GAC AGC (acu;\l-IR) Beta-tubulin (benA) Source: Fwd primer 9-3': Rvs primer 5'-3':

Glass & Donaidson, 1995 GGT AAC CAA ATC GGT GCT GCT TTC ACC CTC AGT GTA GTG ACC CTT GGC

Nuclear rDNA ITS regions Source: \Yl-utc cc al.. 1770, hvd; Cnrererner ct al., 1905. rvs Fwd primer 5'-3': GYA AGT WA AGT CGT ,WC M G G Rvs primer 5'-3': TAT GCT TAF. G T T CAG CGG

Thio redoxin reductase (trxB) Source: EhlBL Y 6 1 19, +80t - 1 153, spanning m u o n 7 Fwd primer 5'-3': W C GCG GAG GAG GTC GTT GAG GCT . M C GGT ( m B - l F > Rvs primer 5'-3': TTA GAG CAC K G CTT TGC CTC CTG GTG ACT [tmB-IR)

template, 250 pi1 each of d\TP, dCTP, dGTP, d m , 300 p V magnesium aceure, 150 ph1 magnesiurn chloride, 5 m i l potassium chloride, lmiil Tris-HC1 pH 8.3,700 ,LM primer and 1 unit of :\mpLTaq (Perkm Eimer Corp.), brought to a total volume of 50 & with stenle deionizcd warer, overiaid widi one drop of stede, hght minerai oil. Reactions were subMtted ro

35 mclrs of the Çoiiowing d i c d incubation: 94 OC for 20 sec denaturation, 50 O C Çor 1 min anneaimg, ' 2

O C

for 20 sec estension. with n finai estension of 6 min nr -2 O C .

Products of PCR wcre eiectrophoresed o n a 1.4 ''(0 agarose gel (contaLiing t?; - D E [10.8 g/L Trisbase, 5.5 g/L bonc acid, Zmiil EDTA pH 8.01 with 200 ,%/L ethidiurn brornidr), in 1s TBE n t n field strength of 2 [-/cm, and visualtzed bv ultrîvioler hght transdumination as 302 nrn. .\ 1 kbp DK.\ Indder (Phnrmacia) was loaded in scvcral lancs for rcicrcncc. Xhis mcthod

foiiows the protocol described bv Weising nnd CO-workers(1995).

RANDOM PRIMER-PAIR FINGERPRINTING" The random-sequence oligonucleotidcs 5SOR (5'-.\TG GG-\ .\T.\ CG.\ CGT GCI' Ge['.\ -1-3') and L E C 1 (5'-GAG G.L\ GGT GGG G.-\T G.\C GT-3') were used ns a primer pair in a PCR conminhg 10 ng template, 200 p.hl each of

den), d G V , d m , 200 mi\[ ammonium

suiphate, 15 mM magnesiurn chloride, 5 mN potassium chloride, XOm\1 Tris-HC1 pH 8.5. 5

pA1 of each primer and 1 unit of Tnq DN.\ polymerase (-4dvanced Biocechnologu, Surrey, CK), 0.1 '/O Tween 70 brought to a total volume o f 2 5 p L with s:enle deionized water, and o v e r h d with one &op of stenle, hght mineral oil. Foliowing an i n i d denaniracion of 3 min n t 93 OC, reacrions were subMtted to 10 i n i d q d e s of die followlig low-saingen- thermal incubation:

This uiork w t s conducted ris rl colhbomaon wth Dr. \Geland Sleyer, D e p m e n c of .\le&ane, L'niverst' of Sydney, Austrrilia

11

93 O

C

for 1 min denaturation, 35 OC for i min annealkg, 77 O

C

for 1 mli extension, with n ha1

extension incubation: 1 min denaturation at 93 O C , L min annealing at 55 O C and an extension of 1 min at

FoUowing P C R products were clccuophurescd on a 10 " O polvacn-lamide gel (1s TBE [10.8 g/ 1.. . . Tris-base, 3.3 g/L boric a d , Imll EUT.\ p H 8.01 polvmcnsed bv irec-rndicd mcchod bv thc addiaon ofo.? " n ammonium persulhte and cardvsed bv the addition of 6.6 ml1 TELIED) nt n field strength of 10 \./cm in 1s 113E u n d the brornophcnol dve from was 3 cm from the bottom of the gel. .\ Fln~~n~ with 3. dned culturc of 1hII 24314 (as Herb. ILL1 24314). FIowcvcr. h s s p e c h c n musr correcdy bc considercd a neo?-pe since the use of a li\-ingc s - ~ p thar c has bccn maintaincd

in culture cannor be assumed to have remained consistent with the original coiiecnon despite its heritage. Furthemore. the o n p d author did not csamine the specimen d e s ~ a t e d .In his examinnuon of dus suah and various voucher coilections. Pin (1979) noted that these isolates appcared ro be floccosc variants of P. chy-opctm that produccd bivcmc~llatcto Lrcgularl!rcn-emcdiatc pcniullia. and classificd P. .pi.com~wmin subgcnus Fztmu~itm. CIo\vevcr,

Cruickshank and Pitt (1987) showed support for the conspecificin. of P. chry.opz,m and I I ~g~~-rom~-t~frn on the basis of isozyme elrctrophoreric pntrcms. .\lthough die stabdh- of thcsc mnrken in Prni~iibuunrtasonomy was later qucstioned bv Samson (1 39 1). empirical studies have

demonsunted that isozvme methods c m proride robust m~onomicsepîration w t t h subgcnus Peni~if/iuntundrr a range of experimcntal condiuons (P~cerson,1993). Frisrad and Filtcnborg on die basis of mvcotosin prof&. (1981)) s u n h l v gouprd P. ynieom~.umwith P. h y ~ - q e n m

NOMENCLATURAL STABILITY OF P. C H YSOCELVULM Samson and CO-workers(1973 considered the chree D i e r c k i n speucs (P. ~itnvrn~~e'~tnz. P. bmnrontbntm and P. g~~-r'om~-ezîm) as doubtfui and phced h e m in synonymr aith P. il/yr'og~nmz. Thev based this drcision on their inabilin- to locate audientic m a t e d @dtHennebert, 1985) and

the inadequae of the descriptions provided by Biourge (1923). Funhennore, Samson and co-

workers (1977) noted that an authentic srnain of P. grisromsrum had been examined bu Raper and Thom (1943), who considered it a svnonvm of P. not~~tum.Pin (1979) stmilarlr examlied an (as [XII 92220,jdt Hennebert, L985) and lecronpifed [sic] (a extant culture of P. gni-tom~~e~~rn neonpification, see above discussion) the tason based on a dned culture of Dierckx' onguial isolate (Pin, 1980; Hennebert. 1985). T h e pedgree of diis isolate of P. .

selectcd bv

~ ~ J W ~ J I V I ~

Pitt (19-9) (I1II 92270) \vas scvcn transiers remorcd from die ongmuial collection (cg. Dicrckx

$3 (oryuial) > Inst. Pasteur 83 > Biourge 29 > Thom 4-33.-O > LSHB P39-1930 > C l I I 19G2 > [hl1 92330). Pitt's dcusion to cetain this m w n whch h c clearlv considered to bc close ro P. i h y - o p z m was doubtlessli- senûmentd, since this Dierckx isolate is

the oldest laboratory-

maintaincd cuiture of the genus known (Pitt, 1979). Subsequent esaminaaons of P.

~RJ-~o~DJ~L*~I~

have suggcstcd h a t it is conspccific \ii&P. L-by-op~nîm (Cruickshank and Pitt, 133-: Bndgc et II., 1989). I n t e r c s ~ ç l rnumencal , nnalrsis of morp hologcal and physiologcni data by Bndgc et al.

(1989) excludcd Thom's stnin of P. ~hry~qeniirn (Clusrcr 3 from the cote of isolatcs of diis m species, whch included the authentic culture of P. ~ r i . - t o m ~ w(Ciustes

- and 14. rcspecmclr).

These authors rationalizrd the position of the es-type culture of P. h y m p z î m (1hII 24314) bv suggesting thar it \vas an aartenuared su& (8ridgc et al., 1989). However. invesagations o f the P. ihr).sogrnzm rvpe suain bv

0 t h

authors have noc demonstrnted any s g n ~ f i c mcultural t

deterioraaon (Pitt. 1980; Pin and Samson, 1993). Indecd, Rnper and Thom (1349) noted chat during 40 rears of concinuous cultivation, die ex-n-pe suain of P. ihryso~enitmrcm3lied stable.

Conspecificiv of P. ~ R J J c ' oand ~ J .P.~ hy~'oge'rnwm .~~ is supportcd in the presrnt studr, in whch chis isolatc (as NRRL 820) clustered Mth the n-pe cultures of P. ihty.ro~cnum(NRRL 807) and P. noirrturn (NRRL 831) (set Chapter 4, Figure 4-9, clade -1)..is such,

synonyn, since P. gri~-eomirunhas priori.

P.

i b p s ~ e n m Jis a hter

based on earlier publication.

The n o m e n d a n i d instabiliw of P. d.vy~-ogenzmand the c l e v i n d u s d importance of dus fungus prompted a recommendatioa for consemation of the nnme (Frisrad et al., 1990a. b). In fact, Frisvad and collengues (19902) went so Çar as ro recommend broad consen-ation of P. cbyogenum ss "the species name for the principal producer of penicillin". This recomrnendation was i~~~n and the adranced o n the bnsis dint the association bcnveen die name " P ~ n z ~ i i Idvy~~o~enrm"

biochernical characreaitic of peniclllin biosvnthesis [vas of paramount industrhl importance (Lowe and L.~lander.1983), despite that t h s metabotitc is h o w n from orher tïilnmrntous h n g i

(Abraham and Newton, 1967: Samson et d.,1996). Frisvnd (PAW-1, p. 159) reporred chat he obrained idenacal secondm metabolite pro fües for 1 50 isolates of P. c h p . q t n ~ / mthat he exarnined. Frisvad and colleagues (19903) uiciuded Vl'esding's (191 1) species, P. not~~ttt~n, 1s 3 synonym in thcir consen-aaon recommrndation despite diat P. cbg~.opzctrnhas nomenclanira1

puorin. in ths case. .\ testual r c h e m e n t of t h s article was advanced hter as a focmal proposa1 ro conserve the name i> ihry~-ogcnumpst carlier narncs (Kozaliicwicz ct al.. 1992). srating char

die conspecificirv of P. pitomrri,m m d P. Lr/,ry-qpn~~m was "firmlr estabiished" bv Bridge and coworkers (1989).

The present studv suggests thnt die current concept of P. ~ . h r ~ ~ - q r comprises nz~m direc h c a g s w h c h likelv represent d r s ~ cspecies. t There do not appeîr to be anv a d a b l e names which c m be applied ro the un-nmed chdes. The erection of new spccies to accommodate these ùneagcs is not in contlict viith the nomenchturd consemtion of P. i h q e n i ~ m(F&-ad et ai., 19903; Kozakiewicz et d.1992). However, since it is clear that Fris-ad and colleagues (1990a) intended n~m biochemicd- radier thm inxonomic grounds. die erecüon of to coasen-auon P. i h r ~ ~ ~ pupon m might be an unpopular underraking. At presenr, segregate specirs nidun the P. i b ~ J o g e n ~group

the delineation of sibling speües fiom P. dvysogenrnum awaits the identification of stable, rend.&

observable morphologicd m d / o r physiologicd characten chat reliablv sepuate die members of these lineages.

SYNONYMS O F P. CHRYSOGENUM The followlig synonymy of P. t h y q m i m is based on an esaminauon of e s i s t l i g tasonomic literîturc in addition to several authennc s t r i n s includcd in die present s t u d ~ .

Ptniziiizm ihrysognum Thom

CS. Dept. .\gr. Bur. .\nim. Ind., Bul. 118, 1910. pp. 58-60, fig.

20. NT: Herb. IXII 21314 Pitt Gen.

Ptni~iifiium1980.

Pitt & Samson. Reg. \*cg. 128: 41. 1993..

nom. LYMZJ.. pmp. Kozaktcwicz et al., Taxon 41: lunzirn resulred m

sufficient content of peni&

ro prevent

the growrh of Ch-tridim.Indeed, it is i n t e r e s ~ gto

note chat P. h y ~ ~ o g t n uismone of o d y a few species in subgenus P e n i ~ i f i i ~not m known ro produce membolites of significant toxiciry to animals (Dillon et al., 1996; Samson et al., 1996). Similar anenumted roxiaty has been noted for rnycoto.sin-produckg species of . - ! ~ ~ t ! ~assochred dhf~~

with the seed caches of burrowlig rodents (D. Wicklow. pers. cornm.). Ir is conceivable chat the coupled with its predomliance rehtivc ro other PeniciUia reduced rnvcotoxici~of P. .%rgqpzm

in hurnan-associated habitats rctlect a s d a r adaptacion to rhc hurnun environment. This bcing rhe case. die producaon oi pcniciULi, a potent anubacterial metabolite wirh ncglyiblc

marnmalirin toxiciry, would cleark be an adapave advantagr, pamcularly @en that the fungus in question is a frequent c o n m n n r of Foodstuffs. SLntlarlp, the ubiquirv of P. '6yognl,m in indoor environments has kd ro specuhaon that esposure to t h s penicillin-producing species mal- be a factor in die de\-elopmcnt of d c r g to dus antibiotk, howcrer. such a Iink so iar has not becn demonstrared (Gravesen, 1979).

CONCLUSIONS ~ t n i ~ d h r rcmh y ~ - ~ ~ nisz romn e of the most prevdcnt spccies in the indoor environmcnr. spores of this mould occur c o m m o n i ~in indoor dusts often at considerablv high CFC per gram-mass concenuation. To date, diere hns bren Little invesngation ïnto die level of genorvpic diversin. cornples which withm dus speaes. The present study suppom the existence of a P. dwy~-uqen~tm consists of as man! as diree species propagated clondy in absence of rccombinaaon.

Peni~ifhiumn o t m is a valid s r n o n y n of P. hyogenz~rn.Formai descripuon of the nvo un-named chdes as sepante species awaits the idenucauon of dehning phenonpic characters (cg. Mcro-

morphology and/or physiologu).

CHAPTER 7.

CONCLUSIONS AND GENERAL SUMMARY

The impact of indoor hngal contamination on humnn health has received ever-increasing attention slnce the early 1970s. Despite rvidence that such problcms have existed duoughout recorded hston., die present involvernent of hng as agents of declliuig L I Q and smcrural compromise is comparably reccnt and lacks hutoricd prcccdent. I propose chat the occurrence of threc prorrnctcd cwnts during the insr c c n v have collectively prccipitnted the prcsenr

h n g d epinostic in North :\rncrica. fhese includc:

I.

The shift from a mainiy industrial- to a w h t c coiiar hbor forcc

2.

The development of an cconomy dependent upon access to hliddle-Eastern rcscn-es of fossil fucls

3.

-fie movement to dcsign and consrnict e n e r e efficient buiidings foliowuil: the 19-3

oil crisis

I h i s hvpothesis supports the vicw that the exploimaon of indoor niches iormed by w t e r incursion on structurai eelcmcnts or indoor tinishes by the ecologcal group of h n g collectirely h o w n as "domicile hngi" is a contemporm- phenornenon. Despite thar nrious of the tûngal

taxa inrolv-ed in the c o n t ~ n a o of n human environments ma. to some estent have been preadapted to these habitats, p ~ c i p a l as l ~agents of food spohge, 1 s h d brieflv o u h e a course of rrents in recenr s o d huron- that reiûtes an hvpothesis that these iûngi have CO-rvolvedwith humans principdy as contaminants of domesuc smctures.

If remedial efforts f d e d , destruction of the house was recornmended. ". ..break down the house, the stones of it, and che tirnber thereof, and dl the mortar of the house: and.. . c x r y h e m forth out of die àty inro an unclem place. ('Lev. 14:45)

In his seminal work on wood decar hngi, Bondartsev (1953) chancterized

+rot of m b e r by

the production of ". ..slightiv noticeable discoloranons.. . foUowed later bv white spots and deprcssions". Dolenko and colleagues (1981) suiularlr norcd that dn- rot infections begtns as: -'thin. silii;:-gmy myxlium u ~ t hpacchrs O i yciiriw. o r ns n fan-h;iped. Mac-colorcd m ~ e l i dmat. Chancrerisuc duck ~ ~ 2 n wdh c~h. î r e brown to b h c k ma. dcvelop on the wood.. . In time the conk becomrs ms? red as a result of myriads of spores prodiiccd.

The mvceiium of Sz'p111~rproduccs aggressivc rhitomorphs that c m penctrare masonrv and Stone waiis, often travelling long distances ovcr concretc surfaces or plumbing to colonizc more wood (EUis and Ehs, 1990; Singh, 1094). Ginns (1986) reporrcd this hngus as a frequcnt agent of brown rot of cimbers in Canada, but norcd rhat it was unknown from naninl habitats. Suniluly, the occurrence of dits hingus in Europe appenrs h t e d to woods m sen-ice (Buczacki, 1980; Grar, 1956; Singh, 1994). Indeed the rnost nnninl habitat for diis fungus \vorld-wide is perhnps best descrîbcd bv its Swedish common name, b~tssuun/p,titerallv house-mushroom (Rrman and Holmàsen, 1998). DK rot is undeniablv the most common agent of decar of wooden s u u c n u c world-wide (Singh, 1994)and diere is litde doubt chat dus is die organism descnbed in Leviacus.

VENTILATION h r o r a (1986) suggested that the practicr of occluding estcrior house vents in Europe d u ~ g

WTVII contribured to the errent of problems posed to British housing bv. d .r rot. ~ Indeed. ~ c h a e o l o g i c dendence indicares dint the ancienn deliberatelv included structural features in their buildmgs to promote ventdation and prevent the build-up of indoor contaminnnts.

including dampness (Janssen, 1999). The goal of most e v l v v e n t h a o n \vas the removd of

smoke from h e a ~ and g cooking tires (Spengler and Samet, 1991); however, renalaaon was also used for disease prevention in ancient Egypt following the observation that stone can-ers who worked Li ughdy enclosed bdduigs experienced a grearer incidence of lung disease dian those working in rems or outdoon (VC'oods, 1988). Later, in die LLiddie Ages, overcrowding of indoor environrnents and poor renalaaon was recognized as a. factor in che transmission of communicable diseases Uanssen, 1999).

EARLY HOUSING AND

URBANIZATION

During the vast stretch of cime Erom die Neoliduc to thc 13'h c e n m

.\D,

fewv irnprorements

were made ro the construction of basic European housing (Bronswiik. 1981). Tvpicîl hurnan dwclhgs consisrcd of clongatc structures of wooden polcs bound with nvigs and thatched with recds nnd loom. in w h c h the interior spacc wns p e r d ! . divided up wvith rhe ccntral durd used

For habitation whle the front and back thirds provided gram storage and sheltcr for lirestock

(ibid.). n ÿ s pracuce, and the widespread use of suaw as a flooring m a t e r d almost certainly contributed to L\Q-rekted problems, panicularly dander allergies 2nd contagous diseases (Pope ct al.,

1993).

In the latc loThcenmry, the amateur Dutch opcics esperimenter . h o n i e van Lreuwcnhoek \.as f i n t ro observe microscopic nrthropods in dusr coilected &om hrs home ('E3ronswiik, 1981). Br

thw: cime, Europenn urbaniznuon had reached a sufficient densin- to cause supficant levrls of outdoor air pollution r e s u i ~ gGom the consurnption of c o d and wood for fuel (Spengler and Samet, 199 1). The British diarist John Erelvn wrote of its effects: "lt is this horrid smoke,which obscures our churches and makes Our palaces look

014whïch fouls out clothes and corrupts the \vater so that the very Mui and refreshing dews which fail in the several sasons preapitate this impure vapour.

which with its black and tenaaous quality, spots and contaminaces whatever is exposed co it.

(Evelyn, 166 1 j& Spengler and Saxnec, 199 1)

.Ir the arrivai of the Industnal Revolution in the rniddle of the 18'\cnnq, there was already widespread acknowlcdgement thar dcclinlig outdoor air quaiin- negarively influenced human respiratom health (Spengler md Samet, 1991). The ciramatic s h f t Li the workforcr Gom agrtculture ro indusm hnd the fÙr&er effccr of r c d i s r r i b u ~ glarge segments of the population rhroughout Europe. In the period from the bcginning ro the end of the l!Yh cenrun-. the propomon of the world population who lived in rowns of 10,000 or more inhnbimnts rose from

2.5 to 10

(Davis. 1363). S[arossian (1989) suggested diat advnnces in ngnculmrnl pracuces.

notnbly the introduction of thc potato into Europe by the Spnnish (Simpson and Ogoaaly. 1986). facilitarcd t h popdanon explosion. Her argument cenued on the fact that the potato

offcred more caloric \ d u e chan grain as n funcnon of cultivared acreage. and rhat die poraro wns healthier, being less prone to the insidious mvcotosin conrxninnaon dia[ so plagued stoced cereals, particuhrly rye (3Iatossian. 1989). Nevcnhelcss. increased urbaniznûon memt a shnrp increasc in the propomon of thc world's population thnt reiied on food provided rhrough cornmercd agriculrurc (Schlebeker, 1360). The p d u a l movement away from an agncuiture cenned socicn. marked bv the Indusuial Revolution wîs s d a r l v correlated to the rapid buildup of urban centres at pkotal points d o n g burgeoning made routes bv a Luge influx of w o r h g chss population (Engels, 1845). Living conditions were p m ,butldings were "badly phnned,

badly b d t , and kept in the wont condition, badly vennlated, damp, and unwholesome" (ibid.).

MODERNERA The formal studv of aLbomr h n g began widi the work of the French microbiologist Louis Pasteur. In his landmark work w h c h ultimateh razzed the T h e o n of Spontaneous Generation.

Pasteur coilecred rnicroscopic airbome hngi in broth medium contained in swm-necked Uasks Gom the air at nurnerous sites in and around Paris (Pasteur, 1861). Pasteur's work demonsuated that minute h u n g a l propagules are cvried upon air currents.

It

wns this invisible rnicrobd

burden of air. he proposed, and not sponïlneous genention thar \vas responsible for rnicrobial problems ranging kom the spollage of foods ro human infections (Drouhet. 1997). Pierre LLiquel, 3. student of Pasteur. documcnted in h i s 1883 dissenauon the Sungnl content o f ye in horncs and hospirals. tlc \vas first CO propose an airborne route o f cxposure to h n p l sporcs ns an tmpomnt hctor in the establishment of n o s o c o d and oppomnistic pulrnonm. mt-conc . infcctions (Drouhet, 1999).

Isgislaaon of i o m d u e d b d d i n g codes in Europe during the lare l'Yh and eariy 20Ih centuries brought abour an end to 6 d e n n i a of rrd hoc residenaal consuuction usmg sod. branchcs and clar (Bronswijk, 1781j; although the concept of a standardized builcimg pracucc wns nor nrw

md examples of such cimcaves are known from ancient Babvlonia ca. 2000 BC (DeCrrice. 1960) and the Bible. Canada howerer did not iorrnalze a national building code u n d 1941 (Pavnc. 1981).

The large-scale cmergencc of health c o m p h t s due ro L \ Q problems began in the enrlv 19-0s and c o n ~ u e to s the present dav (3larbu.n and Woods. 1991). One hctor contribumg to chc c u r e n t problem is the Licreased erposure p o t e n d from the tendency of modem socien- to spend more and more of its t h e indoors (Siagh, 1994). In addiaon, c o n ~ u e efforts d have been made to irnprove brulding engineering and d e s p to mzdmize themial e n e r g retention, therebr reducing h e a ~ costs. g These same design improvements have brought abour d n s u c reductions in dilution rendauon, and fachtated the b d d - u p of indoor airbome cont3minants

(Pope et ai., 1993). This suirigent concern about cost of heaiing h e l is a new phenornenon, since much of westem ci~-iluauondeveloped in an econornic c h t e where h e l was rehtively

Lie-xpensive and the inefficient use of £bel was tolerated. PBor to dw: cime, the hngus-related building problem was stnicnrrd, ilMth the p c i m q agent being Jtpidi, the dry ro t hingus. The move ro b d d q h t e r butlding and the awareness of L \ Q problems that it precipitnted was

influenceci br n nurnber of social and [email protected] derelopments.

THECHANGiNG URBAN LANDSCAPE Foiiowing die Second World War. the western world expericnccd an unprccedentcd boom in cconomic prospen-.

The arriva1 of the information age was marked in 1956 whcn, for the fïst

cime in CS histon-. the majoritv of jobs werc non-lnbor (Bloom. 1995). Thc s h f t awar [rom a

p&dy

industriai economr had a h h c r effect of c h a n p g the urbnn lmdscapc. Because a

grcater proportion of \vagc-cnmers were office-based, radier than iactory workers. prosimi- to shpping and rail ports dwindled in impomnce. Workspace and residenaal accommodacion necessq- for a growirtg white-collar labor force were at n prernium in growing urban centres

during dus post-war boom ( F i s h a n , 1987). The skyscnper b e p n as n novelc experiment by .\.lassachusens e n p e e r N ' h m Le Baron Jenny Li che lare lYh ccnnuy to optunise space by

building on a primanlr vertical, rnther than horizontal sis ( h g s and B ykofskv, 1989). D u ~ g die hrst 50 yeus of the Whcennirc- thw: architecturai form had becn gready dereloped Li urban centres across North ;\merka. The c o n ~ u i n gconstrucuon of high-rise structures was instrumental in providing office and commercial space in the growing post-war economy.

SUBURBANLIFE .idciressing o f die post-wu housing shoctage required innovacion, slnce the North :imerican culrurd preference was for detached homes (Wamer, 1975). In part, the automobile whch had becorne an ubiquitous srrnbol of freedom and sranis was crucial to the resolution of t h s problem sincc widespread automobile ownenhtp p e r m i ~ e ddie deccntralkauon of urban populîaons bv dividuig work and home benvecn the c i n and suburb. rcspectivrlv (ibid.). Indccd O\-crthe 20 y r s [rom 1950 to 19-0. popuinnon g o w t h in suburbnn .\mcrica esccedcd inncr-ci5 growth bu nearly a factor of ten, and accounted for o r e r thrcc-quarters of new lobs in the manufactuing and r e d sectors ( F i s h a n , 1987). BI- 1970 the propomon of the CS populanon living in suburbs had escceded that in cin. cores or n i n l ueas (3-.6

"5).

3 ~ . C ,and II

3 1 .C)"O, respcctivclv) (ibid.). The shonagc of rcsidenaal 2nd institutional bddings was also p a d v addressed bv the adopaon of industrialucd building techniques ivhich inrolved the largc-scale production and insrnUxion of prc-fabncaud butlduigs with cost 2s the pnrnnn opamsaaon criterion (Payne, 1981;Tcsta, 1990).

NORTH AMENCAN DEPENDENCE O N PETROLEUM .-\long Mth changing archtecnire, uansponation undenvent a gradua1 ret profound

. that had figured so prominendv in the setdement of North uansformation. The d w a v. svstem ;\merica stenddr. rîelded to overland m c h g as a means of freyht transport, and the iight g a u g railwavs of utban sueetcar svstems slowlv gave wav to diesel buses (Bothwell, 1986). One theon o n the impetus for this change was advanccd in 1974 b r CS anu-trust attomer Bradford Snell (Slater, 1997). Snell's dieorv held diat the ;ùnericao indusmai @nt, G e n e d Motors Corporation, had repeatedlv allied with oil and rubber intetests collectiveh fionted bu shell companies o p e n ~ as g locd pubblic transit compeatms in order to acquke control of local

sneetcar transir spstems, dismande them and rephce hem with diesel buses (ibid.). ;\lthough Snell's ideas have been widely cnticized (cg. Bottles, 1983, the fact remains that GAI and others had prospered o n defence c o n a c n during the First- and Second World W a n and when faced with post-war uncenainv in die defence secror, sought to esploit other markets.

.\t

the samc cime. there was n s h f t to petroleum as a fuel for r c s i d e n d heamg. Cnal the enrlr

1950s. home hcaung had relicd mosdv on coal or u u o d to fuel cenu-al stoves o r rccirculatcd hot warer s y e m s . Thc use of oil as a home hcating fuel became increasutgly popular becausc of its cnsc of use, as wcll as its gcater avaiiabilin. and comparative low cost (Xash, 1968).

THEENERGY CRISIS AND THE SICK BUILDING The n p i d expansion of North .\mericm oil markets uvcr the 30 v e m following WW'II approslnated a m o u n ~ glurtony g for petroleum c.in\.cn by favourabie cconornics and insaaablc consumer appeure for the automobile. *Ihcsu-called "oil crisis" of dic 1970's b c p n d u m g a p r o a c t e d period of political unccrtainm in kev .\.[idde Easr od-producing nations. The n h n c e of the Cnited States with Israel d u M g the "Yom Iuppur WU'' of 1373 brought about a tempocary embargo on CS oil expom br .\mb oil-producers. Shortiv dtenvards, 2 gencrd s d e

in the Iranian oil fields precedcd the erupnon of M-scale political rcroluuon in the Middle East.

bringmg a t e m p o r q hdr tu crude oil producaon and esporr. D w i n d h g rescn-es and uncertainn- about htture avdabilitv prompred the Organization of Petroleum Expomng Counuies (OPEC) ro implement a sharp increase in the minimum reference p i c e o f crudr oil to procect remaiaing resen-es (Nash, 1968). Within a few vears, die base price of crude oil surged tiom its centwy-long average of nround S2 CSD per barre1 to over SJO CSD

(JW

-

Figure , - 1.

The dependence of North h e r i c a o n petroleum that had gcown g r a d d u in the y e m

following W I I (set Flgure 7-2) posed economicdy disastrous consequences if means could not

be found to stem consumption.

HEATING AND VENTILATION Mauss and coiieagues (1970) credited Comish mining engmecr Thomas Tredgold with dit: &sr formal cdculation of î minimal vendauon rcquirement, in rhs case 4 CF31 per person. based o n the physiological nreds of miners. Workcrs ar the beginning of thc Whc c e n m adoprcd

t-endation rates of 30 CFhI per person for workpiacice cnvuonments includmg hospîrals to reduce the porential for diseasc spread and comfort issues such as minimizmg odour gttnerauon (Janssen, 1999). Based on considerable empLical data regardmg perception rhrcsholds for body odour. \'nglc)u (1938) reduced the rmntmurn r e n d a a o n requirement ro 10 CF11 pcr person.

Subsequcnt standards published bv the .\merican Standards .\ssocianon (.\S.-\)

and the

.\mericm Socien- for Heaang î n d Rcfngerîtion Engincers (.\SHR\E) rnaintained the rmnimum venuhion requirement I r ths level, wherc it remained u n d 1981 whcn unabating h n a n d constnlirs on fuel use prornpted .\SHR\E to reduce the requirement furrher ro 5 CF11 per penon aanssen, 1799). .\SHRAE Standard 62-1989 incrcnscd t h s to 15 CFSL per person where

it rem3ms roda\. bascd on c o n h a t i o n of Yaglou's work (Berg-Munch et ai., 1984: Cain. 1983). ;\lthough not fomialIv included as a rationde for increasing the rnirumum vennlauon rate. the groundswell of L-\Q reiated c o r n p b t s following ;\SHR\E 62- 1981 undoubtedly playcd a role

in this decision. Figure 7-3 shows a grapphical htstory of changes in recommended minimum indoor venulation rates. .\ decrease in the minimum ventdation level in t h e enrlv 1980s couiaded closely with a s h v p surge in oil prices (JWFigure 7 -1). m h g the bepinnuig of the modem e n of sick building srndrome.

Year

RGURE 7-1:

Year-end reference p i c e per barre1 of crude oil from 1883 to 1981 (in 198 1USD). SOURCE:Jenkins,G. 1983. Oil EconoMsts' Handbook. New York:Applied Science Publishen. pp. 19, 50, 5 1 8r 94.

Year

FIGURE7-2:

Breakdown of crude oil consumprion from 1955 to 198 1. Sou~c~:Jeakins, G. 1983. Oil Economins' Handbook. New York: Applied Science ~ubiishek.pp. 19, 50,5 1 & 94.

Year

FIGURE7-3: Minimum prescribed ventilation rates [rom 1836 to the present. SOURCE: Janssen (1999)

CONSTRUCTION PRACTICESU Besides influrncing prescribed venahtion ntes, n s h g fuel cosrs also &ove changes in construction practices. Modem resideneal construction emplop a aghdy seded b u i l h g cnvelope design, with a vnpour retardant membrane on the i v y m side- and an air barricr membrane on the cold side o h highlr insuhted wail assemblv (Kesik et ai., 1993. niis watl construction detiberatcly restricts the infdtration of outdoor air, often permitting die îccumuIauon of indoor poiiutants i n c l u h g emission producrs irom building producrs or f u r r u s h m g , moisrure and moulds (Flanmgan and hforev. 1996).

Fungal contamination bu

+ rot h n g i tends ro dominate in blulding consu-ucred prior

to chc

1920s (Koch, 1994). Thc introduction of manr new b d d l i g m n t e d s has both mcrensed d i e porentid for watcr d m a g c and die biodivenitv of cnsuing hingal growdi. In pamcuhr. manr contcmporary matcnals uscd for exterior sheîthmg arc composites o i wood or paprr producrs bound rogethcr using 3 variety of resins, especiaUv phenol-fomaldchyde compounds ( ' r l u h s and .\Lchghr, 1981). In Ontario, diese products commonlv include orientcd suand boards (OSBs) and wafer boards. mosdy made from chpped pophr. Composirc products are lighcer

and Iess expensive to producc chan soiid wood or larninated wood products (such as pltwood); however, thev exhibit n greater p o t e n d for \vater absorption according to the vast, effective surface a r a s of these products (i.c. die rotai additive surface areas of individuai chips). f i s rendcnq leads to grenter suscepubility to fiingai c o n t ~ a t i o n .

The ioUou;mg w o sections c o n t u considenble m i o n n o n of an mecdord nanrte chat dravjs upon prrsond rxpenmce snidying b g d c o n t ~ a ü o withm n b d h g s . These obsen-auons remm large- subiecuve and have nor been subsranriated bu sysrematic research. However. they are presented as a contevr for the wock done ui the rhesis, and as a bas& ro dererme logtcai directions for funire resemh.

1'

GYPSUM-BASED WALLBOARD PRODUCTS Perhaps the most comrnon b g d problem a f f e c ~ modem g buiidings resulrs [rom the use of another highly susceptible burlding m a t e 4 "dn~vall"or " g p u m board". a wdboard panel g paper (ChIHC, 1982). S f d y b b o t ~ihrrn"tn,m ~1s a made of gvpsum phsrer ~ i t nh c o r e ~ of principal colonist of dw; m a t e h l following \vater damage (Straus et ai., 1999; Tsai et al., 1999). I.eaks resulting from b d h g enrelope f'dures ïre the most comrnon factors thnt cause warcr damage igend lcad to contnminaaon. Dqwnii is used cornmonl\- as an inrcrior f u i i s h g board. but ma- occasionallr be used on the exterior side o l a w d assembly as a Cire remdant o r an nir barrier (Kesik and h o . 1997) where it is susceptible to water ci-ge

2nd mould

growth11.

hlould damage on glpsum dnwd is &en h t c d to csterior ivaiis and tiequrntlv occurs 1) foUow.ng watcr infduaaon through esterior walls, bcncath windows or mcchnmcnl pcnctranons

in esterior waiis. r s p c d v basements; 2) in rhc intenor of waii nssemblies as 3 result of condensation on cold cavitv clements of die waii assemblv foUowing csfiluxion of h u m d room

air (especiaiiv on leeward waiis in wiintcrtime); 3) duc to pipe Icaks (often sanitan r e m s ) or

dnpping condensation from uninsSted cold m t c r pipes; and, 4) at wail base behmd baseboard duc to saturacion by mop water. Converselv. h n g l disfigurement of the interior fuushed surfaccs of esterior wails is oftcn due to condensation. in \ h c h case S/rrrhytrot~~~. is rarely involved. The hngt most irequentlv encountered as agents of surface dis6gurcment are:

C h d o ~ ~ o n kdddo~ponodrs m and CL phurm~prmztm,.- iilc'mrln'~~, L~iotiudiurn,- - ! J J P G ~ ~ ( ~ Ji>enio/or. -

Recurrrnt w t e r penernuon ofien estabtishcs a verticai moisture gradient whereby the lower extent of ;l udl remms sanirated md che wmer dunuushes a t mcreasing verncd distance irom the SLD plate. S I U ~ @ O ~~~ ) .~J ; ~ i sm r m both hydrophhc ruid suongb cdulol~mc,luid tends to prolifemre on the lower evtent of g - p s u m w d b o u d wherc the suriice is buffered ro intermirtent dning (e-g.mtenor of the ~dcamy, beneath büscboiuds, etc.). >Licrocorildia. 3s w i d r n c c d bu the arthropods, p c i m d y rmtes. are common in this regton ris acnve p e r s of SIU&O~~'J* ofien exclusive content of these spores tn heu fecai pellets. .-I~.nmonium(resembhg of -4. b u p ) tiequently coOCCLUS in ths region, and in addirion is ri common colonist of rmte kcd pellets. A t uicre--smgdistance Erom che warer-damaged ;ira hyirophdic speaes p e u.ay to mesophlic luid xerophrlic moulds such as .-Lprrgi/u wtw. -4. ~rni~ohr and s e v e d speues of Prni~iidrmkcluding P. brevtivmpur~um~

l3

Pcnkdkium rhr~.~ogemrum. P. gri~-ec$f/u~rnand P.

J$doJx?z

(.\dm and Samson, 1994). These problems

arc common where tb-mshingsare placed directly agaiost cool esterior w d s , producing satic air pockets which result in condensation on w d surfaces and hingal growth w h c h often affects a dramaticdv large area, reciprocd in ououtline to the b h i n g , and thus rescmbles a "shado\v".

THEDAWN OF "SICKBUILDINGSYNDROME" The discasc that heralded currcnt awareness of L \ Q as an iniluence on health n-m of bacrcrid e u o l o g , nameh Legionnaire's Disease, and it's eponymous causanve agent, b y o n d h pntcfn~op/~ii!~. Lrgionellosis was h s t r e c o p e d in 1976 during a convention of the Amcrican 1.egon in Cincinnati, Ohio, at w h c h several hundred pamcipants prcsentcd with svmptoms of pncumonia.

:\fier nn r?diausnvc search to anempt ro idenab die infecrious agent and route of esposurc, invesugaton idenntied thc H\.':\C

system of the host complcx. tlumidificauon units wcrc

found to contain stagnant water containhg the disease causing agent. whch was aspiratcd into dic v e n t h a o n srstem and inhded bv the builcimg occupants. In nll, 34 deaths were recorded in

this initial outbrcali pu, 2000). To date, the eariiest rccorded outbreak of Legoioneh pneumoma derermine bv r e u o s p e c u ~ esnidics occurrcd in 1357 in meat-packmg phnt in p us^, hlinnesota.

78 people were h o s p i d s e d (?rlulazimoglu and Yu, 1998; Yu. 2000). The elucidaaon of Lrgiomaire's Disease b e p a continuhg awareness of buildings as sources for potentialiy

harmfd biological aerosols.

ECOLOGY OF DUST-BORNE

FUNGI

Household dust is host ro a great varie- of m i c r o h g that onguiate tiom diverse sources.

P ~ c i p d y dust . h c t i o n s as an accurn&tor o f biological particles thnt setde out k o m the ambient air. .\.luch of this spora onginates fiom outdoor sources, such as the phyllophne, and

enters the indoor en\%onment pnssively through open doocs and wuidows. ;\nother cornmon contributor to the indoor airborne spore-load cornes from indoor substntes manifesting hngal spoiling, LicludLig consmcuon rnaterials, hmishuigs and toodstuffs. The influx of spores from these sources into house dust effectivelr b d d s a rnicrofungal "seed-bank",

in whch funpl

propagulrs accumulate over rime. remaliing dormant udcss suitable conditions permit germination and growdi. llanv cornmon house-clenning prxcices do less to rcmore dust thm t h c t do to ncrosoliîc and rcdisuibure ir. - 1 s such, asthmatic chddren n-picnih- show an mcrease

Li respiratoq- symptom prevalence foliowing house-cleming procedures (Clark et al., 19-6). Thü: disnipuon of dust-bound spores bv housekeep~ngpracticcs is pamcularlv m c for the vacuum-cleaning of broadloom (Stetzenbach et al., 1990). .\ssociation analysis of the mycotlora of broadloom dust shown m Chaptcr 2 uE this studr idcnnticd thrce d i s ~ c ct c o l o g d

assemblages w h c h correspond weii to thc hrpothesizcd pnrnan. sources of uidoor mvcotlora chat ultimately contribute tu dust formanon.

~SOCLATION ANALYSIS OF DUST-BORNE FUNGI

The first and most obvious dust-borne hsd assemblage consists of phdloplane h n g . 'ipecies identified in the present studv that belonged ro dus ecologcd group includcd .-lfimcln2~Iic'rn~rttr,

northem temperare climates (izr Domsch et al., 1980). However, it cannoc be assurned thar die gro\i-rh of diese hnungi is necessanlr Limited to the phvllopimr and that their presence in bdding interiors is esciusive-ek Gom e s t d m u d sources. C l e d v che mj0nc-c-of construction m a t e d s emploved in smd-scde r e s i d e n d consauction are based on phnr fibre products, uicludlig dlnensiond lurnber I;uninates, oriented snand boards and paper products (Kesik and Lio. 199-;

h l h s and .\.lcI;night, 1981). Thus, it is not uneltpected thnt in the event ofwater damage, these same h g are comrnon colonists o f wood-based construction materials, w h c h sen-e as intrinsic sources of hingal propagules Li indoor air and subsequentlv Li dust. Species of

C / . ~ O Jare ~O of R p~~~ ~

interest in t h i s regard. since they are Çrequenr colonists of indoor

surfaces incurring intermirtent werting, such î s winrer-time condensation on esterior walis

(idr

Chapter 2). S d a r l r . - l / t ~ m i occurs n ~ ~ commonlr on wooden \vindon- dis. and .-fmoir~~~-ic/iztm p d f h r s mav be found on bathroom surfaces such ns shmvcr cumins. bath m m 2nd ale g o u t

(Domsch et al., 1980; Samson et al., 1996: Singh, 1994). Hence, the interpretaoon of ~ p i c n l ''ph~iiophne"species as such depends upon the esclusion of sg-uficnnt mdoor amplifien of thesc rasa.

.\ second Important conmbutor to thc dust mycobiora uidicated

in

chc present srudy anses from

the importation of soil f i n g into indoor cn~ironmentson soiled fooonvear. Bascd on rhesc data, putative "indicaror spccics" of this gro up üiclude 7ktSodtrn.t~Mn&, f~enz2h"11m ~irnon!ywm.and possibly Mi;opu.s aryïur and .\fr/sorpf~~mbe~~r~. Ln mu esperiencc. thesc taxa are lcss pronc ro colonize indoor subsrratcs under conditions of wntcr dnmage than phvlloplane rasa, but

îU

arc

known as occasionai foodborne conmminnnts (Domsch et al.. 1980; S m s o n et al.. 1906). Pitt isolates, and and Hocimg (1999) quesaoned the idenaficaaon of foodborne Tni$o n ~ i o m p u ~ ~P.nhyqeenum z ,and Stur.hybotp- h r t m i n z ). Wiidun the group o f indoor fung chacterized bv ths ecologtcd group, dierc are considerable tasonomic difficulcies. espeuaily in the genus Pcni~iifiunz.A second aspect of dus thesis involved the esamination of the tasonomv of nvo cornrnonly occurring dust-borne P e n i d a , P. Itnviiomp r e v ~ t - o ~ ~ ~ - t u r n collected Gom 50 houses. These h a p l o p e s showed a snong association of deles. s u g g e s ~ g clonal propagation in absence of recombinntion in die set of isohtes esamined. Representaüve alleles were sequenced for the b e n \ and ITS loci (the hstone locus \vas not includcd in sequencins studics due to dtfficulties in obtaliing clcm iequencc). Scqucnce dam h m rhese nvo loci wcre combincd for phvlogeneac xxdvses based on the c o n p e n c e of rhesc data sets 2s

drmonstrated bv the P h r i o n Homogencin. Tesr

(PHT). T w o weil-supported, htghly divcrgenr

chdes \vcre resolvcd. The p ~ c i p a chde l contalied 86'

O

of thc isolates obtained from house

and P. irofon;Jin~m..\s dust samples. Thls clade includrd dic npe stnins of P. breVr~*on~p~zitrrm is the correct narnc for dus tason, since P. ~.to/on+ntrnis 3 later cpithet. and such. P. brrri~mpi~~ztrn phylogenenc analyses prcsented in Chaprer 5 supponed the synonymy of the nvo rasa. I'hc second clade contained 14" e of house dust isolates, and was sufficicnùv dn-ergent from die p ~ c i p aclade l ro \vi.arranr recogniaon as n disrincc species. Several voucher coUccuons depositcd

in the DAOhI under die name P. bnt~i~*o"put-fz./un clustered w i t h t n t h s clade. I n t c r c s ~ g l rthe . habimts for these vouchrr isohtes tended ro be the dccomposmg kuit bodies of flcshr hngi. n i e major$-of housc dust isohces from dus chde w r e obtained from houses at rural addresses (extralimitai ro the municipal boarder of the Town of Wahceburg), h t h e r suggesting that thü: presendv unrecogwed species is afhliated wich more n a d conditions. such as forested areas or other localities where macrohngi h t in high densitv. No isohtes of nomenclaniral standing that were included in the present studv ciustered within this clade. The microscopie morp h o l o g ~ L Y Zmenilae I ~ show of this m o n nppem Lidistinguishable Gom P. ~ V ~ L - O ~ in~ which

considerable apical swelling, producing a chancterisricdy aspergdloid conidiophore nppearance.

Ir is unlikely chat rhts mxon can be accornmodated in any currenrly r e c o p e d &Ka, $-en that

this morphology is of h t e d dismbution widiin subgenus Peni~dLi" .\ review of e x i s ~ g taxonornic lirerature on Peni~iIliuumf&d to vield m o r p h o l o g d l v srmilu t u a described from fungicolous habitats. .\ h t u r e goal of research shail be the evaluation of multiple phenocvpic chvacten such as carbon and nitrogen utùizaaon patterns as well as morphomettic analyses in an anempt to idencik reliablc chmctcrs upon which this new species mav be based.

Inclusion o i ITS sequcnces of thcsc tasa \vidun a largcr sample a i ten-crticillnte P e n i c h indicated thar the chde contaking members of the P. $mit~r/7prl~'1zim comples formed

a

rnonophvletic group siniared on a long branch that was sister to the core of the tcn-cruchte Peniullÿi, in the basal position (set Chaprer 4, Frc. 4-8). In dicir phrlogenv of the rcncrtiullate P c n i c h , Skouboe 2nd colleagucs (1399) did not include represcntatkes of P. iinziiompu-tz~m,and

rDN.1 sequcnces arc presentiv not avdnble for diu: tason on la, J. 1996. .\ PCR-bascd DS;\h g e r p m u n g technique: .lF7,P for molecdar ~ p m og i

bactena. Sucleic . k d s Res. 24: 3649-3650. Liu, Q. and Sommer. S.S. 1995. Restriction-endonude3se hngcrpmung: a sensinvc mcthod for scrceruns rnutanons m long, contiguous segments of DS-4. RioTechniques 18: -&'O--&--. Lobuglio, L F . , Pitt, J.I. ruid TliyIor. J.W. 1993. Phylogenetic ;inalysls of w o nbosomd DI;;\ regons inAcrites ~ L 'm PoZn g asexwd Pcni~illiumspeaes m aubgenus mdaple rndependent losses of a sexual T L J ~ U srare Bivctli'tlkm. llycol. 85: 592-604. Louwgte, J., Delwlut. E.L., ,\[ullrns, J.I., ,\lcCutchm, F.E., Eddy, G. md Burke. D . 5 lC104.Geneuc mrilysis of HI1'-1 isolates from B d reveds presencc of nvo disunct geneac subtypes. .lIDS Reselirch luid H u x m Rerrorrnises 10: 56 1-56'. Lowe. D.,i. md E h d c r , R.P. 1983. Contribunon of rnycology to the anabiotic m d u s ~ .l[ycol. '5: 36 1 - 3 7 .

Lucrecius, c3. 50 BC. Dr rwum n u i m [On the Nature of the L'niversc]. Ttanshuon by R. l l e l d e . 199'. Oxford: Clarcndon Press. 2'5 pp. Lustgnaf, B.v.d. rindJ.E.1I.H. van Bronsuijk. 19'-.

[email protected]~uigin house dust. .lm. .iUcrg 33: 152.

LIacFariane, G. 19'9. Howunl F h q - Oxford: Oxford University Press. lIacFarhne, G. 1984. .-f/cs~ndtrFhning. T h .\fun (rnd ~bt..Llytb. London: Chatro CL \Y"indus. hIacPherson, J.M., Eckstem, P.E.. Scoles, G.J. and Gaiadhrir, .\.,1. 1993. \-;imbilin of the rmdom amplificd polymorphic DS.\ w a y among rherrno~clers,and e Sfecrs O Spnrner and DS .\ concentrauon. .\iol. Cc11 Probes ': 733-209. .\I;ilcr. D.. ltithen, R., L c ~ x KG., . \'os, P. and OLivcr. R.P. 1000. 'thc Lise of gcncuc -vanation rn fung. .\lyçol. Res. 1 Ol!: 1 10'- 1 1 1 1.

.\FI.P fmgcrpnnring inr rhc dcrccticm

AIaiuno. K.. Sekry, T. m d Cfayashi, L 1902. F-SSCP: Fluoresccrncc-bwrd polyrncnse chun reaçuon - single-srr:ind conforrnauon polymorphisrn (PCR-SSCP) ürialysis. PCR Mxhods .-\ppI. 2: I O - f 3.

.\laliea. hl.. AI. Renard .inci!. Chürpm. 1082. Lii flore f'ongquc des hrtbirauons.

Rcv.

Fr. A [ d . Rcsp. 10: 121- 131).

11arbuy. h1.C anri Woods,J.E. 109 1. B d h y -rclarcd Illncsses. ln Inrhur .-lir Po//u/lon: .-If ftuir/, Prr~pr~.firv.h m c r , 1.11. m d Spcng1er.J.D. (eds) Balmore: Johns CIopkins L'niversi~Press. pp. 306-322. hlarshd. R.D.. Koontz. J. ~ n Sklar, d !. 1095. Dctecuon of mutanons by clcavage of DS.1 hetcroduplcscs wth bactcnophagc rcsolvascs. Srinire Genct. 9: 1"- 183. hIaruncl4 G.. Tnbern, E.. Far~begoii.P., B u m , M . Z;iccana, -1..Tr.stoni. S...habile, JI.. C.tsmclii. .\., Dc\wo. .?.. Pignatn. P.F. md T m , S. 1996. Fingcrpmung of 1-Li-DQ.4 by polyrner~scchun reacuon .ind heteroduplcx malysis. h[olcc. Ceii. Probes 10: 123- 13'. h[ashrym~i,S.. Sekiya. T. md I h y d u , K. 1900. Scrcening of rnulaple DS.1 samplcs for dcrccnon d sequence changes. Techruque 2: 30-1306.

N~xarn,.{.JI. & Gilbert, W.1980. Srqumcuig end-labelled DS.\ wrh base-speutic chernical cfem-agcs. >Leth. Enqrnol. 63: 499-560.

hleumer. J.-R. md Gumont P A D . 1093. Factors affectmg reproduabdity of m d o m mptitied polymorphic DS.1 h g e r p ~ t i n g Res. . llicrobiol. 1U:3'3-3'9.

5leyer. K'.,Lieckttëldt, T., b y s e r , T.. Xümberg, P., Epplen, J.T. mci Borner, T. 1992. Fingerp&ting h g a l genomes airh phage Ml3 DI;;\lind oligonudeacide probes speàfic for simple repeutive DS-\ sequrnces. --\dv. 5101. Gen. 5: 241-353. 1Li);iunoto,h1.M and Fitch, W.M. 1995. Testing speaes phylogenies rind phylogeneuc mechods wth congruence. Sysr. Biol. 4-4: 6-L-6. hlicheii, 1I.R.. Bove, R., C3lissm0, P. md Dt;\mbroslo, E. 1993. Rmdom mplified polymorphx DS:\ h g e r p r i n ~ gusing combinanons of oligonucleonde primers. BioTechniques 15: 388-300. 1Ucr.J.D. 1992. Fungt iis contamanrs ut mdoor Ur. .\rmosphenc Enruonment, part .\.26: 71fi3-21-2. ~tiller._1.D...\.JI. L~Fiamme.1'. Sol~el.P. Lrifontme ; i d R. Grcenblagh. lC)Y8.Fung Candian homes. Int. 1. Biodctenorauon '4: 1 113-1123.

; i d

hingd producrs m

ALiquel, P. 1883, Des orgaxusmes nvmts de l';itmosphirc. Thèse F x . . \ i d . Pans.

1tishra. S.K., L. .\leUo, D.G. .\hem. FI..\. Burgc, \'.P.Kurup, D.L. Pierson. D.L. Pncc. R..\. 5unsoii. R.S. hndhu. B. Shelton. R.B. Simmons m d K F . Swacr. 1992. Envuonmental mycology and its unportmce ro public hellth. !. 11ed. \*etenn. h[ycol. 3 0 (suppl. 1): 3 " - 3 0 5 . 1Liymoto. T.. S. 0skun;i. K. 1Lizun0, hl. Sasa mrl?'. Ishizaki. 1069. Cross-mugcruciy smong SLX spccics of dusr mires rind house dust rinngens. J. .\lierg. W: 228-238. Alohabcrr, !.,\.. Hia. .\.L. and 1km.KY.'.!.1091. Son-ndioricuvc smglc strmd conformanon pol~morphsm (SSCP) usmg the Phamriclri 'Ph;istSysrcm'. Suclac .\ads Res. 19: 3154. hloorc, &'.EL. md L.1'. Holdcmm. 19-4. Ff umm fecd tlon: the normal tlorn of 20 !ap;incse- 1 iaw;uians. .\ppl. .\licrobiol. 2': O6 1-069. Slorcy, P.R. 1 YIO. P r ~ c u c dlispecrs o t sampltng tor orpruc dusts ~ n mçroors;inisms. d .\m. 2'8. 1 l o r ~ ; ~ " r11. c . m d Oliti-ten, .\.11. 1993. PCR-smpliticd mcrosaccllircs w markers 182. 11onysrn;i. Y., S. Siitmta, T. Tsuda and 11. Sirra. 1992. Occurrcncc of moulds Biodet. Biodepd. 30: 4--35.

ut

!. Inci. hkd. 18: 2-3

plant gcncucs. Plmr 1. j: 1'5-

ui Japanesc

bathrooms. Intcmrit.

1IuclIcr. L.G., Lipan, S.E., 1Ltlgroom, 11.G. 1996. .implified t ' r ~ p c n length r poIymorphsm (-\-\FI.P) Cmgerp~ung of s~mbioticf u n 9 d n t r e d by the fungus-growmg m t C j p h o q ~ minulsu. x hlolecuiür Ecoloq 5: 119-12.

Llullis. KB. 1990. Process for mplifying, derecmg, and; o r cloning nuclac a a d sequences usmg a thermostable enzyme. CS Patent 4,965,188. h1unlidhar;ul

L and \)C'&ehd, E . L 1993. Concenmnon oc primer and remplare quhtanvely affects products rn randornly-amplified polynorphîc DN-1 PCR B i o T e h q u e s 14: 362-364.

Myers, RA[., Fischer, S.G., hianiatis, T. and Lemlui, L.S. 1985. NearIy -dsulgle base subsanitions in DS:\ tkgments iolnrd ro 3 GC - c h p c m be derected by denahiring gndient gel elecuophorcsis. Sucleic .lads Res. 13: 3111-3129. N a g r n e , CA[., Chan, IL m d L u , Y-F.C. 1989. A PCR mfacr: genenaon of heterodupleues. .\m. J. Hum. Genet. 45: 33'-339. Nash, G.D. t 968. Lfnitcd SrcltcJ Oil hQ, 1890-I 964. Pittsburgh: Cruversin- of Pittsburgh Press. 286 pp. Sielsen, L F . m d Gr~vesen,S. 1099. Producnon of mycotoxms on uxter damaged b u i l h g matcnds. In BiacrrmoLi. Fmgi dnd . \ ~ Y L - O I O A ~ ~ J . . E. ! o h m g (cd.). Procecdings of the k d [ntemanond Conference on Funpi. ~ S e w York. Leptembcr 23-25. 1098. .\lb;iny, S e w 1lycoto.w~and Bioaerosols. S a r ~ r o gSprings. 1-ork: Eastern S e w York Occup:tuonal ~ n Environrncnral d 1-Ic:ilth Centcr. pp 4 3 - 4 3 1.

Sorbick, D., 11. Torgén and C. Edluig. 1990. I'olade o r g m c compounds, rtispinblc dusr and pcrsond fxrors relatcd ro prevalcncc and mcidcncc of slck building syndrome m pnrnan schools. Br. 1. Ind. ,\M. 4': '33-"SI. Offernians. 1I.T.C.. Struyk. L., Degeus. B.. Breedvcld, F.C., \~andcnclsen,P.J. ~ n Rozrng,!. d 1096. Direct .isscssmcnt of juncaonal diversity m remmgcd t-cc11 rcccpror - bct:i c hun c n c o h g ycncs by çombuied hctcrodupIex md single-stnnd conformauon polymorphism (SSCP) analys. J. immunol. KA. 191: 21-51. Oka, la.. 1I:itsunaga. FI., Tokunap, K., 1titsunagii. S..!uli, T. .ind \-;imam, .\. 1004. .\ simple mrthr~dfor detecnng smgk base subsamuons and its ~pplicmonro I IL\-DPB1 t p n g . Sucleic .\cids Res. 22: 1541 - 134Onr;i, 11.. Iwhanri, Fi., L n n z n w ~ fi., , 1-fayaslu. kL and Sekiya. T. 1089a Detccaon of polymorphisms of human DS.1 by gel elecrrophoresis as s u i g l e - s t r d conform;iaon potymorphrsms. Proc. Sad. .\cad. Sa. CS;\ 86: 3'66-1"O. Onta. 11.. Suzuiu, Y., Sehua, T. m d Haynsh, K+1989b Raprd and scnsiuvc detccnon of pomt mutmons ~ n D d 5.i polyrnorpiusrns usmg the polymer~sec h m rcacuon. Gcnomcs 3: 8'4-3-0.

Park, K.-S.. Jung. L-S.. k m , 5.0. .ind Lm. S.J. 1993. t i q x r s c n s i n n ~pneunonias mduced by P m a l l i m ~ r l n j u m m a home enwonment. Ch.Eup. .Uergy 24: 383-385. Pasteur. L. 186 1. 1fcmoi.r~sur les corpuscules org~rrisésqui existent dans I'aunosph~rc. Examen de h doctrine des Sa. . Nat. Pans 4(16): 5-98. généranons spontanées. ,h Payne. R 198 1. Houses and structures. In C~nLcdirln16oodr. Thclrr Pmpcrt~cim d C-ied. 3"' Ed. J[ullins, J. md 1 l c h g h t . T.S. (eds). Toronto: Cmversity of Toronto Press. pp. 265-334. P e ~ e r G.-1.. . Bush, -1..Kise, R.. Kim, K.,Domer, L., L s h a , EL,Lroche. -4.. Scoles. G.. Uohar. S.J. md Fedak. G. 1993. Reproduabdiry of m d o m mplified polymorphe D S , i &\PD) ;uidysrs among laboratones. PCR llethods -\-\ppl. 2: 331 -345.

Pepys, J. 1969. Hypersensitit~cydisases of the lungs due to h g d and orgmc dusts. hlonognphs m ;illerg. \-ol. 4.

Peterson. S.\\'.

2000. Phylogenetic ündysis of Peniiifdum speaes büsed on ITS and LSL' -rDN.\ nucleoude sequences. pp. 163 - 1'8. ln I n t t p f i o n q'.liluljem Tkononris .\ldhodifor Pcnj~iiburn na' A ~ v m i i fCh , J.-J ~' ~ L Un-~ X-4. ~ O S m s o n ;uid J.I. Pirt (eds).-\msterdam: H m o o d .\cademic Publishcrs. '

Pitt, J.1. 1985. Inherenr problcms m Prni~i1lit;mraxonomy. In. .-!duc~nwin Pwii/Lurn und , - I ~ v ~ ' q iJ~YJ-tc'mrltiLs. /h R..\. Samson and J.1. Pitt (eds). New York: Plenum Press. pp 155- 16 1. Pirt, J. 1. 1388. .-1 l ~ l o r u r oGui& ~ fo L>mmo~rPrni~i//i~;rn J>ecitS. S o n h Rydc, S.S.%'.:(:omrnonweaith Scicnntic mci Indusrna1 Rcscarch Orgrnation, Dix-tston oi Food Proccssmg. 13' pp.

Phrr. S.D., C.1. l[;irtm. S..\[.1-iunt;ind C.K'. L a m . 1989. Damp housmg, modd g o w h and s-mpromriuc hralrh srare. Br. .\[cd. 1. 338: t 6'3- 16'8.

Prosscr, J. 1003. Detecnng single base murauons. Trends. Biol. Technol. 11: 38-2-16, i'ulpxli, Fi.. Zakharov, S.F.,Garner, lI.,\[.ruid Chrmbach, .\. tO0-l. Detccnon of ;i s u i & base mismatch m double-mmdcd DS-A by electrophoresis on u n c r o s s ~ e dpolyacryhmdc gel. Elcctrophorcsrs 15: 1095-1 1W.

R.wntkglavac. Ai.. Glavac, D. ;inci Dean, Al. 1994. Senstntlry of single-smd conformriuona polymorphism and hcteroduplex rnethod for mutmon dctecnon in the .suc iïbrosis genc. Human llolcc. Genet. 3: 80 1 -

Yu-. Rrrymmn, F. and 11. Ichwmz. 194'. Home dust ruid fungus dlergy-. .\cm Pathol. .\licrobiol. Scand. 24: ' 6 - 8 5 . Richards. h[. 1954. .\unosphenc moid spores in and out of doors. J. ;!ilerg'- 5 :429-439. Riedy, h1.F.. F I d t o n \S.',[. III m d .\quadro, C.F. 1992. Excess of non-parental bands m offspmg fiom h o u - n parnate pedtgrees assayed usmg R-lPD PCR Suclerc .lads Res. 20: O t 8.

Ripe, E. 1962. M O I d~ e r g . 1. .ln investigation of che ütrborne hingd spores rn Stockholm, Sweden. _\cm ,üItxgol. 18: 130- 159. RodRcks, J., Hesseltine, C.W. and lfehlman, 1L-L 13". .\b~*oto~in~in humun ~ n unirnui d h t r h . Park Forest South, Illinois: Pathotox Publtshers, 80' pp. Rodngo, .\.G., Keiiyborges, LI., Bergqursr. P.R ruid Bergquisr, P.L. 1993. .\ rmdomsauon test of the nul1 hypothesis chat nvo chdograms are sample rstimated of 3 prinmetnc phylogeneac tree. Xrw Ztislruid J. Bot. 3 1: 25'-268. Rosendahl. 5. 1990. Populanon structure of clona1 h g (.\bstr.ct hICP4.2) O1tl Congress o f rhe Inteniauonal Cnion of .\licrobiologcal Socieucs. Sydney, .iusrralia. .\ugusr 16-30. 109'1. Rylandcr, R. 1000. Effecrs .ifter mald cxposurc . - w h c h .irc thc causrinvc .igcnts? In Bro~tmioi..t *.:M~I.id.\ l : L a r ~ n ~ t r i . i iJ~ohanning(Ed.). Proceerirngs of the Th.ud Inremanon~lConfertncc on Fung, l[ycotom~s~ n d Bio;ierosols. Sanrogri Spnngs, S s w York. Srptcmbcr 3 - 2 5 . 1998. .\lb-mu, Scw York: Easrcrn Scw l'ork Occupaaond anci En\uonmentd Fict'dth Ccntcr. pp. 78-32

Ryskov. .\.P. 1999. llululocus DSi\ hgerpmang m the gcneuc stucircs of btodivcrsty. Uol. Btol. 33: 880-302. Saad. R.R. ~ n -1.-1. d El-Guidu.

1OOi).

[email protected] of rhe house dust

in

Riyadh. ;;ludi .ir:ibu. Zentrdbl. llikrohiol. 145:

65-68.

S.&, R.K., Geifiind, D.ti., Stoffcl, S., Schrirt: S.!., Fiiguch.~,R.. Hory, G.T., .\lullis, K.B. ~ n tiriich. d F L i . 1088. Primer duccted smymauc mptiîïcauon of DN.\~ 7 t .hi thcrmostablc D 5 . i polymcr~se.Scienct. 30: 48'- 49 t .

SüLki. R.K.. Scharf, S., Fdoona. F.. liuhs. K.B.. tiom. G.T.. Erlich. tI..i. m d .irnheui. S. 1085. Enzymauc mpliiicanon of beta-globuh genomic sequenccs ~ n rcstncuon d site malysis for diagnosis of sickic ce1 anema. Saence 3 0 : 1350- 1354. Stikrimoto, T.. .\. L'mu, 1I. Ylimacla, 1'. 1l;itsuda. K. Tanrik;i and S. Toni. t 98O. S nidics on the osrnophrlic hngus tC;r/hmirl A t as m diergen evduatcd bu chc skm pnck test m d rdotiliergosorbent rcst. Inr. .\rch. .ilicrgy .\ppl. tmmunol. 'IO: 368-3'7. Srimbrook,J., E.F. Fntsch m d T. l i m a a s . 1989. .\lok"uhrchnrng Labonton Press. New York. L'ois 1-3.

.-1 Lboruto- . \ l c l n d 2nd cd. Cold Spnng tfarbot

S;~mer,J.11..LLC. 1hrbury 3ndJ.D. Spengler. 1988. Cicidth elkcts iind sources of uidoor arr polluaon. Pm II. .lm. Rev. Respu. Dis. 15-: 221-243. S m e t , J.N. and Spengler. J.D. (eds) 199 1. Indoor .-tir Poilurion: -4H r d b Pmptt-r& Cniversity Press. 40' pp.

Bdurnorc: j o h s H o p h s

S.mson, RA. 1985. Dialogue follotkuig paper presenred by \Küiiruns et 31. The closely relrited speues of subgenus Pmit/liurn - J ph y logemc esplonuon. In. .-ldvuncrs in Prnr~r'idum~ n r.lA ~ m r / / m.$~*ternutirR..i. S m s on m d J.1. Pin (eds). S e w York: Plenum Press. p. 13'. Samson, R-1.. Flannigan, B., Flannigan, ALE., 1-erhoeff, -\.P.. -\dm, O.C.G. m d Hoekstra, E.S. (eds). lc)ï14. Rtxommendanons. In H d h 1npliurion.s otFlmgr in lrrdwr Enmhnmnrr. .iuQualin-1fono_mphs 2. .imsterdam: Elsevier. pp. 53 1-338.

Samson, Ru\., E-fadlok, R. and S t o l . .LC. 19'". .i taxonomie study of the Prni~iidumh y o ~ e n c ~ senes. rn . h o n i e vlin Lccum-enhock 43: 16%1-5. Smson, Rh\.. Hoekstra, ES., Frisvad, J.C. and Filtenborg, 0. 1996. Intmduction ta Food-Born Fnngr. B-mm, The Netherlmds: Centraalbureau voor Sciurnmelculnires. 322 pp.

3 h

Edn.

Samson, R,;\. md B.v.d. Lustgnat: 19'8. [email protected],peni~r'ibiJc~m d Em~riunrbulqPhi/i~xrnin rissounon w t h housedust mites. .\lyoparhol. 64: 13-16. Samson. R.-\.and E.S. van Rccnen-E-iockstn. 1988. Intrnduction to F~od-Bornef i n @ 3rd cd., Barim, The Sctherlruids:Cencrmlbureau voor Schimmelcuirures.

'iavagc, il..\.,\S'ood, N..\.P., Bidwcll, J.L., Firches, A., Old, J.11. and 1-IUI, L1L. 1095. Detccnon oi bet:i-thrilassema mutations usrng D L \ hctcroduple'c genentor rnoleculcs. Bnt. J. Haematol. 00: 364-5-1.

javrlkould. P.H., .\arts, H.J.. dc Hiias.!.. Dijkshoorn, L.,D m . B.. Otsen, Al.. Riidcrnakcr.J.L., Schouls. L. ~ n d Lenstra,!..!. 1999. ;\mpliGrd-fiagrnent l a g t h polymorphsm sndysts: the statc o i an m.j. Clm. JIicrobrol. 3': 3O83-3O91. Savolatncn, ).. i'iander. R., Einarsson, R. md Koii-ikko, -1. 1090. Immunoblorung malysis ofconcanavah .\ isolated ~llcrgcnsof Cjnclrdcr ( I ~ L U R ;\Ucrgy T . 45: 40-46. Schefcr, 1 {.B. 1986. FIcdilth effccts from rnycoto.uins !volaule or ~bsorbedto pümculates): .i rcvicw of thc rcvclanr data m anunal expemenrs. In:Sigmiïcancc of h n g m uidoor ;ur: Rcpon rii J worluns yroup. 1 fedth m d \K.'Clclhre Cmada K'orking Group on [email protected] and Indoor .lu. 18 pp. Schirenvacer, B. m d Ender, .\. 1993. Different DS.\ polymcrases ma. [email protected] thffercnt R\PD products. Suclcic .\ads Res. 21: 464-4648. Schober. G. 1'19 1. Fung in carpcung and hrnirurc dust. .iUcrg'- 46: 630-643. Schcirilm. G., l[cunscl, O., Tietz, IL!., .\leycr, K..,Griser, Y, Tausch, 1.. Prcsbcr, W.. .inJ .\fitchcil. -1-.G.1'103. tdennficanon o i ~ l i n i c dstrauis of C~n(i?ih~ibicunsby DS-\hgerpmnng wth polymrmse r h m reacnon. Mycoses 36: 1'1 - 1'9. Schlebekcr. J.T. 1960. The world metropotis and the tristory of .imencm agncuirure. J. Econom. Hist. IO: lY--108.

Scott. /.,\., Stnus, S-4. and N'ong, B. 1999a. Heteroduplru hgerpnnttng of Pcnt"ti(ium bn~rbvmpd'tum from house dusr. In Bio(~em~-olj. Fungt crnd .\@vto,uirr. EE. Joh;uuiing (Ed.). Proceedhgs of the k d Intemauond Conference on Fun% 1 l ~ c o t o m and s Bioaerosols. Samoga Lpnngs, Sew York- Seprember 23-25. 1998. .11bmy, S e w York: Eastern New York Occupaaond and Entuonmental H d t h Center. pp 335-342. Scorr, !.,\.. Stnus, S.,\,md .\Lalloch, D. 1999b. l l o l e d a r genenc chamctenzauon ofr~btli?m P m d f m z ihpo~ennmfrom mdoor eniuonrnents. (-Abstnct h[OS5.6) 9h Congress of the internauond L'mon of .\Licrobtolo~cdSoaeues. Sydney, ,\usrralia, ,\ugusr 16-70, 1999.

S c o q R 1968. Blue veined cheese. Proc Biodiem. 3: 11. Seifen, Li. and Frima& J.C. 7000. Ptni~i/dmon wood producrs. pp. 285-298 In Intqrution q'.Clodm TLYORO~H~~ .Cfrthodrjar Peniti/kum md ,-t-pnml. [email protected] L\. Srunson md J -1. Pi K (eds). &nsterdm: H w o o d ;\cademic Publishers. S e l y n , S. 1980. The hscovery iuid rvoluaon o i pcni&s uid qclospoms. In The Befu-h~-rm .-lnribioh~PtniLiihj dnd C~phulOJPon'm in Prnpr~?z~v. 5. Selwyn (Ed.). pp 1 - 3 5 London: Hodder and Strmghton. Sheffield, \'.C., Beck,!.S. iind Sronc, E.11. 1092. .\ sunple md efficient rncrhod for amchmenr of A 4)-base p;iir GC-nch sequence to PCR-mptitied DN,\. Biofeedbrick 12: 386-38'. . Sandsrrorn. D.W. .ind Sronc. Fi.)[. 10'13. The w w i n \ l r o t ~inslc~str:tnd Sheffield. \'.C.. Btxk,!.cj., K ~ x e k .LE.. c o n f o m ~ n o npolymorphism .in;ilysrs for the citlrccnon of single-base .;uLsuniuons. Genormcs 16: 375-332. Sheffield, \'.C.. Cox, D.R., Lcrman, L.S. md Myers, R.11. 1080. .irtachrnenr ofii 40-base-pur G i C - r i c h sequencc (CC-clmp) ro gcnormc DI;.\ fragments by the polynemse chrun reacnon results tn unprovcd detecnon of smyle-base chmges. Proc. Sad. :\cad. Sn. CS:\ 86: 3 2 - 3 6 . Sherman, 1-1. and D. hktksamcr. 1964. Skm test reacuons to mold scnsruvc prinenrs ui rcl;ition to prcscnce of motds ui thcir homes. S e w York Stare 1. l[ed. 64: 333-2535. Shelds. G.F. m d Straus, S..\.10'5. D S .\-LIS.\ hybndrlinon studrcs of bittis. Evolunon 29: 159-166.

Sinha, R.S., J.E.1I.H. v-m Bronsm~jkand ti.,\.ti. K.;illacc. 10-0. FIouse dust mires .ind their fungl ;issocianons. Cm. hfcd. .issoc. J. 103: 300-30 1. jkoubor. P., Fnsvad, J.C., T;iylor, J.W.. L~untscn,D., Boysen. 11. .ind Rosscn. L. 1900. Phylogcnenc anaiysis of nucltioude scquenccs from thc ITS ccgion of tcrvernullatc Ptn~~ihrn specrcs. ,\[!col. Rcs. 103: 3'3 881.

Slater, C. 199'. G e n e d .\forors ad the demise of streetcars. Transportauon Quarterly 31: 45-66. Smrth, i'., Srreifel, .\., Rhme. F.S. and !uni, B. 1088. Ported plant b g d spores shcdduig (-1bstr.i. .\m. .\lecttn~ Amer. Soc. .\licrobiol. p. 4 14.

Srnouse, P.E. m d Chetdon. C. 1998. .\ndyncd aspects of popdanon-speutic DI;.\ h g c r p m m g for uirlJv~duds. J. Hered. 39: 1-13-150. Sohn, L.-1..Rothfels. L k f . md Suaus, Su\. 19'3. D';;i:DS-\ 3: 3-85

- --

hybndrzauon snrdtes in black t h . J. ltolec. Evoi.

SOU, D.R. 2000. The ins md ours of DS,\tïngerpruitmg the mfecnous h g . Ch.1[icrobiol. Rev. 13: 332-3-1). Sormson, K.G.. D.G. Frazer, B.B. J k s ,J. Simpson md !'.A Robmson. 198". Trichothecent: rnycoroxms m aerosolized conidia of ii't~1clgdmtg.r rltra- .ippl. Environ. Mcrobiol. 53: 12-0- 13-5-

Soto, D. and Sukumrir, S. 1991. Impcoved detecrion of murations in the p53 gene human m o r s as single-smded confomanon polymorphisms and double-suanded hereroduplev DN-4. PCR llethods -4ppl. 2: 96-08. Sprnardl, L., .\laz;lrs, R. and ? ' h d e t , C- 199 1- Prorocols for an improved detecnon 06 pomt mutauons by SSCP. 5ucleic -4ads Rcs. 19: U309. Stetzenbach, L., Buttner, M.and Cruz-Perez. P. 1999. Funpl spores aerosoliseci from contamated tloomg m a t e d s . (;\bstr $243). . h e u c m Industnd 1Iygiene .\ssociauon Contérence, Toronto, Ontano, f une 5- 1 1, 1999. Storzky, G . m d S. Schcnck. 19'6. \'oIaulc orgünic cornpaunds m d mcroorg*msms.CRC Cnucal Rev. 1ticrobiol. 4: 333-382.

Smçhm. L3.P. 1088. Damp houstng and c i d d h o d ~sthma:n i d a n o n (if rcporurig ymptoms. Bnr. '\[cd.!. 2)': 123-1226. Str~chan.D.P., B. Fi;uuug;rn, E.lL l l c C d ~ cand F. .\IcGarry. 11)00. Quanuficaaon of urborne moulds m the homes of chddren with md u ~ t h o uwheeze. t 'fhom.: 382-38'. Strardus, L\., Orban, Z., Burns, -1.L.. \'oncro. -1...\litstrides, CS.. .\I;ir?

. -- -. . . -

-T.?

22.

& 2.

* c

- A *

11.3 3.'

.- -

-3.

1.4 1.4

- . .33.2 9 -

7

b.

3.2 -.C

- 2.3 . - 2. . -- .3

- L .

F

J.E

1'. 3

2.4 3.5 3.0

3. O

-

*

&.A

1.3 d i & 7

.* . S-

-- . -.

3.0 4.3

- -

,

349

61 O 2.3

A

1.5

..

L8 1

96 62 139

13 10 155

d

. _Y -

2-4 296 221

35c

.C

.

'1

..

. . . a

-

+

, O

3.4 3.2

35i3

3.2

LOS 120 342 3C1 338 id0

4.3 6. J Y -5 1. 4 T.3

a

272 352

L.L

44

311

i4

59

-

+

', 1

O

'0 RB

u

229

243 256

3.4 3 4

338

24û 19

2

235 41 34-

2.2 2.O

?El7 22

7

O

,*,

2.0 7.4 44.3

-i . 3.,.L-

5.2

Taxon A PENIAURA ZENIAURA ?ENIAüRA PENIAURA PENL4URA PENIAURA 2FNïAURA ?ENZAURA PLNIAURA JENIAURA ?EN IAUXA. ?Et.I:AUm 2 2 1T.YüR.4 ? Z>I 1AÜ?..4

?E?IIAL'M ?ENI.YJM

?ENZAUW FENIAURA PENIAURA 3FNZUJR.4 LINIAURA LFNïAUEW PFNIAURA ?EN IAURA ?ENIAUEW PEN I A U M ?ENZR;1RA -' *rwI=A - ** ?TV FEN iAü3A

-

?EXIAtiW

?FNIAu'RA ?EN I A C M ?SN I 3 R Z V ?ZNIBRIV ?LN 1BREV ?5NI3REV ?ENZaREV ?ENI3RtV ?5Ni9REV LENIaREV SSNIBRIV 3ENT3RFV PEN I S R F J 3ENIBREV 3ENIlREYJ 3ENILRE'J ?FNI3REyJ 3ENISRE'I ?ENISREtJ ?ENIBREYJ ?EN13REtJ PEN I 3 R E V ?FNISRE1J ?ENIBRETJ PEN IBREV PSNIaREV

CINIBREV FENIBREV PZNIBREV ?EN13REYJ 2ENIIREV SENIEREV

# Taxon B 3 3 ACRESP 33 X T c A L T E 33 U T E S P 33 PSPZCAND 33 ASPEF'UMI 33 A S P E G U U 3 3 ASPFNIGE 3 3 ASPECCUR 3 3 ASPFCRYS 3 3 ASPESF 3 3 ASPlSY30 3 3 >-SPE;'STK 3 3 -4s 2E'/E 3.s 33 . r \ U R E ? Y i L 33 Z W E G i Z E 3 3 CHRSPYSP 3 3 CLADC'LAD 2 3 CLADHERS 3 3 C'JDSP 3 3 CXDSPYA 3 3 CONISP

#

33 33 33 33 33 33

2 NEG 2 3 NEC 2 4 ?CS 25 LOS 2 6 ?IEG L NEG

--

22

33 33 33 !3 34 34 34 34 34 34 3.1 34 34 34 34 34 34 34 34 34 34 34 34 34 34 34 24 34 34 34 34 34 34

SYERNZX EPICNIGR E'JROHZXB TSAOX'LtS FÜSASF GECE?P.=AVEI YCCÜPLJM 'IUCORACE 3MC3P PAEC'/.UI ?ENZATM AC?.LS? ALTEPLTE ALTZS? AS?FCAiD ASPENMI AS?CGLAü ASPLNIGE ASPECCXR ASPEGRYZ ASPES? ASXÇYDO

AS?EUSTL ASSEVERS AüRE?ULL CWGLOB

CHRSPMS? CtJDCTAC C7LACF!ERB CXDSP CUDSPXA

C3NIÇP ENERNIDU EPICNIGR EUROHERB ?üSACX7iS FIJSASP GEOMP.WEI

MUCOPLUM XUCORACI

3 4 ?.UCS P

L

CORR ?OS

2 3

NEG NEG

4

?OS

5

?QS

7

?OS ?OS

a a

30s

5 LJ 11 12 13 :4 15

NEG FOS

?CS NLG YEG

LiEG

-0

,

?CS ?CS

1'

NEC

:a

NEG

L9 NEG 20 NEG 21 NEG

9

-

2 3 ?CS 2 4 305 30 YEG 9.

3 I ?OS 3 2 ?OS

1

LIEY

2 3

NEG

4

NEG

5

SEG

6

LJEG

7

?OS

3 3 13 11 12

. -2 i

14 15 16 17 L8 15 20 21 22 23 24

?CS

30s

NEG

SOS XEG NEG ?OS FOC

-0s NEG

?os NEG ?OS ?CS NEG

NEG ?OS ?OS 2 5 ?OS 2 6 ?OS 27 NEG 2 9 ?OS 2 3 ?OS 30 FOS

A+B4i

A-B+

22

A-B-

303

C(A+B+l 3.0

Taxon A PENIaREV

# 34 34 34

Taxon B PAECVMI 2ENIATRA PENIAURA

35 ACRESP 3 5 .UTFALTE 35 . U T E S " 3 5 ASFFCAND 35 ASLFrljMI 35 ASPEGLAU 3 5 AS?ENIGC 3 5 XSPFCCUR 3 5 .L5FE3R?Z :G AS3ESF

--

d,

2;

>+$?f$'{ZO

1 5 AS?ES'STI: 35 35 35 35

AS?S'JERS >.URE?ULL

# CORR 3 1 ?OS NEC FOS

?OS NEG

NEG ?OS ?OS ?OS ?OC

NLG 20s 30s NEC ?OS ?OS

20s

CHAEGLOB

FOS

SHRSCMS?

?O 5

2 5 C'ADCWD 3 5 CTLJ.DHERB

?OS

--

NEG "CS

3 5 C'LADSP 2 3 CLADS?!!! 3 5 CONISP 3 5 ZMERNI3ti 3 3 EPICNIGa 3 5 EURGEtRa 3 5 F'GSAGALS 3 5 FUSASP 3 5 ZEOKPAiiN 3 5 HUCYPLLJM 25 YUCORACE 35 3 E C S 3 3 5 ?AZCVAiiI 35 ?ENIATU 3 5 ?", NIAURA 3 5 ? E N I SREV 39 ACRESP 3 6 ALTEALTE 36 XTESP 39 ASPECAÀD 36 AS?!ZEUMI 36 A S P F G U U 36 ASPFNLGZ 3 6 AÇP5OCXR 3 6 ASPLORYZ 3 6 ASPESC 3 6 ASPEÇYDO 3 6 ASLEUSTU 36 ASPEVERS 36 AUREPULL 36 C . W G i O E

3 6 C.YRS?!YSP 36 36 36 j6 36

ZTADC'LAD CTLADHERB CLADSP CLADSPFA

ZQNISP

36 ZMERNIDti 36 S P I C N I G R 16 ZURCHERE 3 6 FüSAOX?S

?O3

33s 20s

NFG ?OS ?CS !JCG 20s

zr)c NCG

NtG ?CC ?OS

YEG NEG

YEG

?OS ?OS !ES

ros NEG ?OS ?OS NEG NEC YtG NEG XEG

?CS ?OS 70s FOS

NEG ?OS 70s NEG

?OS NEG 30s

?OS

A+B+

A+B-

A-B+

A-B-

C (A+B+I

D nnn

Taxon A PENICOMM

#

Taxon B 36 ~ S A S P

# CORR 2 6 NEG ?OS NEG NEG 30s

NEG POS ?CC

-0s NEG

NEG !lEG

NEG NZG YEG

NEG BOS

?OS NEG ?CS NEG NEG ?OS ?OS NEG NEG ?CS XEG 30s

?OS NEC

?ES ?OS ?OS

?OS YEG

20s ?OS YEG ?OS ?iEG

YEG NEG

LOS ?OS NEG

?OS NEG ?OS NEG ?OS ?OS

20s

NEG ?OS O S YES NEG

NEC NEG XZG

?OS

A+B+

12

A+Ba2

A-B+ 47

A-0-

22a

EïA+B+I 15.0

2 1.32

D

0.251

Taxon A lFNICORY PENICORY ?SNICORY PENICORY ?ENICORY FENICORY FEXICORY ?ENICSP.Y E'ENICORY ?ENICORY ENICORY ZENICORY 1ZNIC3RY ?n::SRY .=ZN - ICOR'!' FENIC3RY TENICORY ?ENICORY 3ENZCORY ?ENICORY ?ENICORY ZINICRUS ?FNICRUS ?ENICRUÇ 3ENICRUS ?FNLCRUI

?ZNICRUS

..rL.i~-nü~ ?ENICRUS XSNCRCS ?ENICRUS PINICRUS ?EX TCRUS FENICRUS PENILRUS ?INICRL'Ç ?=NICRUS ?FNICWS ?ENICRt'S ?EN4C3US ?=NICRUS >ENICRUS ?ENICRU5 ?EN IC2u'S ?EN I C R U S E N I C3US IFNICRL'S ?ENICRL'S ?=NICRUS ?ENIC4US ?SNICRUS ?ENZCRUS JENICRUS 3FNICRUS CENICRUS LEN:CRüs ?ENICRUS EIENIC3US PEFNCRUS FFNICTNG FENICTNG FENICTNG

GCCP.IP.WN

# CORR 17 NEG 18 XEG 1 9 POS 20 2 0 s 2 1 ?OS 22 ?OS 23 ?OS 24 ?OS 25 0 0 s 2 6 ?CS 27 > C S

IrILjCOFiüM

18 ?OS

YCCV~.CZ FECSP

-Y

# Taxon 8 38 C L P - D C U D 38 CWDHCRB 38 CLADSP 38 C'iA0SPH.A 38 C O N I S ? 38 EMEilNIDU 3 8 FPICNIGR 38 Z U R O H I R S

38 39 38 39 39 38 38 35 38 39 38

38 3a

34 39 39 39 24 39 33 34

34 39 34 35 35

EUSAOXYS

FUSASP

?.EC'IARI ?ENZATW ?ZNIAtTW ?ENISREV ?FNICilRY ?CNICOMM ?ENICOPR ACRES? ALTEALTE AiTESP ASFFCAND ASPEFL'MI AS?5GLALl ;IS>tNIGL ASPEOCUR ASPICRYZ ASPESP ASP1SqiDO ASEUSTU AS EEVEaS AUREPULL CWEGLCB

2; 33 39 CHRSPMSP

3 9 (JZ3C'LAD 3 4 CS4DHFRB 39 CLADSP 3 5 CTLiiDSPtW 39 CONISP 39 ZME2NIDU 3 5 SFICNIGR 39 ZUROHLRB 39 WSAOXYS 39 F U S A S P 39 1GECMPANN 3 9 tlUC0PL;IM 39 YUCORACF 39 ? * X C S ? 39 PAEClARI 39 ? E N I A T U 3 4 ?EN IXÜRA 39 XNNXBREV 34 ?FNICXRY 39 ? E N I C C m 34 ?EENICOPR 3 5 ?FNICORY 40 ACEltS? 40 .U.TFALTE 4 0 ?.LTFS?

T

-

A-B+

A-B-

C

x'

(A+B+I

1.07 7

3.09 5.~35

3-33 2.13

1-63 .3.15 1. 0 4 3 . ::

.- . O--

?es

3C NEC. 3 1 ?CS 32 ?OS 33 O C 3 4 ?OS 35 ?OS 3 6 NEG 37 ?OS 1 ?OS 2 ?OS

3 4 5

LI 12 -

-2

14 : t -

16 NEG . ' NEG :3 NEG :3 ?os 20 ?9S ? : ,?OS 2:

?OS 23 ?OS 24 ?OS 2 5 ?OS 2 6 NEG 27 NEG 2 9 YEG 2 4 ?OS 30 ?OS 3; ?OS 32 ?OS 3 3 ?OS 3 4 XEG 35 ?OS 3 6 ?OS 37 NEG

38 POS t 70s 2 ?OS 3 YEG

I

*

LL

3.;5

2.22 3.::

3.29 3.34 2.54 2.3:

2.L3 2 . -7 3-24 7 7

J

--

. -29

J .

?CS

?OS NEG ?CS NEG 30s ?OS ?IEG ?OS

-

-z . 7

?OS 20s

3 3

t

:.14

-- . -

NEG NEG

6 7 ?

- y

.L*

3 . CIO 2.15

20

1.29

-

-.,A

' 1

2-26 1.36 1.2:

-2 . J*C. M

.

i -

-; -7"& 4 .

-

1

L .

-- g-

1.36 1-34 3 . 30 1.45

;.34 3.04 3.30

3.4a 4.39 3.30

-

L .

2.

.-

-: '" a

3.130

-

5.31 . ?

' J . AU

3.38 7.22

:-23 1.32 1-46 2.L3 3.36 5.24

2.34 2-74

Taxon A PENICTNG PENICTNG PFNICTNG PENICTNG ? E N I CTNG PENICTNG ?ENICTNG PEN ICTNG PENICTNG PLNICTNG ?FNICTNG ?ENICT'IG ?ENICTNCPFNICTNG ?EN 1 CTXG 3ZNICLNG ?ENICTNG ?ENICTNG ?FNICTNG YENFCTNG sFN-r'PvG PFNICTNG ?FNZCTNG PFNICNG ?FNICTNG 3LNICTNG ?FXICT!tG ?E>IZ Z ? 1 G PFPIICTNG FNICTNG PENICTNG ?ENICT?IG ?ENICTNG LCNICTNG ?ENICTNG ?ENICTNG ?ENICTW PENICTW. 3ENICTW ?FNICTN PLNICTW PSNICTRM 2ENICTW PFNICTRM ?FNICTF(M PFNILTW. ?ENICTRM 3FNICTW PFNICTW lFNTCTRM PlNICTRM 3ENICTW

a.-

* - A .

?ENICTEZM

ZENICTM ENICTRM PENICTW ?FNICTW PZNIC'XM PENICTRM PENICTW ?LNICTRM ?LNICTW

# 40 30 40 40 40 40 40 40 40 4G 4C

Taxon B ASPFCAND

ASPLFUMI ASPEGLAU ASPENIGE ASPEOC2R AS?ZORYZ ASPLS? ASPESY30 ASPEUSTU .l.S?EVERS ..tiREPULL 413 ZLiACGLCE 4 G fURS?MSP 412 Y X U C L A S

40 : x a t m a 4 3 ZL3r.DIP 4 0 CLADSEFA

40 40 40 40 40 40 40

40 40 40 43 40 40 40

40 40 40 40 40 41 4I 41 41 4:

41 41 41

41 41 41 4 1

41

CQNISP EXERNIDU ZFIZNIGR CUROHERB LJSAOX'iS "SAS? SCCMPANN XJC3PLIJM XiCC)RACE 3ASCÇP ?AZC1JARl IENXTFW ?CNIAüiW FENI3RFV ?CNICRRY ?EN:COm

31NïC3P9 BENICGRY ?FNICWa ACXS? ALTEALTE

ALTES? ASPECAND .4S?EFüMI ASPEGUü ASPENIGE ASPEOCHR ASPEORYZ AS?ESP ASFLS'IDO ASEUSTU ASPEVERS

4 1 AURE?ULL 4 1 C3AEGLO3 4 1 CHRSLPlS2 41 C'JDCLAD 4: C'ADHERB 4 1 CTLADSP 4 1 CXDSPW 4 1 CONIS? 41 ZMERNIDU 4 1 EPICNIGR 4 i Z'JROHERB 4L U S A O X Y S 4 1 =SAS?

#

CORR

4 5 6

NEG

POS NEG 7 NEG a NEG 4 NEG 10 ?OS

1L COS 12 N t G 1 3 ?OS 1 4 XEG L5 'IEG

Io

.

?CS

-7

YEG 1 3 NCG L3 ?OS 2 0 ?CS 2 1 ?CS 2 2 ?OS 23 NEG 2 4 ?OS

--

L:

?OS

2 6 XEG 27 ? o s 28 NEG 2 9 LOS 30 ?QS 3 1 EOS 32 NEG 3 3 NEG 3 4 ?OS 3 5 NEG 36 ? C I 37 fGS 38 ?OS 3 9 ?OS 1 YEG 2 ?OS 3 2C)S 4

O

?CS ?CC ?OS

7

?OS

9

?OS NEG

5

3

r 0 ?OS 1 1 ?OS 1 2 ?CS 1 3 ?OS 14 NEG 15 NEG 1 6 ?CS 1 7 NEG

ra

NEG

13

?CS

20 FOS 2 1 NEG 22 NEG 23 NEG 2 4 PCS 2 5 NEG

26 ?OS

A+B+

A+B-

1

33

A-B+ 19

A-B317

C (A+B+)

1.3

-9 L.04

D

0.308 3-02? O. 1 9 6 i3.07:

2.603

i3.12: 1-54: 3,358 3.053 3 . L24 S. 323

-. J

- 7 -

Ou'

1. :4: - :-* 9- .

-. .. - . J. -2c

1.446 3.34: 2-63? 2 . sao 3 . '4'J 1.3CO

3.623 3.343 * J .

.--

-3

1. 3 1 3 j . ;-'-

1.329

:. : c c

3 . L?: 7 . -64 1.362 2.264

2 . ::2 3-32: 2 . 362 3.254 1.543 3. 3 4 1

---

J.22J

3.213 :. J O 3 1 ' J .

1 7 *

J ' r ;

hl. 386 J * :cc 3.451 7.424

3-64' . 3 . 320 *3.-51 S. 3 0 1 3.;54 '3.232 13.

O:?

J . 543 3-32; 9.341 1.575 3.4433 3 . -129 3.':: 3.383 3.323

# 27 28 29

CORR POS

002

NEC 10s

?OS

a ;

!1ZG

234

?OS

3L3 214 2 4

20s

?IEG NEC. ?OS

l

NEG YEG NEG tICG ?OS NEG

a

?os

4

NEG

4 5

O

10 ?OS

IL !ICG IL 'IEG :3

C(A+B+I 1. 7 258 19.3 309

245 310 275 3i2 275 245

POS NEG 31 3 0 s 32 3 0 s

30

33 34 35 36 37 39 35 4.2 1 Z 3

A-B-

?OS

YEG 15 tIEG 1 6 NEC

.

1 -- - -.-. ,

d

324 7 7 '

-

-- d7e

1

-

-..eu

-. 4.; . . -.a

-. . . - -

, cl ?

-.

a

A.

A.&

- -

9.2 d 4

,

.

:

7 J . d

-

*

4 .a

L . -1

l

.-,,CIO

7

k

L6.3 2.2

- m -

.

-

:. -1 .- -

229 29: 34 1 2:3C5

. . t . 6

1

-

,b.

.- . . A

- - . A

22*-,. 2 2 0

.-,? .i

La

2 4 ?OS 2 5 !EG 6 ?OS

2

1

:L

-

La.

- - 7

2i3 ?OS 22 NEG 2 3 ?OS

0.2

Li.:

320

265 3-

2 1 NEG

- . a 7

L

f r

,

-

;

- 4

.

-,-

F

13 r NtG

.

t

- ?

,-i

?CjS ?OS

-.-.. -.

;1

. A

L 7

-

12.e

-.-

3 4 13 3.113 .

y

-

-03

:2 0

-. -. .

4 4 -

256

.-

S.'.

-2 . 2-

J .

4.3

. -. - +

a.

-

d

4

1.5 3.5 ' n

1

. - . O.

- d m -

-L

' *.

7 d

-2 . 7

J

NEG

339

3.0

2 3 NEG

273

2 30

?OS ?QS 3 1 30s 12 NEG 3 3 ?OS

265

3. 4.

3 4 ?CS 3 5 NEG 36 ?OS 37 2 0 s 3 8 ?OC

264 Loi3 262 342 250

?OS 4 0 ?OC 4 1 NEG

320 3 0O

27

34

r

70s

2

?OS NEG O S

1 4

5 O

NEG

7

NEC-

?CS

a

-

343

'3 . 4

304

,.O

341

3.5 2.3

309

i70

d 4

-2 3- 5

42 343

34 1 334 336 236

-

-

4.4 3.3

4.3 3.5 5.0 3.:

-." - ;i

7

L .

3.

-

-

3. ? '3 4 s3 5 O. 7 2.4 1 3

. . .

Taxon A

PENIDIGI

#

Taxon B 43 ASPFOCKR

#

COR.

8

POS

4 3 ASPEORYZ 4 3 ASPCSP 43 ASPESYDO 4 3 ASPIUSTU 4 3 ASPIVERS 4 3 ?.UREPULL 4 3 C-5AEGLO8 4 3 CHRSPMSP 4 3 C'LADCLAD 4 3 CU-DHERS 43 ZXDSP 43 ~3'22S3?!. 4 3 \ZgNISt 4 3 SNE3NI2ü 4 3 Si?TCNIGR 4 3 SUFIOtiEaB 4 3 FUSAOAYS 4 3 ETSAS? 4 3 GEOMPANN 4 3 !+t'COPL;IM 4 3 CIL'CORACF 4 3 ?KCS 3 4 3 ?KC71.W; 4 3 ?FNIATIW 4 3 ?EN I A ü M 4 3 ?CNIJREII 4 3 ?SN 1E3Il.f 4 3 ?ENISCPM 43 3 L N I C O P 3 4 3 ?ENICGR? 4 3 ?ENICR';U" 4 3 ?EX ICTNG 4 3 ?ENICTrn 43 X N I D E C 5 4 4 ACRES? 4 4 ALTEALTE 4.1 ALTES? 4 4 AS?ECAND 4 4 AS2FFu'MI 4 4 ASFFGrLAü 4 4 ASPENICC 4 4 XS3EOCHR 4 4 AS?EORYZ 4 4 AÇ3LSP 4 4 ASLISYDO 4 4 ASPE'JSTIi' 4 4 AÇFEVERS 4 4 XL'RECL'LL, 44 CYXGLCB 4 4 tCEXS?MÇ? 4 4 C'YA2CrAD 4 4 CLÙiDkiERB 4 4 ZTLADSP 4 4 CTADS??J\ 4 4 'ZONIS? 43 3 E R N I D U 4 4 E?ICXIG2 4 4 EUROHERS 4 4 rnSAOXYS 44 XSASP 4 4 GECMPANN

9 NEG 1 5 NEG

II NEG 12 ?OS 1 3 ?OS 1 4 ?OS r5 'IEG

16 NEG 17

30s

:a

20s ?CS

:3

3 s -. ?IES -- ?IEG L!:

, , 7

23 NES 24

NEG

25 NEG 26 ?:EG 2 NZG 2 9 ?OS 2 4 ?OS 30 ?IEG * 2 ?OS 32 NEC3 3 'IEG 3 4 ?CS

-

&

i, C , NEG 3 6 SEG

37

zgs

3a NEG 39 4C 4I 42

1 L 3 4

NEG

?OS YEG NEG YEG 20s YEG

?CS

5 5

NEG

NZG ?OS

3

?OS NEG

3 O;

3C)s

LI NEG

-

L2 ?OS

*

?OS 1 4 ?OS 1 s ?OS 1 6 ?CS -2

- 7

,

re

?OS NEG

19 C S 20 ?OS 2 1 NEG 22 :JEG

2 3 NEG 2 4 NEG 2 5 NEG Z 6 ?OS

27 NEG

A+B+

A+B-

2

9

A-B+ A-B70 299

C (A+B+)

2.0

D

0.11

2.710

Taxon A ?INIGLZlN

# 46 46 46 46 46

46 46 46 4O 46 46 46 40 36 46 46 46 40 46 46 40 46 46

46 46 46

46 46 46 46 46 46 46 4a 46 46

Taxon B ALTESP ASPECAND ASPFFUMI ASPEGLAU ASPENIGC ASIFOCHR ASPEORYZ

# 3 4

CORR

5 O 7

a 3

NEG POS NEG POS NEG NEG NEG NEG

A-B+

13

16

A-B340

2

CïA+B+I 0.6 0.0.3 0.3 4.: 2.5 3.3 2.4

2.17

:O

ASIECY30

, ,

,.O

ASPEUST'J

12 ?IEG - 2 NEG :4 NES

.-

4.5

ASLEVERS AURE?rJLL "GZGLZE 738S?MMC? ZL;I.CCXZ ~Z'JDHtii9 ZLADS? C'ACS??A CQNISP FMERNIDU ZPICNiGEt S'J'?.CHERB ?J,CACXYS FVSASP GECMP.4iiN YL'C3PLüM YUC3RACE ?AKS? ?XC'/AII I ?FNIATU ?EN I X K A ?ENï%EV 3FEIICXR'I ?FNLCI;?li'i' ?ZNIC3PR ?ENICGR? FENZC4US ?EN ICTNG

. , ?CS

.-

-2 :fj

?CS

:' NEC

.:3-

NEG NEC fO NEG 2 1 NEG 2 2 NEG 23 ?OS O S :4 2 5 NEG 2 6 YEG 27 NEG 2 9 NEG 2'3 NEG j C NEG - Y

?

>

-

O. 3 12.2 -?

.-

9

J .

- -

. -.

O. 2 d

*

2.3 5.3 S. 4 4 L I .

-.

- -.

3.0

- .-.-

'a 7

L *

3.4 2.6 7

7

4 . L


JEG

20s

-,

7 - .

J . ,

2.345

.. - . -

-

J .

r

-

A

.

-i

-p.-

7bO

.-,. -" - a -

2-

J .

1. ?CE ?

;î-

J . d d

2.3:::

. -J .

- . n

-2

* - -

* J . AL.;

-, J i

- y -

~

O

?OS

3 . Li3 329

33s

:.,;O

FOS

?

NEG

;.-2E !.4;38

YEG

20s

NEG O C ?OS ?OS 30s

?OS ?OS ?OS

NEG 20s

NEG 3C)S ?OS

41EG

L

;. J .

?CL:

1. ::-

> .123 -, -.-. -,- .-- 22- 0-2.

3.100 3 -435 2.624 ;. 3 4 7 2. L3L 3 .-O4 3.275 3.3C4 2.32'3 2.134

Taxon A ?ENIMIS

Taxon B 5 4 ?ENfiSiA

#

# 44 50 51 52 53

CORR NEG NEG 00s NEG ?OS

L

?OS

2 3 4 5

NEG

NEG ?CS iItG ?IEG

-O

NEG Fr,$

2

3 ?rs 11; NEG :1 !IEG 1 2 ?OS 1 3 ?CS 1 4 ?ILG 1 5 !IEG L6 NZG ?CS :3 YEG :9 !lEG 2C X G c , SEG 2 2 ?IEG

-

- 1

-

2 3 SEY 2 4 ?OS 2 5 NEC

--

L O

?CS

z7

NEG 7 5 1GÇ

-

;"QS 3 0 NEG

-. 2

2'2s

32

?IEY 33 YEG 34 305

-

23

?3s

36 37

NEG

? .

NEG

!c^ 3 s 3 3 NEG 4û ?ris 4 ; ?OS 42 SEG

4 3 SEG 4 4 XEG 45 NEG 46 NEC 47 NEG 4 8 ?CS 4 3 ?OS 50 NEG 5 1 ?CS 52 NEG 53 YEG 54 ?IEG

I

NEG

2 3

?OS ?OS

A+B+

A+B-

--

A-B+

..

A-B-

332

E (A+B+I 3.3

If

2-33

O

Taxon A

PENISIMP

#

Taxon B 56 AS?ECAND

#

CORR

4

NEG ?IEG ?OS ?CS ?OS ?OS ?OS ?OS ?OS ?OS

NEG NEG ?CS 3'2s ?CS NEZ ?OS ?CS

?CS ?OS ?OS

?CS ?OS ?OS ?CS

?CS 32s

201 ?OS

?OS 30s

YES ?CS ?CS

?CS ?CS XEG

NEG NECNEG NEC ?CS ?CI

?CS

xs !ES NEG ?CS

?OC 20s

39s ?'2 S

!IE G

?OS ?CS

?ISG

?OS YEG ?GS ?CS 'JEG 20s

A+B+

1

A+BA-B+ A-BC (A+B+I 14 18 331 1.a

X*! (3.30

D

0.594

-

#

CORR

il

?OS

1 2 ?OS 13 30s I: 30s 15 19s

.L -I

L 6 ?OS 30s

.-L35- NEG ?OS 2C NEG 71 N E G 7

-

-,1

-L

: - 4-

-

, , , .-

?CC ?IES ?lES Zr--

27

II 5 27 27

14 3d 7

L

22 -? -'

-

i

77

L L

1-8 263

--'--

. O': -. 3 i L ' I

-

7

.- .- -. -. -d

9

., Z -r , ?

-- -- -, -0

=- =. -?

3iS 30s 3 1 ?OS

---

fa

2i

32s

23

7

22

?QS

LL:

34

?OS

37 76

-

P

-- E S 2 0 ?CS *

-

:

- --

* 4

d

NEG 7r;~ ?CS

=

--

-

.,O

29

-

1

L .

4;: ?OS 4: ?CS 4; YtS 4 3 YEG 4 4 20s

t6

4 5 ?CC

*

46 47

43

YES 3C_S ?CS NFG

43 3 0 >IEG

-- ,, . NFS ,

-Z .L

-, ,-

2'35 30s

54

55

'30s ?OS

L

3'3s NEG

7

4

-2 02 3

NEG ?CS 33s

4

5

-

0

a

--- ,

#

--- --

L L L

'j

.a *

--

L

L

'f

24

-- --

25 n

-

L 4

c

4- 2

29 26 4.

.L

R 9

.--

,

?:

-.---. 47 .. 1 4

a

a

-7

. -*

62

.- ?

-

..

-

.. -, 75 320

.. -., a -

4

7

2

-.

d

d

.

6.3 = '

. --

-

a

- 0 .

52

--

3 3i l

. . - -

"'

3.;

&-le

3;s

A

jij

3

'2

4

-i

l

t-7

330

=-

*

.

:L

a.

~

---

n

1 3 a - 4

7 ?? d - G

323 77 L 4 d

d

4O 245

i

- . a-

321

. -

323 3 3 - n -

-

5.4

-,m-

-.

&

*

- - A

3

.

-. 4.: .- .-.... ?-

&Li

24-

J

-.4 3.3 -

- G $

..

*. . .4.2-. . -.-- .7 d

d

3

.

? 4.

-

'.#>- -3

. . ;. .> 3.4 CI.5 . 3 .6 - . ,.C

?

d . C

L

24 3 326 l36 2413 2Fl9

Y

22L

.i t.L

;.a

.,.-. ;3 .s 4.3

d A

.

-,

..--

-

.oo 44

23

204 310 337

, : PO5 L4 N E G

7

2

124

171

4

298

20s

D

L

Li5 N E G

3

14

>

7

.

J 1 .

-. --

3C3 264

,O NECII ?CS L; ?C)S

rs

-3 . 6-

iidL

d . 44- 4

m L i

70s

--

d.

320 -.-• :--

a

24 L20

-

-

-..-.

C

14

d

-

A.?

.13 .. -. -- -. &

r-

T

L,?

9

3

- . 9

4.

- - a

24

2

.

--~

2

.-

-:,

.--

-

-T.

-2-4

333 2?4

3

-

- 2 . :

*

-l

46

10s 30E

YEG YEG

3

24 24 f9

J . Z

..-

L

-

.

2.3

t

5i

-

1

..

--

P

-rL

-a-- .-.

-4-

64

-

0.3 : 7 d . d

a - -

--

,.. .- . .-

2Y

. --

,.

7

14.5

1-L

329 2-6

' a

d

, d

-

4

-. .-. 22L

24 2C 20

2:

:

-

323 1-6

.- ,-J

2" YEG 2 9 ?OS 2 4 ?QS

.:-3

m

4

2

1

-i

- d . ' L

?

& + - d

- - +

4

7

--

. 1- . 3

;

7

7 iaj ;d -

23

&

7 3 162

2 , '- _ 7; +

n

27

L

NEG

'i

&O

-

A+BA-B+ A-BE (A+B+) 24 41 239 3.0

--

4

.

e

A

C

,7 J

O

-.:.3

.

,-

7.2

-

17CL

. J1. 0

340

L .7I .

d d d

7

d

Taxon A

#

Taxon B

#

CORR

PENISPOL

ja

C-ADC~LAD

~7

YEG NEG 20s ?OS YEG YEG ?OS

18

19 20 21 22 23 2 4 ?OS 2 5 YEG 2 6 NEG L . !IEG

- -.

-'f

6"

-3

?CS

3C 3 1 YES 32 '9s 33 34 35 * : 3' A

5CS XEG

?OS 30s

NEG 36 ?CS

3 5 ?OS 4 3 NEG

4 1 ?CS ?IES 4 3 NCG 42

4 : "CS 4 5 ?CS 4 6 ?CS 4 - ?IEG

4 3 NZG 45

?IEG

50 YEG

Z i ?CS 52 !IES 5 3 NEG 5 4 ?OS , , YEG -

--

;O

TC)C

5 7 YEG

: ?OS

2 3

YEG

4

?CS ?OS

XEG

5

O

LOS

?OS

3 3

NEG NCG 1; ?OS : ?OS r 2 20s * - 2 YEG I 4 ?CS A

.-3

L ?OS I6 ?OS

20s 1 8 NEG

:7

16 ?OS 2 0 NEG 2 1 NEG

A+B-

A+B+ 3

6

A-B+ A-B18s 173

C (A+B+I

4.5

& 1.34

D

3.175

Taxon A PENISP26

# Taxon B 5 9 Z!ERNIDU

# 22 23 24 25 26 27 28 23

CORR ?OS

A+B+

NEG 30s

?CS NEG NEG ?OS ?OS

3 0 !IEG 2 L YEG

-.

32 FOS

33 39s 74 ?QI * + 4 d

4

36

"

25s

F(3S

FOS 38 ?OS

39 NEG 43 ?OS 4 1 ?OS 42 ? C S 4 3 NEG 44

?OS

45 2 0 s 46 20s

BOS 48 FOS 43 NEG 47

50 FOS 5 : ?OS 5 2 ?CS 53 54

-- --

30s ?CG

, , ?OS

--

56 ?CS 2

1

?OS

Sa

zos

1 2 3

YZG NEG

4

3 s

5 O

X G

-

NEG 32s BOS

3

0 s

3

NEG

:O

?OS

11 'IEG 1 2 305 13 NEG L4 NEG

15

3clS

16 BOS L7 XEG

LS NEG 10 20 21 22 23 24 25

30s YEG NEC

XEG YZG

NEG ?OS

A+B3

50

A-B+

A-B7

209

C

IA+B+I 1.4

n' 5.55

D

9.330

#

Taxon B 60 FUSASP

#

2 6 NEG

300

GECMPRW 00 !4UCOPSITM 6 0 YUCORACE 60 ? * ? C S ? 60 ?.4EC7J.9RI

2:

?OS

3-19

L.6 g.3

29 ?OS

288 270

2.0 2.5

7G-

6 S ?EN I A T M

32 POS 33 ?OS

J.2 1.4 3.2

oc

60 64 6O 60

?ENIAURA

TENISRFV ?FNICXRY ?SNIC3MM 93 ?ENTCO?!I i d ?SNI'ZSRY

oc'

'ENTZIUS 6 Lî ?EN 1CTYG GO 63 60 63 6O ii3 CO 60

CORR

29

30 YEG 3 1 ?OS 3 4 NEG 3 5 NEG 3 6 ?OS 37 20s

38

-:Y

E iA+B+)

d d -

311

-

351 7 .,

4

L .

27 4

-

=.

'77 1

*

- -

A . -

-2- -6 3 -

- . C

,.--

- --

-. -. -

246 -.-.-.

J . 2

. -d7I d

T

-r.1 9

?CS

-

L

.L.d 1

-

-.-tt

-

?ENICT%i

-113 ?CS 4: 29.5

?ZNIDECü ?FNIDIGI

42 43

?ENIZCiiI ?ENIZX?A

4 4 ?OS 4 5 NEG 4 6 YEG

200 34 6

47

YEG

336

1 .6

48 49 50 51 52

NEG

340 34b 3 43 240 - 4 -

3.5 1.2 3.3 3.4 2.0

358

J i &

?£NIGiAN ?SN :Ga IS ?SNIIXPL

O O ?ENII3LA 50 ?FNIfTAL 60 ? E N i . I I C Z 50 IENICXPL r n .JW =NI?IiRF 60 3 E N I 3 A i S -r-

5C 3FNI3EST

oc

?ENISIclP CO ?ENISP 30 ?ENZS?Ci oc' ?FNI3?26

01 AC?.ES?

C.

P .

y .

ASf.CVF3S 6 1 AUXEPULL oi F .

XXGLOE -. CHRSFMSP

OL

oi

6:

CLADCLAD

61 61 o* 6:

ZADHERE

ZIADSP fI3rDSPUji '"NISP 61 5iEaNI3ti 6 1 PPICNIGR r a~ EURGHE3S

-

6 1 FUSAOXYS 5 1 FESAS?

6 1 GEOMFANN 6 I Yu'COPLüM

NEG NEG

?OS ?OZ

-

-3

9

Sa

?OS

:JZG

53 ?OS 1 ?IEG

e.

ALTEALTC 6 1 AiTLSt: 5 i ASPECAND O i ASPEWMI a, A S I F G X G 6: A s P Z N Z G E 0: AS?FOCU,S 6 1 AS?EORYZ 5; ASLESP 5 1 ASFFSYDO o - AS1FGSTU

SES NEG

53 NEG 5 4 ?OS 5 5 NEG = c.- ?O5

YEG YEG

O,

?

NEG

A-B-

3

-"CS ?OS

4

5 O

-

3 4 LC

.,. *

?OS 2'3s ?OS

?OS ?OS 39s ?OS

12 1 3 NEG ',4 ?OS 15 ?OS

.,-:

1 6 ?OS ?OS

19 XEG 13 ?CS 20

?OS 2 1 NEG 22

?CS

2 3 NEG 24 303

-

*

1. 4 3.5 3.3

-.- u?

3413 34 9 343

.-1 *. 5. 2 2.1

77;

..1 . -. .

-. -.---

- 4 d

?

-1)

J.L.

A"

34i;

7

---.---.-.

J . 2 J . ?

:2;3

1 d i -1

204

.

2O9

3.0

.

$-1

- -, ---- . -.- .-L

c

,

a

d

+

S . c

. . A

C i . -

L

-5 . t2

L

213

F

-

-

z

5. O

164 130 224

49.5

7 . . a

.- 3- 0/

236 2 15 104

-. d

*

212 17-

Ls-

9-4

,i

163 192 14 3

215 223 39 -,Y

COS

213

26 NEG 27 ?OS 29 ?OS

135 220

25

7

2L

184

1-

e

-

-.. .-4 d .

-

- -.-.

-G

- 4 .

2

I

- 9

3.-

-5.4

.--*L.

-

4 a.-

-

-2 * ,

-..&.i5.4

33.5 24. O 54 .3

-

-

2 - 2

- -( - 1 34.3 . . 7

4.d

i

-.

22. ' 4.6 29.1

#

Taxon B

61 61 61 6i

MUCORACE

61 61 61 61

PAECSP

PAECVARI PEN IATRA 3ENIAURA 3ENI3REV 3ENICXRY LFNICOW.

61 P F N I C O P R *

.

o~

?FNICORY

6 i ?=NICRUS 6 1 ?ENTCSYG 6 - 3EN:cTg.i.M - rzNT3EC'; Q, * 3, 3FNID:GL o , ?ENIECUT O i ?ENIEX?A O L ?ENIGWN 6 1 ?ENZGRIS SL ÇFNTIXFL O L LENIISLA 61 ? F N I I T . U 6 1 ?FNZHICZ 6 i ?LNZOXAL 6 1 ?ENIWRP 6 i ?ENIFAIS 0 L ?EN IREST 5: ?L!:I3":!4?

--

-

-.

F

Y

-

o;

.

?EN:S?

.

6 1 ?5NIS?O L ,-

?EXIZF26 9~ ?EN?SP64 6 2 AC4ESP o,

-.

62 ALTEALTE

62 ALTES2 32 ASCFCAND 62 A S ? E X M I 62 A S I F G ' d U 6 2 AS?ENIGE

6 2 AS2EOCSR 6 2 ASPECRYZ 62 AS?ESP 62 ASPESII9C 62 AS?EUSTU 62 AS?FVERS

5: AUaEPULL 62 C Y X G L O B 62 62 62 02

# 24 30 31

CORR ?OS

32

POS

O

3 3 ?OS 3 4 ?OS 3 5 ?OS

-

4 5 ?OS 40 47 4a

49 50 51 52 53 54

-

5 E 4,

-2 ?OS ?CS S B ?OS 5 5 ?OS 9

1

oi3

?CS

2 3

2'3s NEÛ NEG

:

4

5

02 LICJCORACE

62 ??XCSP

42 78 37

:CO

22 44

'8

LC4

711

-:. 7 7 - -2 .- 2- -

3 rs

. .4

,O

13 n

?

O

za 10 9 4

-

1.35 -7 7 5

q

4

-,-

,LC - & a

LI3 57

d

d

-

.. 4: .-

LX :4 L 132

134 :38

6 4

, A

-

*

,35 130

'35 136 138

4

- a

' 7

:40

,,

-. .

O

4.

- -. 4 .

d

d

* *

L3 ' 1

*

A

I6 d

32

-

:3

... -5 2

d

3% ?OS 305 30s 23 3 0 s 24 ?OS 2 5 SOS 2 6 NEG 2 7 ?CS 2 8 XEG 2 9 NEG 30 PGS

2 1

A

L

2

..

7

.

?

- .-- . -J

- ' 4 .

d

.

4

-

F

7

L - O

9.2

-

-,-

-5'3

-0.0

7::

5.: 2.3

L c -l

214 216

-. .-. d

4.2 4.2 5.4

1.:

- * -

,IL

222

-7 . a=

212

1:3 S

-. . --

2'3.4

333

3.3

L 9

-

-- 7 z d d

.- -.

4

2

3:-

.. .. . A

d

--

Li& ,?

- L W

-" LL4

-.-

a

-

24

332

. ,

2

2 ;

-

.

:a7

.- c

2 3

283 21

-4 336

-. d

r)

176 .? 5 zc

d

L32

4

-

m

3 3 L32

I

- A

A

A

*

7

,?

34 4

1;: - 7 -

i

L

245 225

34G 34s

1o,z

. :. 5

3

L i &

5.3

-1.2-

6.4

3.3 3.5 5. 3

2.3 1

L.,

4.6

.3 3.3

i2

:a

338

6.5 3.3 3.7

5a

203

-.?

I

346 285

3.4 2.4

268 35d

3.3 .3 3

-7 7 4 d

-. -.

. -

4.1

d*&

f

d

2.3 .3 3

45

.

.4

.

L2E

- A

..

d

533 333

14

264

3

-.

d

*

24

w

:O

d

3.5 3.8 3.; 7.3

H

67

. --

. *

- - r L

-"2~

12 3

d

M

, J . CI

262 343

IS

.

40

65

..

d

341

.-

A h + -9

*

A

4

Z36

A &

A

, -

223

* a

.3 -

-. -

-

:

110

5

19 29 22 22

-

5.4

4

h d

4

7

L

s

7

d . d

214

*

?CS NEG

d y

-,.O I .

,,1

, - ?

d 4

13

77

-

SOS ?CS

-. - -7 , ) --.

,

30.2

:28 '

A

:!3

134

33.: -.-

--. --

'

305

(7

3.5 10.3

-,

:i

:4 15

-- -9

3.1 19.3

-&3

:38

1

9

,7. ' ,a

(A+B+I 35.9

7 - m

NEY ?OS

3

114 17û 224 :57

Cl3 223

,O

?OS

224 205 123

3

'ii 7

YEG

195

22G

3

3 4

C

173 221

w

.- --

- 7 4

:3

ra

04

O 32 3

d

-

'L

62 GEOMPANN 62 HUCCPSUM

120

?OS ?CS ?CC !IEG ?OS NEG

r

A-B-

22

2 18

O 7 3 3 ',O :L 12

,O

A-B+

54

?CS

NEC ?OS ?OS 20s

A+B-

LO5 140 124 'L35

NEC

T

C'ADCWD

62 ZIiROHEXB 62 5 S A C X Y S 62 FCSAS?

NEC ?OS ?OS NEG

2O

.

6 2 FMERNIYU 62 Z P I m I S R

NEG

3 6 20s 37 20s 3 8 NEG 3 9 !IEG 4; 20s 1 !IES 4 2 !IEG 4 3 NEG 4 4 YEG

CXRSPMS?

C'XDHERB C'LADS? O2 C T A C S ? Y A 62 CCNISP

XEG

A+B+ 37

L

A

.A

A

--

75

LO

29 7

,* i-3

.

.

Taxon A PENIVARI PENIVAFlI PENIVARI PENIVARI E'ENIVARI ?ENIVARI FEN I V F R I ?=NIVARI ?ENIV?XI ?EN IV.= I ?EN 1VPR I ?SN Z ' I M I ? CCJ I'lAa I 2 EY : .1.;i? 1

-

JFUI:/kqI -* ?ENIVLi: ?SNIVARI

?ZN IVAR1 ?EN 1vA.a:

?EN 171m 1 ?ZNLV?iRI

?ZN I'IAR 1 3ENIVARI ?ENIV.W 1 ?ENIVAR 1 ?ENZVA31 ?SN :VAR Z

?EN zxa : ?EN IV&? 1 ?ENIVA.Etf ?WIVAif

?LNIyIERF FENTVEAR ?EN I1/ERR r z N f 'IFRR 2SNT:ERR ?EN f * E R R ?EN IVERR "FNI"'ERR ?EN IVERR ?ENïVZRR ?ENZYflRR ?EN I I I E R R 3ENIVERP PENIVERR ?EN I V E R R ?ENIVE33 FSNITLRR ?ENITJIRR PEN I V Z R R ?EN W E R R

--

"F,NVt,94

?EN IVERR 2ENIVEF.R F'ENIVERR ?SNIÏfFRZ FEN L E R R PENIVSRA PEMI'ERR 7ENIVIRR

25NIVERR 33NITERR

#

31 32 33 34 35 36 37 38 39 4O 4l

CORR NEG XEG POS O S

?IEG ?OS 20s ?OS ?OS ?OS ?OS

4:

?OS

43 44 45 46

NES

?CS ?OS

NEG 4 7 NEG 4 9 ?OS 43 NEG 50 NEG 5 1 NEG 52 ?OS 5 3 NEG 5 4 ?OS 35 30.5 56 ?OS ?OS -57 ;a 20s 53 NEG c'Cl NEG 51 ? C S 1 K G 2 20s 3 ?OS 4 NEG 5 ?CS 6 ?OS 7 NEG 30s 3 ?OS 1i3 ?OS :1 YEG

-

12 ?OS 13 NEG '4 YEG 1 5 20s 1 6 NEG

L? 2QS L9 NEG 1 4 20s 2C) ?IZG 2 1 'JEG 22 NEG 2 3 ?OS 2 4 NEG 25 ?OS 2 6 XEG 2 7 NEG 29 ?OS 29 NEG 30 NEG 3 1 NEG

A+BA-B+ A-BC(A+B+I 11 49 308 1.6 12 3 3-10 2.3 20 42 315 L.4

a

3

a

a -. -. :- ?

a2 187 90 3 0 4

.1-

32 59

10

.1- 2-

'

.-

.e m

-

.:- 3-C2 .., -

L l?

a

4

F

3

' 7

L

d

:2

11

... .,

-

L-.

18 11

8

1 1

. .-

i

:2

,

12

14

.. .- -. ....

ZG

& &

'1

Y

L

25

i

3

&

9

1: 27

:a. .

.-- -,-

-

.,L O

8

Y

52 1O

-- 2-.-0

25 3

3 3 ?

3

-..

O

275 170 267 348 253 244 325 30: 9

-

-

22Y

34' :42 7

-

-

2'-

344 234 235 340 340 343 337 343 332 243 340 320 34 3

:QS 347 - m .

id, 21c

u 1 .7 1

-

3. ? n

u.0

3.4 2.4

..3 . 3 ,3. 3

0.5 7

*J

.1 d m 2-

- .--

1 A . ,

a - ?

2

#J

-

-

9

*

d . 47

4.6

-

* u.9

- -

J .

F -

-

23 14 179 37

-

61 139

3

10

3

13

4 4

240

3

J . 0

i.i

9.6

- - 7

195 A

-

58 12 7 .

Y .

J

2.4 2.5

- . 7

c

. .

4 . -

2 95

9

..-

336

45 23 142 296

1

2.5 ;.3

24 123 "l

3 3

3

- * -

34; 330

02

-3

.-.-

';3 24

z

-

7

3

4 . 4

.L 2-

A

7

T

-

-* a.. 5.

,,, 42 34 5

; y -

2913 353

5 2 3 3 3 3 6

2.a 6.2 3. : J. 3

-. , --

A L 4

A .

4

2.2 -

.&O.. &

A .

327 :Fa -4

S. 6

337

3.0 3.3

349 13; 273 233

221 350 3EV 165 lZO

242 302 348

4.3

.-;>

4.5

- .

L.-

1.0

3.1 C. 2

0 .2 4.3 0.3 3.5 L.4 O. 3

L

2a9

1.3

30 3 49

270

2.2 3.2

352 3;;

1.2

Taxon A

#

PFNIVERR

6 3 3ENfATR.A

Taxon B

# CORR 3 2 ?OS 3 3 NCG 3 4 POS 3 5 ?iEG 36 ?OS

37 NEG

:a ?OS 39 NEG 40 4I 42 43 44 45

?CS

?OS NEC NEG YFG ?SC

4 6 YKG q7 !iEG 48 ?OS 4 3 ?OS

50 NEG 5 1 NEG 52 YEG 53 3'3s

5 4 YEG 55 NEG 56 >IEG 57

?OC

--

5a YEG ;Y ?CS 6 G NEG i i NEG 62 NEG L ?OS 2

NEG

2

?OS

4

?OC

5 6

?OS NEG

YEG 9

?OS ?ICG

3 LO .; -

!IEG

:Z 13 14 15 16 L7

NEG NEG

&

?OS ?OS ?OS ?CS

?OS

18 NEG : 3 ?OS 20 O S 21 ?OS

22 23 24 25

?OS ?OS ?CS NEG

2 6 YEG 2 7 NEG 29 20s 2 9 ?OS !O XEG 31 ?OS

A+B+

A-B+

A+B-

2

7

A-B7

353

C (A+B+)

3.2

D

7-35

O. 0 0 5

Twon A PFNIVIRI PENIVIRI PENITIIRI PENIVIRI ?EN I ' I I R I ?FNIVIRI PSNIVIRI ?ENIVTRI FEN I V I R I ~LNIVIRI ?SN I'f I R 1 .?r:NZy/f .E N T y I I3R1I FSNT'/;3T ?EYZvf1?I ?riN17f131 3ENI:;:RI 3ENIVIRT ?EN L ' l ï 31 ?SNIVIRI ?EN1711RI ?ENIVZRI ?5NIT/I3I ?ExIvmI ?SNIVIRI ?ENI'f 1R I -3f ~ZNN1I -V1I133T: FFNTV:31 3f NIYjTRI 3FNTVIRI r=NI7J:31 ?FNXUL? ?EN I'I'JL 2 r=NIVL'LP ?ZNIVUL? ?EN T.jUi.2 ?EN TVIiï.2 ?EN f'fUL? ?EN 17/üLC

-

--

&

-

9-

--

I?j.JÿL? 2ENIVUL2 PENIWL? ?ENIVUL? ?ENIVUL? ?SN IVULP ?fNTVUL? 2ENIijüL2 ZFNIIIUI? PENNIVULP ENIWL? 5SNIVULP ?ENIif13L? XNIVUL? ?FNIVUL? 3SNTTJüL? ZENI'VUL? ?EN I V Ü L P PENIVUL? 3FNI'VTJL? PINIVUL? ?ENIVUL? &

-

# CORR 32 NEG

33 ?OS 34

POS

35 NEG 36 ?OS 37 38 39 40 41 42 43 44 45

30s

?OS ?OS NEG NEG NEG ?OS

?]ES ?CS

:O

?CU

47

?CS ?OS

48 4 9 NEG

50 5i 52 -=.: 54

-2 -3

NEG ?OS ?OS

3 s NEC

?OS 5 6 NEG 5 7 ?OS 2 a ?CS

-.

-2 7

33s

ai3 ?OS 6 i NEG

os ?CS 63 NEG NEG 2 ?OS 3 ?OS 4 ?iEG 5 NCG 6 NEG 7 ?OS 3 NEG 3 NEG 10 ?OS L i NEG L2 NEG 1 3 NEG :4 ?OS 7 A

:O

c d

30s

?OS

L7 ?OS 1 8 NEG L 3 ?OS 20 ?OS 2: ?OS 22 NEG 23 J G S 24 ?OS 25 ?OS 2 6 NEG 2 7 ?OS 28 NEG 29 ?OS 30 NEG

A-B293

C (A+B+)

1.7

Taxon A ?FNIVL'LP

# Taxon B 6 5 PAECVARI

# CORR 31 NEG

A+B+

A+B-

i

A-B+

21 20

49 7 40 75

A-B298

32 ?CS 33 ?OS

2 4

34

?OS

7

15

3 5 NEG

10 5 2

'2 13

131

-00

35

262

?C

3

3j9

3 6 20s 37 39 39 40

?OS

7

?OS ?OS 20s 4 1 NEG 3 2 YEG ?CS LOS

4O

?CS

d

' G - a

4

'1

7

3

53 54 55

-:3-.

-. .- -1

-

A

4

T

.d

q .

i ,

NEG NEG ?OS ?OS

233 ;7 ;

d 4 d

330 338 334 324 334

7

:4

7

-. -

3

LL

7

A

* *

,?

13 -. 7

C

4

d

,L

.-

-. --

-2

- 5-

,d < .

3

9-3

,

,Y

-

-

7 d ;

7

a

-1 .3

L

3

A

14 1'

L

A

?CS 20s

O

132 :O2 10: 38

.-

.- .

O

YEG

-8

*OS

13

NEG

-

?

2O

a

?os

9

XEG

10

NEG

7

NEG

10 4 55 36 3 4

26 2

.

A

-

Y

*

F

a

7

32 L06 37 38 104 53 12

:oc

61

.- -2

228 13 13 13 15 30 40

-

'-

20

36 20 14: 157

.

P

..O

ha 35

104 40 73

10 11-,

17

91

4' 31 7

50

48

3 2

105 106 38

70

:a

NEG

4

?OS ?OS

29

NEG

:a

6

30 104 38 102

20

323 322 - - *

5ù 3 134

7 . &

324

338

3 . 4 a a d

L ,

3 4 5 O

25 26 27 28

.

.- .-

-7

C L

3i3 3

1s ?OS L3 NEG 20 3 3 s 2 1 ?OS 2 2 NEG 2 3 32s 24 ?CS

-

,

325

10 33

30s 1 6 NEG 17 =ios

?

C

m

6

..

?OS ?OS

FOS

'

S

a d -

:3

22

L L

NEG

?

-l

1? LL

04

NEC

04 *

3 3 O

'

11 12 13 14 15

-

1

324

?OS ?CS

7

240 -336 !O 31' 4 "1548 .' * w 325 3 335

lL71

-? 7

21

-8

- r

22

7

?CS ?OS

.

3

d

NEG 58 YEG 2 . ?OS 5 2 ?CS 53 NEG 69 ?CS 6 1 NEG 0 2 FOS

-0:

--

i i

1 7 NEG 4 a NEG

49 53 51 52

.- -

d

13 ?CS 4 45

la

340 3c7 268

-* a

:L

a L30 167 16 39 6 55

14' 336 213 330

--*-

4 a,,

296

246 7 7

d

251 245 243 246 17: 215 254 205 225 241 &LO 64 T

?

245 251 144 204 214

;ac 254 253 L31 34 245 222

255 206

c ~A+B+I 3.0

9 2.54

D

0.Zll

Taxon A

PEOMHERB

# Taxon B 66 MUCORACE

#

CORR

2 9 ?OS

NEG ?OS LOS

A+B+

15

A+B-

73

A-B+

56

A-B-

205

C (A+B+)

D

20.0 2.7

14.6 2.6 12.3

NEG ?OS NEG NEG ?OS

25.3 55.3 z7.5 2.3

?OS

3

YEU ?OS 20s ?CS 30s

?OS

-.

Y

.

4.: . >

7

- d . J

.2 - .- =+c . 3 z

7

d . J

?OS COS

2f3.7 3.9

:IEG

o . .

K G ?OS

2.0

?OS ?OS

?OS ?OS

YEG ?OS YEG

*

+

-

2.2 3.2

.- -1

-

o., * c.0 9

-

.O ?

&.O

-2 . 3-

?EG

3.5

?OS

.2 ,.ci-. 2-

?I ES ?JEU

?IEG ?OS NEG

- . -

2.3 4:.0 - -

.-

a.-

*

4.36 4.38 3.35 1.92 3.24 3.40 3.3C 3.29 ,3.:0

z.13 2.42 ,.j3 7

.,. -$ 5-

-1.1:- -, . 3 -

:.&Y

1.0d 3.34

1.34 4.42 2.-4 3.-4 3.16 1-45 1.4:

3-25 1.4: 4 -34 l.37

J.4:

3.3' z.3: 3.52

-.

-

4

a.

&

?OS

.2 - -.

1.-1

?IZG

15.4

?OS

4.2 54.3

3.33 3.52 2.4:

?CS ?OS ?OS NEG 30s

K G NEG ?CS NEG JOÇ

NEG ?OS

?OS NEG NEG ?OS

9

L.0

.- . - 2

* -

.

L.

. -.-..

3.2

;.34

4.2

2.21 3.52

*

-.

& * d a

4.2

.- - . . 7

1.

:.s

... 9

j

.

-

8

4.3 32.3 43.2 4.3

2.4 31.1

1-54 3.33

2.3c

.2.35 -

P

--:O

3.-5 ?.33 L.27 6-55 1.32 .q

..

20s

L4.6

YEG

13.8

3.05

FOS

23.7

Lm77

?OC YEG 30s

NEG ?OS

?

L.

-

L.'

33.6 41.2 3.4

3.7:

3.J2 1-92 2.-: 3.36

3.31

o.

037

Taxon A ?HOMSP PKOMS P PHOMS? ?HOMS? ?HOMS? ?HOMS? PHOMS P ?F?OMSP PHOMS? ?3CMS? ?UOMS? FECMS ? ?UCFS?

?5CE1Ç il ,>UGMS? ?SOMS3 ?SCMS? ?HOMS? ?HOMS ? ?u*OMS ? ?UOMS 3 ?tiCMS? ?HOMS 3 ?F?OM£?

?UOMS? ?SOMSE ?EOMS? ?IiCFS 3 FXOMSC ?UOMS?

#

Taxon B

1)

30 NEG 31 ?OS

32 NEG 33 NEG 34 NEG 3 5 NEG 3 6 NES 3 7 ?O$ S 9 ?iEG 3 5 ?IEG -1G NEG 4 1 NEG 4 2 NfG 4 3 ?OS -14 YEG

4 5 NZG 46

NEG

47 48 43 50 5: 52

XLG NEG

?CS

YEG

55 YtG

56

FUOMS 3 ?UCE!S 2 ?HCMS? ?!!OMS? 3tiOMSP ?EOMS? ?UGMS? ?FiOMS2 PUGHS? ?ti.OMSP ?:T4CHAR --q, r SCYAi ?ITIiCFi ?IT4CYAQ

57

.

?OS

NEG

5 3 ?CS 5 4 NEG

?HOMS?

&

CORR

2 6 POS 27 NEG 2 8 NEG 2 9 NEG

?OS

?IEG 58 !IEG 5 9 NEG

63 XEG 6 1 ?CS 02 YEG 0 3 NEG 64 NEG 6 5 XEG 6 0 NEG 1 2 3

NEG ?OS ?OS

4

?OS

3 1THCt.M

5

?ITKCFi ?ITtiCW ?IT,qCrn 3IT3CFI ?I-?!iCXA8 ?ITIYCM O~TUCII? ? IT!!C.XAIS ?ITIYC?i ?IItiCtiAR Pi?LiCFaZ

6 7

?GS 70s

hcum

3"" ' , L &

PITIICFi ?,TE.'.C9AR ?ITECFM ?ITIYC?M

a 9

?OS ?os PC)S NZG

LO I1 >OS 12 ?OS 1 3 NEG 2 4 NEG 15 ?OS

1 6 ?OC L 7 NEG i8 NEG

13 ?OS 20 ?OS 21 20s

A+B+

A+B-

A-B+

A-B-

CiA+B+)

D

Taxon A SCOPBREV SCOPBREV SCOPSREV SCOPSREV SCOPBREV SCOFSRET/ SCOP3REV SCOPBREV SCOPSREV SCOPBREV SCOFLREV s"C3?9EET/ SC3F9RE'J Sc5LSP.E'; 9C0?9ZETi SCOPBREV SC3FSRETJ SCO?SRCV SCC)PSRETI SCOPSREV SCGPSXEV LCOPSRFV SCOPBREV SCOOSRLV SCODBREV SCOFSREV 3C339AEV SCOPS?.FV SCSPBREV SCOPBRE'I SCCFSREV SCOPSRE'I i^CD?LREV 3C3P98EV SCJPBRCV SCO?SRET/ SCO?SRETI SCOFBREV SCGFSRE'J i'CrJEEREV SC3FBRETI SCOPEREtJ S C 0 ESREV SCOPSREV SCOPBREV SCOE32EV SCOPBREV 3COFBREV SC3EBREV SCOPBREV SCOPBREV SCOPBREV SCOPSREV SCOPBREV SCOPSREV SC3PBREV SCOPSREV SC3F3REYj s'C3PSREV SC3PCAllD SC3PCAND SC3PCAiVD

# Taxon B 7 0 ASPESYDO

#

CORR

11 POS 1 2 NEG

I?

NEG

14 15 16 17

NEG COS FOS NEG

La

NEG r 3 ?CS 20 NEG

-

21 ?OS '

LL

30s

2 2 395 24

?CS

T C

4

3 6 NEG 27 NEG 2 8 NEG 2 9 NEG 30 ?OS 3 1 ?OC

32 305 73 30s 3 4 ?OS 3 5 ?IES

-:-

3 6 ?OS

-

?CS ?OS - " 3 Y ?OS 40 NEG '

2e

4: 33.5 42 NEG 33 ?OS

44 NEC 4 5 ?CS 46 NCG 47

49 49 50 51 52 53

NEG NEG ?OS NEG

NEG NEG ?CS

S -53 4-3 C?OS 50

?OS ?OS 53 ?OS 5 9 ?OS 57

6 9 NEG

6i 62 63 64 05 66

?OS ?OS ?OS NEG ?OS NEG 67 NEG

6 8 NEG 6 9 NEG L 20s 2 20s

3

SOS

A+B+

5

A+BA-B+ A-B- C (A+B+I 28 4i 295 4.1

O

0.05

9.323

# Taxon B SCOPCAND 7 1 ASPFCAND SCSPCAND SCOPCAND SCOPCAND SCOPCAND SCOPCAND SCOPCAND SCOPC.UiD SCOPCAND SCC)PCAND 3C9PCAND SCSPCXVD 3C3PC.XVD 3C 2lCAND 2 CO ? '3.hi D ~COcC~~vC SC9PCAND 3COPCAN3 SCOPCAND SCOPCAiD SCOPCASD SC3LCAJla SCOPCAiD SCOF'CAPID SC3PCAID SC3PCAND 3C3PCAND 3LCUCAVD SC3PCAND 3C3PCANO SCOPC.!G SCOPCANC 3LûPCANI: SCOPCAYD SC3PC;IIUD SCCPCAND SC3PCAND 3C3PCAND 2COPCAND SCOPCAPID SCOPCAUD S C 3 PCAND ÇC3PCAYC SCOPCAVD SCOPCAND SCOFCAUD SCOFCAND SCCPCAND SCOPCAND SCCPCAND SCOPCAND SCoOcmD SCOPCAJSD XOPCAND SCOf CAND SCOPCAND SCCPCAND SCCPCAND SCOPCAND SCOPCAND SCOPCAND SCCPCAND

Taxon A

# 4

C O R . A+B+ NEG 2'3s

5 6

NEG 00s

7 9 9

?OC 30s

1i3 ?OS 11 ?OS

L2 ?OS 1 3 29s 1 4 NCG 15

-

16 !EU

.-

YEG 1 3 YEG 1 3 NEG 2 0 ?OS 2 1 NEC;

2 2 NEG 23 ?OS 24 ?CS 2 5 ?OS 26 NEG 27 ?OS 26 ?OS

--

L Y

10s

3 C 30s 3: ?CS 32 ?OS 33 34

-2:

305

?OS ?CS

3 6 NCG 'f FOS 3E ?OS 3 4 ?OS

40 ?CS 4 1 ?OS 42 NEG 4 3 ?OS 4 4 ?CS 45 NEG 4 6 ?OS 4" NEG 48 NEG 4 9 ?CS 50 ?OS 5 1 NEG 52 ?OS 53 3Q.s 5 4 XEG 55 ?OS 56 30s

-2 -I 5a

NEG 20s

53 NEG 60 NEG 61 ?CS 62 ?OS 63 30s 6 4 YEC 05 ?OS

7

A+BA-B+ A-B26 18 324

C tA+B+I

1.4

D

0.65

O . 420

Taxon A SCOPCAND

# Taxon B 71 PHOMHERB

# CORR 6 6 NEG 67

NEG

68 20.5 09 NEG

O'

YEG

i 2 3

10s ?OS

NEG ?OS

4 5 6

?OC ?OS NEG ?ES !lEG

3 3

,,, ?CS L L NEG

:2 !ICG :3 NZG

14 ?OS 15 NFG 10 C C 7

-9

i

1

305

1 3 ?OS 13 NEG

20 YEG 21 29s L; NEÇ 2 3 ?CS 24 NEÇ 25 ?OS 2 6 YEG 2' NEZ 7

A

2 8 !iEG 2 5 ?CS

3 3 !IEG

3 1 YEU 32 NEG 33 ?CS 3 4 YEG 35 NEG 3 6 YEG 3 7 !IEG 3 0 ?OS 2 9 ?OS 40 :4EG 4 i NCG 42 X t G 4 3 NEG 4 4 'JEG 45

XEG

46 ?GS 47 30s 4 8 20s 4 4 ?OS 50 ?OS J i ?OS 52 ?OS 53 C S 54 ?OS 5 5 NEG 56 NEG 57 2 0 s

A+B-

A+B+ 7

20

A-B+ A-BC IA+3+) LiSL 24: 7.3

l? 9.30

D

Taxon A S PW-SP SPHASP SPHASP SPHFiSS SPFASP SPrnS? SP.WS2 S?i-!!S? S PFAS P SPY,4SF S CUAS ? S?UAS? 3 3UAS L

--

-

# Taxon B 72 PENïSPOl

#

CORR 5 8 NEG 5 9 ?CS 6 û NEG

61 62 63 04 05 00

NEG NEG NEG

67

NEG

O?

?OS

03

?CS NEG

--

9

.-

?OS

?OS 20s

:2u2,3

7

NEG ?CS YEG ?OS

3 :O

NEG 20s

ALTES?

XPEGSTL'

TUSASP SCOMPANN

7 9 YUCOPLZM '9 .IUCûRACE 78 3 A t C Ç P ' 6 ?.ECTl?iXI 78 3FNIATU 'E ? E N I A U X 4

' 6 ?FNI3RE7J a PENICHRY 3

; 8 ?ENICOMM 78 ?SNICOPR 73 3ENICORY '8 ? = N I C R U S

'4 ?FNICTNG 7 9 ?CNICTELi' 5 ?SNI9ECLI 7 3 ?SNIDIGI 7 8 ?ENIECXI 7 9 ?ENISXPA 78 ? f N I C - L M 75 ? S N I G Z I S 79 ?LNïIMPL ?ENIIÇï.A 7 8 ?ENLISA;

'

NEG

C (A+B+I

2 3

-9 C - J Z S F M 7 ; IZONIS? - 9 EMFRNI31; 73 SPICNIGR "9 ZUROHIRS '9 WSACXYS

-

NEG

262

ALTSXTZ

-9 "ES2

-9

66 67 68 69

A-B-

: 0 s

'? A S P S T J E R S - 3 ALFE?GLL '2 cyxG32,?E S C4?.S?YSC '8 YJCC'JD '8 X Z t i E R B

8'

CORR

65 YEG

ACRES?

AS3ZCANC -a ASPSFUKI 7 8 ASi?EGLAü 79 ASPENIGZ 'r3 AS?EOCHR '9 .AS?EORYZ ASPES? '9 ASPESYDO

'3

#

a

?os

:I ?GS L f NEG 1 3 NtG :4 NEG 15 39s -5 75s 17 NEG 19 NEG 1 3 ?OS 2 0 NEG G , NEG 7 ,, ?OS 2 3 NCG 2 4 ?OS 2 5 30s 2 6 ?OS

.

F

,..

-

f -!

NEG

2 8 ?OS 2 9 NEG 3C 2 0 s 3 1 LlCG 32 ?OS 3 3 30s 34 NEG 3 5 NEG 36 ?OS 37 NEG 38 ?OS 3 3 ?OS

4 G NEG 4 1 ,705 4 2 NEG 43 44 45 46 47 48 44 SO

NEG NEG

COS NEG NEG 30s 30s NEG

;*;4:

- .- - -

-

' C L T = :

J . 1 a -

2 . S54 2.242 !.'O4 2 . $38 7 n * Ji-u-

1

3.'52

-J . , 2.0 - -

3. :G2

, J .

-Z L-- -

1. 2 6 2 j. 1 6 1 1

T

*

?

J . L - 2

l.jL3 3 . ;c: 3 . :32 2 . ;124 j.3a3

:. S C C 1.634 2 . .l'5 3.3:3 .*

;PR - 4 -

>,5j7

1.522 3.413 7

J .

-3.

?,

3.242 3 . AC6

3.586 3.

crao

3.236 L. 300 3.393 3.355 3.306

-

3.522 - - 9

J. 2 i

3.334 3.393 3.545 2.424 3.244 3.379 3.35L 3.362 J.4013

Taxon A YFAST

# Taxon B 7 8 PENIMICZ

P CORR 5 1 POS

A+B+

13

A+B-

299

A-B+

1

A-B- C tA+B+I 56 1.3

x2 0.25

D

9.617

Sample No.of No. isolates

Total No. No. of spp. Species seen once

Percent Coverage

Sarnple

No.

No.of isolates

Tobl No. No. of spp. Species seen once

Percent Coverage

Sarnple No.of No. isolates

Total No. No. of spp. Species seen once

Percent Coverage

Sample No.

No.of isolates

Total No. No. of spp. Soecies seen once

Percent Coveraae

Sample No.of No. isolates

Total No. No. of spp. Species seen once

Percent Coverage

Sample No.

No.of isolates

Total No. No. of spp. Species seen once

P e r mt Coverage

APPENDIX D .\lignrnenr of rcqucnces of nuclex ribosomd DN.\,ITS 1-3.SS-ITSî and pa&l?BS rcgon Gom Pr'ni~fIIiuumsubgen. Prni~iIINm

Invariant bases are indicated bu an asterisk

P e n i c i l l ~ u m spp., CLUSTAL X

!L.di

nuclear rDNA,

iTS1-5.8s-ITS2 and p a r c i a i 28s sequences

multiple sequence a l ~ g n m e n t

AAGGATCATTACCGAGTGAGGGCCC-TCT-GGGTCCAACCTCCCACCCGT AAGGATCATTACCGAGTGAGGGCCC-TCT-GGGTCCAACCTCCCACCCG?' AAttATCATTACCGAGTGAGGGCCC-TTT-GGGTCCMCCTCCCACCCST iUGGATCATTACCGAGTGAGGGCCC-TTT-GGGTCCAACCTCCCACCCGT AAGGATCATTACCSAGTGAGGGCCC-TTT-GGGTCCAACCTCCCACCCGT AAGGATCATTACCSAGTGAGGGCCC-TTT-GGÛTCCAACCTCCCACCCGT AAGGATCfrTTACCSAGTGAGGGC~C-TCT-~SCGTCCA9CCTCCZACCCGT ;WGGATCATTACCSAGTSAGGGCCC-TCT-GYÜTCf;MCCTCCCACCCST .X\GÛATCATTACCSAGTGAGGGCCZ-TCT-GGGTCC~CCTCI:2XCECST ;WGGATC~TT8CCSAGIGAGYGCC~-TCT-~~YYT~~MC~TC~~~C~~~~ UGGATCATTACCSAGTGAGGGCCC-LCT-GüGTCt.WCZTCCCACZCST

MGGATCATTACCÜAGTGAGGGLCC-TC~-GGGTCCiWCCTCC~AC~CGT MGGATCATTACCGAGTGAGGGCCC-TCT-GGtTCCA.ACCTC~~ACCCGT AAGGATCATTACCGAGTGAGGGCCC-I'CT-GGGTCCAACCTCCCACCCGT AAGGATCATTACCSAGTGXGGGGCCC-TCT-GGGTCCIWCCTCCCXCCCZ?

; M G G A T C A T T A C ~ S A G T G A G G G C C C - T C T - G G G T C C ~ C C T C C ~ A C E GiTe

UGÛATCATTACCGAGTGCGGGCCCCTCG-GtGCtCMCCTCCZACG 4 9 XAGGATCATTACCGAGTGCGGGCCCCTCG-GGGCECiWCCCCT

42

AAGGATCATTACCSAGTGCGGGCCCCTCG-GGGCCCMCCTCCfACC 49 A A G ~ A T C A T T A C T G A G T G C G G G C C C - T C T - G G G T C ~ ~ C C T ~ C : : A ~ ~ 4GeT iWGGATCATTACTGAGTGCGGGCCC-TCT-GtGTC~EMCCTCZCACCGT 4 8 MGGATCATTACTGAGTGAGGKCC-TCT-GGGTCCMCCTCCCACCCGT 4 8

MGGATCATTACTGAGTGAGGGCCC-TCT-GGGTCCAACCTCCCACCC 46 48 48 XiGCATCATTACTGAGTGAGGGCCC-TCT-GGGTCCAACCTCCCACC 4 8 UGGATCATTACTGAGTGAGCCCCC-TCT-GGTCL;MCCCCCCS 48 MGGATCATTACTGAGTGAGGGCCC-TCT-GGGTCC~CCC~ACC~GT ia ~GGATCATTACTGAGTGAGGGCCC-TCT-GGGTCC;WCCCC 48 AAGGATCATTACTGAGTGAGGGCCC-TCT-GGGTCCAACCCCCGT 4 8 .UGGATCATTACTGAGTGAGGGCCC-TCT-GÜGTCC~CCCCCCC 48 AAGGATCATTACTGAGTGAGGGCCC-TCT-GGCTCCAACCTCCCACCC 4 8 ;WGGA?CATTACTGAGTGAG(;GCCC-TCT-GfCTCCMCCCCC 48

AAGGATCATTACTGAGTGAGGGCCC-TCT-GGtTCCiWCCCCCT XiGGATCATTACTGAGTGAGGGCCC-X7-GGGTCEAACCTCKACG

;\AtGATCATTACTGAGTGAGGGCCT-TC--GGGTCCAaCCTCCCACCEGT 47

Penic~llium spp., n u c l e a r rDNA, ILSl-5.9s-ITSZ and partial 2 8 s seqnences CLUSTAL X

( i . 8 ) mul:rple

sewence al~gnment

Penlcillium spp., nuclear rDNA, iTSL-5.8s-ITSS and p a r c l a l 28s sequences CLUSTAL X i L . 8 ) multiple sequence alignmenc

CTTTA-TTGTACCTTGTTKTTCGGTGCGCCCSCC-ICAC--GCG GtTTA-TTGTACCTTCTTRTTCGGIGAGCCCSCC-TC-CC

34

?4

GTTTA-TTGTACCTTGTT~TTCGGTGCGCCCSCC-TCAC--GGCCGCCG 34 GTTTTATTGTACCTTGTTGCTTCGGCAGGCCCGCC-TCAC-GCCG

35

Penict1:ium

spp.,

nuclear

rCNA,

TTSI-5.8s-ITS2 and partial 28s sequences

CLUSTXL X ( 1 . 9 ) m u l t ~ p l e sequence alignmenc OC!

5i

7O

3G



100

-----------------------------+---------+---------*

GTCTR-TTGTACCTTGTTGCTTCGGCGGGCCCSCC-cZC~--ÜCCGCG

34

STTTA-TTGTACCTTGTTGCTTCSGCGGGCCtGCC-7CAC-GGCCGCCG 3 4 GTTTA-TTGTACCTTGTTGCTTCGGCGGGCCCGCC-?CAC-CGC 3TTTA-TTGTACCTTGTTGCTTCGCCGGCCCCGCC-TCAC-CC

94

34

GTTTA-TCGTACCTTGTTGCTTCGGCSGGCCCGCC-TCAC--GÜCCGCE3 4 34 ?4 STTTA-TCSTACCTTGTTGCTTf~GYCSGGCC~GLC-~CAC--GÜCCSC 34 ST?TA-TCSTRCCTTSTTGCTTC5CCSGGCCCCCC-T~ZAC--~3ÛCCGCZG 34 ; ~ T T ~ - T C S T A C ~ T T G. G-L-.~ -. -C-~-------P--~-- - ~C C+Pc~ -rA r~ -.p- ~P- P~~P--P P ~ P~P ~ u . Iu. I P u PuC -up -Lp -A- ~- u ~ ~ ~ J!4C ~ ~ ~ ~ ~ ~ G C S

.,.*..*..*.**.*.*

*...,..... ....**......... *

W...

Penicrllium spp.,

nuclear

rDNA,

ITSL-5.9s-ITS2 and parcral 28s sequefices

CLUSTAL X (1.81 aulcrpie sequence alignmenc

TCATTGCTGCCCTC~GCCCGGCTTGTGTGTTGUGCCCC-G-CC

385

TCATTGCTGCCCTCaGCCCGGCTTGTtTGTTGGGCCCC-GT-CCTCCGA3 8 5 TCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTSGGCCCC-G-CCG

?E5

TCATTGCTGCCCTC~GC~~GGCTTGTGTGTTGUGî~CC-~ST-~~ZCC~SA 3d5 TCATTGCTGCCCTCMGCCCGGCTTGTGTGTTGGGCCCC-GY-GA

395

TCATTGCTGCCCTC~GCCCGGCTTGTSTGTTG~GCCCC-GT-~::::TCCSA :e6 TCATTGCTGCCCTCWGCCCGGCTTGTGTGTTGYGCCCC-GT-Ct?'CCZX

385

TCATTGCTGCCCTC;UGCCCGGCTTGTGTGTTGYGCCCC-GT--ZCTCCSA3 8 5 T C A T T G C T G C C C T C ~ G C A C S G C T T G T G T S T T G Y G C C C f - f 3 ? - C C A 385

"CALTGCTGCCfTC;UGCACSGCTTSTUTSTTGGtZCCC- - ~ ~ ~ ~ ;~Y~TTTG"ACCIS~TCTrJTAGGCCCSGt~CSGCSCTTSZfSAT'2.U ZZ'I

..

~ G G ~, - - GTcZACCCSCTCTGTAGGCCCSGCCSGGTSCTTSCCCAT~:.S.CCC T

-UGCTTTGTCACCCSCTCTGTAGGCCCGGCCSGCSCTTGCCSATCMCCZ

cc

SGGCTTTG~CACCCUCTCTGfAGGCC~GGCCGYCYCTTGCtSATCUCCC

SÛGCTTTGTCACCCSCTCTGTAGGCCCGYCCSGCGCTTGCCSATC%CEZ GGGCTTTGTCACCCSCTCTGIAGGCCCGYCCSGCSCTTGCCGATC%CCC ~GGCTTTGTCACCCSCTCTGTAGGCCCGÜCCSGCGCTTCCCGATC~C~C

~~GL,.,GTCACCCSCT~~STAGGCCCSGCCSGC~CYTGCCSATCUCZZ -mm* SGGCTTTSTCACCZSC'KTGYAGGCCCGGCCSGCSCT7SCtSATC~CtC SUYCTTTSTCACCCSCTCTSTAGG2CCSGCCSGCSCTTGCCSATC;WCZC ZGGCmWFP-p ,..u,,ACc~~~.i..u.rrCG~c~uu~~~Gtu~..~~.,uATCMCCC -c

CPC-VPTP-.

PPPCPCPP

PPP-*rPeC

SGGCITTtTCACCCGCTCTGTAGCCCCSCfC5GC5CT7tCCSAT7%CCZ ;YGL7TTSTCACCfSCYCCSTAGGCCCSGCfSGCSCCTSCCSATC%CZE

3 Û G C T T T G T C A C ~ ~ S ~ T C T ~ ~r ArG aG C~ P ~p rbpPpdPp -~~rpeCPF c~q -~r *r q. ~ ~ r ~ ~ r - . ~ C C ~ ~U~CTTTGTCACCCSCTCTGTAGG~CCSGCCSGCSCTTGCZSATCXCCC

cPc

-

ïGGCTTTG~CACCCCLTCTG~AGGC~C5GCC5GC5CTT5C~SAT~~CZ7 JUGCTTTGTCACCCSCTCTGTAGGCC~SGCC~GCCCTTSCCSATZMCZZ 5YGCTTTSTCACCCSCTCTGTAGGCCCGGCCSGC5CTTGCCSATC2C~C ;GGC-w.pr-r* ~,,~~C,,~L.~.G~AGGCCCSGCCSGCSCTYSCESA~C%CC~ pp-e-pC

...

---.,. ...G l C A C C C G C T C T S T A G C C ~ C 5 G C f 5 f C 5 C T T C ; C ~ 5 i i i i ~ C ~ C i : : zGC4TTTSTcACztSC-P"P-* .,. u ~ f i G c i ~ , ~ a u ~ L c t G C. ~ ~ . A A C C Z

CC r

JWUL

'"CPPe"cP

c*--reFr**F ~

~

~

d

f

i

.

ZGGCTTTGTCACCCSCTCXTAGGCECSGCCSÛCSCTTGCtSATTX4CC-

J~UCTTTC~CACCCSLTCTGTAGGCECSGCC~GCSCTTGCCSAT~~CC-

-CC

.,. .,

=GGCT-TG-rACP-P-"r"TT ~-~GL.-.u.AGGCZCGGCCSYCGCTT~CCSATT~CZ-

J~GCTTTGT~AC~C~CTCTGTAGGCC~GGCCSGCSCTTGC~~ATCUCZ-

Cc

SYGCTTTGTCACCISCYETGTAGGCCfSGCCSGCYCT7SCCSATCaCCSGGCTTTSTCAC~CSCTCTC;TAGGCCCGÛCCGGCGCTTGCCSATC;MCfSGGCTTTGTCACCZSCTTTGTAGGAC~PCCrCCCp . ~ ~ L ~ ~ ~ L ~ C Z T G C C S A ~ W C C -

J~GCTTTGTCACCCSCTTTGTAGGACTSGCCSGCSCCTSCC~ÀTC;WCZGGGCTTTCTCACCCSCTTTGTAGCACTGGCCSGC5CETGCCSATC;WCESGYCITTGTCACCCSCTTTGTAGüACTSGCCSGCSCC~SCfSATC;WC~pp

~ Y G C T T T G ~ C A .LGL. C " r ' ~ " ~ ~-~oTrA G G C C T G G C C 5 G C S C T T G C f 5 A T C % C ~ A

~WGCTTTG~CACC~SCTCTGTAGGCCCGGC~GGC~C~AGZCSA-~~~C~A

r P

-

CGGCTTSGTCXCCCCCTCTGAGGCfSGCCSGCSCTGGCZ5A-~JZfT7Z . * t t * * * * t * * t t e * * ***** t ****.**** *****

rDNA KSI-S.BS-ITSZ sequences Penicillium subgenus P e n ~ c l l l ~ u mnuciear ,

CLUSTPJ. X

(

l.a

muitrple sequence allgnment 50 L

P. zanescens :IR.U3 10 i T 1 ?.atrovenet7m N R K t S 7 1 :T! P.chrysoqenum NRRIâOÏITI ?.chryscqenum C9.24 3.notacum ElRRL8LI [T! ?.grrseor~seum NRRLatOiT: ?.chryscqensm CS. LZ ?. natgiovense !JR?.L?:: :T: ?, r?r~soqeP.Llm ?lRRLd24 Flen2n.j srrn ?.zo:atqat ?IRRL632 3Lci;r;e s t ri. EJ. e q y c c ~ a c mW??LZS3G :T: t ~ zrsJc:3teszn . !IRRL3?32 ; Y :

?:rsr:j:=atlrm

SRRL558O

?.aech~ac~:*an C35384.54:T; ?.qr:s.-~.d~pcccmy;csla NRRL134i3l;L: ?. :membertL !lRRLa'3 [Y: ?. z a s e ~ z o i u m?lRRL275[TI ?. crus:osum NRRL36û ?.,~rrrd:catum NRRL4E1 ?. auran::cqrrseum ?lR?.L37! : Y : ? . y o l o n i c r m X?.XL3'35 ; Y ; ?. pclonlcrrn; Zf4. : ?:~rrrd~cat=m NRRL358 [: ?.ech~nulatmNXLlL5:;Tj ?. s c l e r ~ t ~ ~ e n!ll?.tRLn '36 [T: ?.sclerotigenum NRRi316::T: ?.aison22 CSS232.32;T: ? . z r p r s ~ h i l m ?W.RI:2SZ7 :T: ?.qrrsecfulemn XRRL-34 :TI ?.qr:seofulvm NRRL2300 [ Y ' ?.;nrys:~.3rpcdcmyzs NRRI:l4tiS.T: ?.expansum YRRt3'4 azourqe scru ?. :srYacilm !IRRL:Y :T: ?! .pa radoxus NRRI.2 :6 2 : Y : ?. atramen:sslm NFL3L795 :Tl ? . s w r e c ~ c k r ?1RRL3:5 ~ :TI ? . n o ; ~gerlurn!IRRL3442 [Y: ?. ra:stricn:i ?lRRL:0?3 [Ti ? . s o p p r ~ NXRL2023!T: ?.orevrcrmpac:trm 385.4 ?.orev~ccrnpdc=rim DACM13Z7:Z.T: ? . s c a i o n ~ f e r ~ ATCCIJL;: m ,T: ?.Srevrcsmpacztim 325; .?.zrevLccmpact*m 3iIz. : Su.Lap:dosum NRRLi:BiT: ?.bilai: NRRL339? :Tl

5!0

52 C

533

APPENDIX F .\hgnmcnts of gene sequences from P. bnviiompmwn

Invariant bases indicatcd bu an asrerisk

seqcence

-1PPEhDD; F - Part 1, berii

F-406

781

2 1O

200

130

220

240

230

T--------t-------------------t-----------------------*---------T

ACAACGGTACCTCCGACCTCCAGCTGGAGCGTATG>ACGTCTACTTCAACCATGTGAGTA 234 ACAATGGCACCTCCGACCTCCAGCTCGAGCGTATGFACGTCTACTTCMCCATGTGAG 237 ACAATGGCACCTCCGACCTCCAGCTCGAGCGTATGMCGTCT.4CTTCMCCATGTGAGTA 23' ACA4TGGCACCTCCGACCTCC:AGCTCGAGCGTATGAACGTCTACTTCAACCATGT.T

237

ACMTGGCACCTCCGACCTCCAGCTCGAGCGTATGMCGTCTACTTCM.CCATGTGAGT.4 23' ACMTGGCACCTCCGACCTC:CAGCTCGAGCGTATG~CGTCïACTTCMCCATGTGAGTT42 3 7 ACAATGGCACCTCCGACCTCCAGCTCGAGCGTATG.X~.CGTCTACTTCA4CATGA L3'

ACMTGGCACCTCCGACCTCCAGCTCGAGCGTATGiiACSTCTACTTCMCCATGTGAGTA23' ACA4TGGCACCTCCGACCTCCAGCTCGkGCG?A?G;MCGTCTACTT:2;ACCRTGTSAGTT1 2 3 9 ?.C.V.TGGCXCCTCCGACCTCCAGCTCGAGCSTATGMCSTCTACTTC-UCCATf-Y5AGTA22' A ~ : ~ A T G G C A C t T C C S A C C T C ~ A G C ' I C G A G C S ~ - 9 T G ~ J . C G T C ~ ~ ~ . C T T C ~ C A5 G 3' AG.. ?.C.9r,?GGTA.CCXCSACCTCC.~.GCTCS.?GCSTA?~ .r;(CSTCT.~.CLTC?-~.CC.A?..T :2 5 f

t

t

f

.*

1

~

w

w

t

t

~

t

t

-

~

.

t

t

l

f

..

C

.

f

-

t

t

-

t

t

~

t

APPENDD; F - Part 1, b e d

t

f

.

t

.

-

t

t

~

t

~

f

.

f

-

t

~

~

t

-

-

t

3132.1 865.4 9251 DAOM 1 9 3 7 1 2

ATCC LOlli 33C6.2 3117 359 3244.1 365.6 375.3 3ACM 132-13

Pen i cil l i um brevi c m p a c t um,

r DNP.

locus

sequence alignment

-IPPENDIX F - Part II, rDX,\ ITS 1-5.8s-ITS 1

F49

3132.1

m.4 9251 CAOM 1 3 3 7 1 2

ATCC lCI1I 3308.2

3117 399

IS4.l.

:

305.0 175.3 X C M L53"::

-\PPENDIX F - Part II, rDN.i ITSZ-5.8s-ITSZ

F-410

421

430

440

450

480

47C

480

+------------------&--------------------d------------------A

5132. 365.4 3251

L

399 3244.1

TCCG~GGCAGCGGCGYCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACTCGC 4 7 4 CCCGMGGCAGCGGCGGCACCSCGTCCGGTCCTC;WGCGTP.TGGGYCTTTGTCACCCG 1 7 5 CCCG~GGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGATGGGTCACCCG475 CCCGMGGCAGCGGCGGCACCSCGTCCGGTCCTCMGCGTATGYGÛCTTTGTCACCCGC 4'5 CCCSAAAGYCAGCGGCGGCkCCGCGTCCGGTCCTCAAGCGATYGGCGCACCCGC 475 CCCGfiAAGGCAGCGGCGGCACCGCGTCCGGTCCTC~GCTTGYGGTTTCACCGC 4'5 C ~ C ~ ~ G G C A G C G G C G G C A C ~ S C G T c ~ G Y T t c T c A A G C G T ~ ? s G Y G ~ T T T G T4C- 5i i c ~ C ~ C UCCG~GGCAGCSGCSGCACCGCGTCCGGTCCTCMGC.TGGGYCTTGCACC 4 '5 SCCG~GGCAGCGGCGGCACCGCSTCCGGTCCTC~GC?CT?TGTC.CCG 4-5

565.6

..-.-

l

5 i 3 . 2

" P r P

3ACEI 133'1:

-.PPr

3ACM 1 9 3 7 1 2

ATCC 10111 3306.2 31if

: ~ ~ ~ ~ ~ ~ ~ 4- 5 ~ ~ L,,~>-UGGLACCGGCSGCACCSCSTCCGCTCCTCPJ.GCGTn~pppp~mmTp~p .P.. GCWJL. ..; , ,ACCCSC 4- 5 , ~ L ~ J ~ ~ A G Y C ~ . G C S G C S G C ~ ~ ~ Z S ; ~ S ~ C C S Y ~ T C ~ C U > . G C Z 4~- A3~ ~ G C G C ~ ~ T ~ ~ ~

.........................................................

54 1

543

*------*

3134. : 365.4 325: 3AÛM :33'1, ATCC 1 3 1 1 1

3306.2 -. :4

,

- A &

355

TCAGGTAG TCAGGTAY TCAGYTAG TCAGGTAG TCACGTAG TCAGGTAG TCAGY TAG

54 ! 542 542 542 542 542 5 42 TCAGGTAG JG2

3244.1

TAGGTAG 542

365.6 375.3 2AOM 133'1S

TCAGGTAG 5 4 2 TCAGYTAG 5 4 2 TCAGGLAG 54: .ttt..*t

-1PPENDl.X F - Part II, rDN-4 ITS1-5.8s-ITS 1

APPENDIX G .\ Lignments O f g n c sequences Erom l'rni'iiliunt ~./,r).~~-qtnwn ---

In\.nriant bases indicated by m asrerisk

Peniciilium enrysogen um, acuA l o c u s

Psnicill i u m cnrysogenum, acuA l o c u s CLUSTAL X

(1.81 nultiple sequence aligrunent

CLUSTU X

( 1 . 8 ) multiple seauence alignment

P e n i c i l l i u m chrysogenum, acuA l o c u s

CLUSTAL X (1.8) nulcipie sequence a l i q m e n t

,UTENDIX G - Part 1, a m - \

P s n i z i l l i u m cnrysogenum, acuA locus CLSSTAL X ; 1.8) n u l t i p i e sequence a l i g n r n e n t

APPENDIX G - Part 1, a-1

CLÜSTAL

sequence

,IPPEKDD; G - Part II, ben-\

P e n i t i f l i u m cnrysogenum, B t 2 Locus CLUSTAL

X

(

1.8) multipie seauence a l i q r m e ~ ï

,WPENDCI; G - Part II, bea4

3 e n i c i l l i u m chrysogenum, 3t2 lccus sequence

,IPPENDK G - Pm II, ben;\

G-420

? e n i z i F l i u m chryscqenum, a:2

Locus

multiple sequence

,4PPELVDLX G - Part II, bea-1

Penicillium c h r y s o g e n u m , at2 l o c u s CLUSTAL X ( 1 . 9 1 multiple sequence oliqnmenr

APPLVDIS G - Part 11, bea\

G-422

Penicil l i u m chrysogenum, 9t2 l o c u s CLUSTAL X (l.9) multiple sequence aliqnmenc

.UTEXDIS G - Part II, ben-\

Penicillium cnryscgsnum, 312 locus CLUSTAL

X ( 1 . 3 ) mulciple sequence aiiqnment

:WPEXDIX G - P m II, ben,\

G-424

Penicillium thrysogenum, 3 ~ 2lccus CLUST.4.L X (1.8) multiple sequence alignment

,IPPEKDiS G - Part 11, b e a i

G-435

Penicill i u m cnrysogenum, ITS Locus

CLUSTAL X (1.2) a u l ~ i p l esequence a i i g n m e ~ t

_\PPEXDIS G - Part III, rDN-\ ITS1-5.8s-ITS2

G-436

P e n i c i i l i u m cnrysogenum, ITS l o c u s CLUSTAL X

(1.8)

muL:iple

secpence alignmenc

-\PPENDIX G - Part III, tDN;i ITSZ-5.8s-ITS2

G-427

P e n i c i l i i u m cnrysogenum, ITS locus

CLUSTAL X

(

1.9

mulziple sequence aiiqnment

,UTENDIS G - Part III, rDNA ITS1-5.8s-ITS2

Lenirillium chrÿsogenum, I T S locus CLLlST.AL X

(

i. a

b:

multiple sequence alignment

M'PEIJDLX G -

III, QN-\ ITS1-5.8s-ITS2

G429

Penicill ium chryscgenum, I T S locus CLUSTAL X (1.8) r n ~ l r i p i esecuence a l i q n m e n ~

.IFPENDCI; G - Part III, rDN,\ ITS1-5.8s-ITS2

Penicillium chrysogsnum, ITS lccus multiple

alignment

,\PPENDiX G - P m III, rDNA ITS1-5.8s-ITS2

G-43 1

P s n i c i l L i u m c n r y s s g s n u m , ITÇ Locus CLUSTAL X

iL.31

r n u l c i p l e sequence alignment

.IPPENDK G - Part III, rDbi,\ TTSI-5.8s-ITS2

G-433

P e n i c i l l i u r n c h r y s o ç e n u m , I T S locus CLUÇTAL X (1.9; rnu1:ipie

secpence alignment

_IPPEXDKG - Part III, rDN,I ITSl-5.8s-ITS2

Penicillium chrysogenum, I T S l o c u s

CLUSTAL X

(

1.3) multiple sequence aliqnment

,\PPEXDCI; G - Part III, rDN,\ ITS1-5.8s-ETS3

?enici1 l i u m chrysogenum, ITS l o c u s

CLYSTAL X (1.8) multiple sequence aliqnmect

AGGTAG AGGTAG AGGT AG AGGTAG AGGTAG .4GGT..G AGGTAG

AGGTAG RGGT3-G .-iGGT.:G AG Y TAG AGGTAG .AC;GTAG AGGTAG AGGTAG AGGTAG AGGTAG AGGTAG AGGTAG AGGTAG AGGTX AGGTAG .4GGGTA AGGTAG AGGTAG AGGTAG AGGTAG

AGGTAG AGGTAG ..**.*

,\PPENDïS G - Part III, rDN.\ ITS1-5.8s-ITS3

G-435

Penicillium chrysogenum, i r x 9 l o c u s CLUSTAL X

( 1 . 3 ) multiple sequence aligmnent

-1PPEXDiX G - Pan IV,tr'cB

G-436

P e n i c i l l i u r n cnrysagsnurn, trxB lems C L U S T U X (i.8) multiple sequence alignmenc

Penicill i u m chrysoqenum, ï r x B Lccvs CSUSTAL X (1.3) nulcipie sequence aliqnmenc

.-tPPENDIS G - Part Il',t

d

G-438

chrysoçen um,

locus

CLUSTPL X ( 1 . 3 ) nultiple sequence alignment

Penicillium chrysogenum, ï r x E Locus

-4PPENDtS G - P m IV,USB

Penicillium chrysogenum, c r x B iccüs

CLÜSTAL X (1.8) m u l ~ i p l e sequence aliqnment 30i +-----

XGGAGY XGVAGG AGGAGG

AGSAGÇ AGGAGG AGGAGG AGGAGG AGGAGY .=.GG.z-GG 7

--

7

-F

.-.W~.-IZGL'

.XGAGC AGGAGU AGGAGG AGG>.GG AGGAGG AGYAGG

XYAGY AGGAGG AGGAGG AGGAGG AGGRGG .AGGJ.GG AGYAGG .XGAGC. AGGAGG AGBAGG AGGAGG AGGAGG

AGYAGG * W . * * *

-WPEIù'DK G - Part n',~KSB

G-4-41

Loading...

STUDIES ON INDOOR FUNGI

STUDIES ON INDOOR FUNGI James Alexander Scott .\ diesis submtred in conformity with the requirements for the degrec of Doctor of Phdosop hy in .\.l...

28MB Sizes 1 Downloads 47 Views

Recommend Documents

No documents